Background
Asthma is a heterogeneous chronic disease of the airways characterized by airway inflammation, reversible airway obstruction, and airway hyperresponsiveness (AHR) [
1,
2]. Their etiologies are still elusive, because they involve complex interactions between environmental, genetic and immunoregulatory factors. With the progress of the researches, asthma can be divided into eosinophilic asthma (EA) and non-eosinophilic asthma (NEA) according to the presence of granulocytes in the sputum and T-helper cytokine responses [
3‐
6]. A majority of asthmatic patients with eosinophilic inflammation can be well treated by inhaled corticosteroids [
7]. However, some with neutrophilic inflammation are often poorly responsive to corticosteroid therapy even at high doses and therefore are at risk of developing refractory asthma [
8,
9]. Currently, there are no effective treatments for severe, steroid-resistant and neutrophilic asthma and these patients take up more than half of health care costs [
10,
11]. The precise molecular mechanisms leading to neutrophilic inflammation in asthma remain unclear. Thus, understanding the regulatory pathways that control aberrant immune responses in the lung is important to our understanding of neutrophilic asthma pathogenesis.
MiRNAs are small, endogenous, single-stranded, and noncoding RNA molecules that are approximately 18 ~ 22 nt and regulate post-transcriptional gene expression. By complementary base pairing to the 3′ untranslated regions (UTRs) of target genes, microRNAs could lead to mRNA degradation or translation repression of their target genes [
12‐
14]. More recently, the crucial role of miRNA has been implicated in various immunological and inflammatory disorders. Emerging evidences also have revealed the specific miRNA profiles in the development of bronchial asthma, such as miR-16, miR-21, miR-126, miR-145 et al. [
15‐
18]. Recently, miR-223 has been reported to emerge as critical regulators of the response to bacterial stimulation and the immune system [
19,
20]. MiR-223 was transcribed from an independent promoter and shown to be specifically expressed in the hematopoietic system [
21]. Furthermore, miR-223 played critical roles in the inflammatory diseases by regulating different gene transcription factors, including C/EBPa, NOD-like receptor activation, the ubiquitin ligase Roquin, E2F1, and the NF-κB pathway [
22‐
26]. Recent studies have demonstrated that miR-223–3p was upregulated in sputum of severe asthma and was highest in neutrophilic asthma [
27]. However, there are lack of mechanistic studies clarifying how miR-223-regulated gene expression shape airway inflammation in neutrophilic asthma.
The Nod-like receptor protein 3 (NLRP3), a member of NLRs family NLRP3s, which consists of three main proteins, including NLRP3 scaffold, regulatory molecule caspase-1 and apoptosis-associated speck-like protein containing a CARD (ASC), has emerged as a crucial regulator of chronic inflammatory disease [
28,
29]. It mediated the activation of caspase-1 in response to microbial ligands, and then cleaved and activated pro-interleukin (IL)-1β and pro-IL-18 to active forms and promotes their secretion [
28]. Recent studies have suggested that NLRP3 inflammasome signaling was involved in the pathogenesis of asthmatic inflammation. And the upregulation of NLRP3 and IL-1β in sputum correlated with neutrophilic airway inflammation [
30,
31]. Although miR-223 has been proven to suppress NLRP3 expression through combining with the 3′ UTR of NLRP3 [
25,
32,
33], the role of miR-223 in the regulation of lung NLRP3 during neutrophilic asthma remains unclear.
In this current study, we aimed to determine whether miR-223 played roles in the regulation of airway inflammation and to investigate the underlying molecular mechanisms in neutrophilic asthma. Our data indicated that miR-223 was upregulated in lung tissues of experimental mice model. miR-223 deficient mice led to aggravated airway inflammation and enhanced NLRP3 inflammasome levels with elevated IL-1β. Collectively, we propose that miR-223 acts as a key rheostat that regulates airway inflammation in neutrophilic asthma.
Methods
Mice
Wide-type (WT) mice (CD45.1+C57BL/6 mice, 6-8 weeks) were obtained from the Center for Animal Experiments of Wuhan University (Wuhan, China), and were used for the experiments 1 week after arrival. CD45.1+miR-223−/− mice were purchased from the Jackson Laboratory. All experimental mice were bred in an approved containment facilities with specific pathogen-free food and water under 12 h light/dark cycle. Experiments were approved by the Institutional Animal Ethics Committee of Wuhan University.
Induction of neutrophilic asthma model
The experimental protocol for neutrophilic asthma was performed as previously reported [
34]. Mice were sensitized on day 0 with 20 μg of grade V ovalbumin (OVA, Sigma Aldrich, St. Louis, MO, USA) emulsified in 75 ul CFA (Sigma Aldrich) by intraperitoneal (i.p.) injection. On days 21 and 22, all mice were challenged with aerosols consisting of 1% OVA (grade III). Control mice received phosphate-buffered saline (PBS) only. The highly selective NLRP3 blocker, MCC950 (200 mg/kg dissolved in PBS, i.p.) [
35] and IL-1β receptor antagonist, anakinra (50 mg/kg dissolved in PBS, i.p.) [
36] were given to the OVA/CFA-sensitized miR-223
−/− mice immediately after each challenge, respectively. Control mice were treated with the same volume of PBS for comparison. Mice were sacrificed 24 hours after the final OVA challenge, and then serum, bronchoalveolar lavage fluid (BALF), lungs were collected for subsequent analysis.
Agomirs
MiR-223 agomir is a chemically modified oligonucleotide that can be widely used to upregulate the endogenous expression of miR-223 in animal experiments. Agomirs for miR-223 and the negative control were ordered from RiboBio (Guangzhou, China). The sequence of miR-223 agomir were not provided by RiboBio. miR-223 agomirs (5 nmol in 50ul saline) and negative control agomir were administered intranasally on days 20, 21 and 22 [
37,
38]. Control mice were treated with the same volume of saline for comparison.
Bronchoalveolar lavage
The tracheas and lungs were lavaged 3 times via a syringe with 0.5 ml PBS containing 0.6 mM EDTA, as previously described [
39]. The BALF was centrifuged at 1500 rpm for 7 min at 4 °C and the BALF supernatant was stored at − 80 °C for cytokine analysis. The recovered BALF cells were prepared by cytocentrifugation (TXD3 cytocentrifuge, Xiangyi, Changsha, China) and were stained with Wright-Giemsa (Jiangcheng Bioengineering Institute, Nanjing, China) for differential cell counts (neutrophils, eosinophils, lymphocytes). Four hundred cells were counted for each slide.
Lung histopathology
The left lung lobe of each animal was resected and fixed in 4% paraformaldehyde buffer for at least 24 h, then dehydrated and embedded in paraffin. Lung sections were cut into 5-um thickness, and were stained with haematoxylin and eosin (H&E) and periodic acid-Schiff (PAS) to assess airway inflammation, goblet cell hyperplasia and mucus secretion at 200× magnification by microscope. Four sections were assessed per lung.
And a scale was used to semi-quantitatively evaluated the severity of peribronchial and perivascular inflammation, as previously described [
40]. The extent of mucus production and goblet cell hyperplasia in the airway epithelium was assessed by calculating Apas+/Pbm using Image Pro Plus 6.0 (IPP 6.0) software [
41].
AHR measurement
Mice were anesthetized with 1% pentobarbital and mechanically ventilated, and AHR was measured by using the animal lung function instrument (Buxco Electronics, Troy, NY, USA), as previously described [
42]. Briefly, incremental concentrations of methacholine (ranging from 3.125 to 50 mg/ml) were intratracheally delivered by an attached nebulizer. Baseline airway resistance was assessed using nebulized PBS. Total lung and airway resistance index (RI) were then calculated by the instrument.
Quantitative RT-PCR
Total RNA was isolated from lung tissue using TRIzol (Invitrogen/Thermo Fisher Scientific, Inc., Carlsbad, CA, USA). Complementary DNA (cDNA) synthesis was performed with a miRNA specific primer using Thermo Scientific RevertAid First Strand cDNA Synthesis Kit according to the manufacturer’s manual. Amplification was performed using qPCR with SYBR Premix Ex TaqTM (Takara Bio Inc., Otsu, Japan). All primers were provided by Sangon Biotech (Shanghai, China), and the primers sequences of target genes are presented in the Table
1. The cycle threshold (Ct) of miRNAs were normalized to the Ct of endogenous U6, whereas GAPDH was used to normalize the expression levels of mRNA. The relative gene expression was calculated by the 2
-ΔΔCq method.
miR-223 | GCGCGTGTCAGTTTGTCAAAT | AGTGCAGGGTCCGAGGTATT |
U6 | CTCGCTTCGGCAGCACA | AACGCTTCACGAATTTGCGT |
NLRP3 | GACCAGCCAGAGGTGGAATGA | CTGCGTGTAGCGACTGTTGA |
ASC | CACCAGCCAAGACAAGATGA | CTCCAGGTCCATCACCAAGT |
Caspase-1 | AACAGAACAAAGAAGATGGCACA | CCAACCCTCGGAGAAAGAT |
IL-1β | AGTTGACGGACCCCAAAAG | CTTCTCCACAGCCACAATGA |
IL-18 | TGGAGACCTGGAATCAGACA | TGGGGTTCACTGGCACTT |
GAPDH | TGTGTCCGTCGTGGATCTGA | TTGCTGTTGAAGTCGCAGGAG |
Western blot
To measure the proteins expression of NLRP3, ASC, Caspase-1, IL-1β and IL-18, lung tissues were infiltrated in tissue protein regent with RIPA Lysis Buffer and protease inhibitor (Beyotime Institute of Biotechnology, Haimen, China). The protein concentrations were measured using BCA Protein Assay kit (Thermo Fisher Scientific) following the protocol. The total proteins were separated by 10% SDS-PAGE and then transferred onto a PVDF membrane (Millipore Corp., Billerica, MA, USA). The membranes were blocked with 5% non-fat milk in TBST solution for 2 h at room temperature. The PVDF membranes were subsequently incubated with primary antibodies against NLRP3, ASC, Caspase-1, IL-1β and IL-18 (Abcam, Cambreidge, UK) at 4 °C overnight. After three times washes in TBST for 15 min each, the membranes were incubated with HRP-conjugated secondary antibodies at 37 °C for 2 h. Immunoreactive images were captured with an enhanced chemiluminescence kit according to the manufacturers’ protocol and were detected using the ChemiDocTM Imaging System (Bio-Rad). GAPDH was used as an internal reference.
Cytokine analysis
The levels of IL-4, IL-5, IL-13, interferon gamma (IFN-γ), IL-17A, IL-22, IL-23, IL-1β and IL-18 in BALF were measured using enzyme-linked immunosorbent assay (ELISA) kit (eBioscience, San Diego, CA, USA) according to the manufacturers’ protocols.
Dual-luciferase reporter assay
To determine the target relationship between miR-223 and NLRP3 mRNA, a luciferase reporter assay was performed using 239 T cells co-transfected with a NLRP3–3’UTR fusion vector and miR-223 mimic, inhibitor and corresponding negative control. Cells were harvested after 48 h, and the luciferase levels were detected using a Dual-Luciferase Reporter Assay System (Promega) according to the manufacturers’ instructions.
Statistical analysis
Data analyses were performed with Student’s t-test or Analysis of Variance (ANOVA) using SPSS 17.0 software (SPSS; IBM, Armonk, NY, USA). Data were presented as means ± standard deviation (SD). P < 0.05 was regarded as statistical significance. All experimental data were repeated at least three times.
Discussion
Although the importance of miRNAs in the regulation of immunological processes has been recognized [
43‐
45], its specific role in the pathogenesis of neutrophilic asthma remains unclear. In this study, we demonstrated that miR-223 participated in the regulation of neutrophilic airway inflammation in the asthma model. MiR-223 expression was upregulated in the lungs of OVA-induced WT mice compared with PBS-induced WT mice, and miR-223
−/− mice exposure to OVA resulted in aggravation airway inflammation, mucus hypersecretion and the production of Th2 and Th17 cytokines. In addition, OVA-induced miR-223
−/− mice exacerbated AHR, another important feature of asthma [
46]. Moreover, both NLRP3/caspase-1 and IL-1β levels were higher in the lungs of OVA-induced miR-223
−/− mice compared with those in PBS-induced WT mice. Intranasal administration of miR-223 agomirs not only partially restored airway inflammation, mucus hypersecretion, AHR, the production of Th2 and Th17 cytokines, but also decreased the expression levels of NLRP3/caspase-1 and IL-1β releases. Collectively, these findings suggested that miR-223 played a crucial role in regulation of neutrophilic airway inflammation, and involved in the pathogenesis of neutrophilic asthma.
MiRNAs, small non-coding RNA molecules, have been identified in the development and responses of the immunological and inflammatory disorders. It has been described that unique miRNA expression profiles participate in different phenotypes of asthma [
27]. Previous studies have showed that miR-223–3p, miR-142-3p, and miR-629-3p expression were increased in the sputum of neutrophilic asthmatic patients [
27]. Similarly, altered miR-223 expression in the bronchial epithelial brushings of patients with mild asthma was reported by Solber et al. [
47]. MiR-223 was reported to be emerged as a negative regulator of neutrophils activation in many experimental models of inflammatory diseases. Neutrophils were anticipated to be closely related to the underlying pathophysiology of severe asthma [
48‐
51]. An earlier study by Johnnidis et al. addressed that miR-233 played a regulatory role on neutrophil function [
21], which indicated that miR-223 might exert effects on the neutrophilic asthma. Inconsistent with the above results, another study showed that miR-223 expression in asthma was showed to be down-regulated [
52] or no alternation in bronchial biopsy specimens of patients with mild asthma, severe asthma and healthy controls [
53,
54]. Thus, whether miR-223 participates in the pathogenesis of neutrophilic asthma is still unclear. In this present study, we performed experiment mice model to investigate the potential role of miR-223 in neutrophilic asthma. Our results demonstrated that miR-223 expression was higher in the lungs of neutrophilic asthma mice compared with those in control mice. This finding was in accordance with prior studies. Moreover, we found the deletion of miR-223 aggravated airway inflammation in the OVA-induced neutrophilic asthma mice model. It may be that when asthma occurs, protective factors and harmful factors played roles at the same time. And the occurrence of asthmatic airway inflammation was the result of counterbalance between favorable factors and harmful factors. miR-223 might play a protective role in asthma, so airway inflammation was exacerbated after miR-223 was knocked out. Therefore, these findings showed that miR-223 may be involved in the pathogenesis of neutrophilic asthma.
IL-1β, a potent inflammatory cytokine, was involved in multiple chronic inflammatory diseases, including chronic obstructive pulmonary disease (COPD) and asthma. Recent studies have showed that overexpression of IL-1β and IL-18 might play central roles in the pathogenesis of neutrophilic asthma [
31,
55‐
58]. Inhibition of IL-1β activity by administration of neutralizing antibody or deletion of the IL-1 receptor type I abrogated the progression of asthma, and administration of recombinant IL-1β replicated the markers of neutrophilic asthmatic inflammation [
59]. IL-18 knockout mice exhibited decreased neutrophilic inflammation and airway remodeling in OVA-induced asthma [
60]. In this present study, we found that the expression of IL-1β and IL-18 in BALF were significantly upregulated in neutrophilic asthma group compared with those in control group, which were consist with the findings of other recent studies [
61,
62], implying that IL-1β and IL-18 participated in the pathogenesis of neutrophilic asthmatic inflammation.
Caspase-1, an endogenous cysteine protease and the effector of inflammasome, was required for the cleavage and activation of pro-IL-1β and pro-IL-18, which was involved in inflammation. As caspase-1 activating platforms, inflammasome played a central role in multiple inflammatory diseases, including neutrophilic asthma [
28,
58]. Among them, NLRP3 inflammasome was the most fully characterized that dominated the main auto-activation of caspase-1. Kim et al. showed that blockade of NLRP3 in steroid-resistant murine asthma potently inhibited the neutrophilic airway inflammation and AHR, suggesting that NLRP3/caspase-1 played central roles in the pathogenesis of refractory asthma [
30,
59]. In this present study, we detected the protein levels and mRNA expression of NLRP3 and caspase-1 in the lung tissues of neutrophilic asthma. Our findings showed that the expression of NLRP3 and caspase-1 increased in the lungs of neutrophilic asthma group compared with those in control group, which were consist with the results of other studies [
30,
35]. Administration of MCC950, a highly specific small-molecule inhibitor of NLRP3 inflammasome, significantly suppressed NLRP3 expression levels and caspase-1 activity, alongside with the reduction of IL-1β and IL-18 release, resulted in the diminution of neutrophilic airway inflammation and hyperresponsiveness, indicating that NLRP3/caspase-1/IL-1βsignaling axis was involved in the pathogenesis of neutrophilic asthma.
NLRP3 inflammasome-dependent, IL-1β-mediated IL-17 responses have been associated with neutrophilic airway inflammation and AHR [
63,
64]. OVA/CFA-induced asthma was characterized by a large number of neutrophils infiltration in the airways representing Th17-dominant responses and weaker TH2 responses. In the present study, we found that treatment with MCC950 significantly inhibited both Th2 (such as IL-4, IL-5, IL-13) and Th17 (such as IL-17A, IL-22, IL-23) responses in neutrophilic asthma, and reduced the infiltration of neutrophils and eosinophils into the airway and AHR. Anyway, treatment with MCC950 exerted similar effects to IL-1 antagonist [
65], implying that NLRP3/ caspase-1/ IL-1β axis was involved in both Th2 and Th17 responses induced by OVA. This was in agreement with other studies showing that blockade of NLRP3 inhibited both eosinophilic and neutrophilic inflammation in severe asthma [
30,
59]. Collectively, these evidences suggested that inhibition of NLRP3/ caspase-1/IL-1β axis diminished neutrophilic airway inflammation through restraining Th2 and Th17 responses.
Agomir, a chemically modified oligonucleotide, has been widely used to upregulate the endogenous expression of miRNAs in vivo [
66]. Previous studies found that NLRP3 inflammasome activity was negatively controlled by miR-223, which played a role in inflammatory diseases [
23,
25,
67,
68]. In this present study, miR-223 overexpression with agomirs attenuated airway inflammation, AHR and pro-inflammatory cytokines production. MiR-223 agomirs could effectively suppress the mRNA and protein expression of NLRP3, but miR-223 deficiency largely promoted the mRNA and protein expression of NLRP3. Blockade of NLRP3 resulted in significant repression of airway inflammation and pro-inflammatory cytokines production, mimicking the biological effects of miR-223 overexpression. Dual-luciferase reporter assay was performed to verify the interaction between NLRP3 and miR-223 as previously descripted [
23], the data demonstrated that miR-223 directly targeted on the 3’UTR of NLRP3 mRNA. In light of these finds, it will be interesting to reveal that miR-223 regulates the neutrophilic airway inflammation by directly regulating the expression of NLRP3 and may be a potential target for the treatment of neutrophilic asthma in the future.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.