Background
Esophageal squamous cell carcinoma (ESCC) is one of the frequently occurring digestive malignant diseases in China [
1,
2]. Patients with ESCC have higher mortality rates and 5-year survival rate is lower mainly because of local invasion, lymph node and distant metastasis [
1]. Precise mechanisms of ESCC invasion and metastasis remain unclear, so further studies on the potential mechanisms involved in invasion and metastasis are critical for the improvement of prognosis for patients with ESCC.
MicroRNAs are about 22 nucleotides non-coding RNAs which can attach to their target mRNAs’ 3’UTR, by this way, to regulate the translation and stability of the target mRNAs through the action of the RNA-induced silencing complex [
3‐
5]. In many kinds of cancers including ESCC, abnormal expression of microRNAs has been found. Furthermore, the abnormal expression of microRNAs has also been shown to be associated with tumor development [
6,
7]. In addition, abnormal microRNAs expression has also been implicated in affecting metastatic and progression stage of cancers by the acquisition of metastatic potential [
8‐
10].
MiR-424-5p is located on human chromosome Xq26.3, and recently has been classified in a large cluster together with miR-15/miR-16 [
11]. However the expression of MiR-424-5p in different types of tumors suggested unequal roles. Zhang et al had demonstrated that miR-424-5p expression was significantly reduced in the liver cancer tissues compared with that of the corresponding non-cancerous liver tissues and down regulation of miR-424-5p in HCC tissues was also related to advanced disease progression in HCC patients [
12]. While, Wu et al showed that miR-424-5p was significantly up regulated in pancreatic cancer [
13].
Until now, great efforts had been made to identify the association between microRNAs expression and ESCC and to understand the functional role and molecular mechanism of aberrant-expressed microRNAs [
14,
15]. The potential of some candidate microRNAs for clinical diagnosis and prognosis was revealed, and treatments involving microRNAs achieved some amazing curative effects in cancer disease models [
16,
17]. However, the expression levels and role of miR-424-5p in ESCC had not been fully elucidated. Here, our findings provided evidence that miR-424-5p was a tumor suppressor gene in ESCC. Furthermore, we found that miR-424-5p perhaps played its role through negatively regulating SMAD7 signaling pathway. Taken together, miR-424-5p rescue might be a rational for diagnostic and therapeutic applications in ESCC.
Methods
Patients and tissue samples
Thirty-two pairs of ESCC tumor and adjacent normal mucosa in paraffin-embedded blocks were acquired from the First Affiliated Hospital of Zhengzhou University. No patients had received radiation therapy or chemotherapy before surgery. Two senior pathologists made and agreed upon the histological diagnosis of ESCC tissues. The paired ESCC tumor and adjacent normal mucosa areas of block were carefully dissected and transferred to RNase-free tube for RNA extraction.
Cell culture and transfection
Esophageal squamous cell lines: EC9706, Eca109, EC-1 and immortal embryonic esophageal epithelium: SHEE cells were all cultivated in RPMI-1640 medium with 10 % FCS, at 37 °C in a 5 % CO2 humidified incubator. RPMI-1640 medium was replaced every 2–3 days. Transfection was typically carried out on cells that were 80 % confluent. Mature miR-424-5p mimics or control oligotides were purchased from Dharmacon Inc. 50 nM miR-424-5p mimics were transfected into EC-1 cells using Lipofectamine™ 2000 (Invitrogen) according to the manufacturer’s protocol. At the same time, EC-1 cells transfected with control oligotides or vacant EC-1 cells were used as negative or blank controls respectively. PcDNA3.1-SMAD7 transfection was done after the EC-1 cells trsfected with miR-424-5p mimics or control oligotides, EC-1 cells transfected with miR-424-5p mimics, pcDNA3.1-SMAD7 separately or vacant EC-1 cells were used as controls.
Total RNA, including microRNA was extracted from tumor and corresponding normal tissue in paraffin-embedded blocks using either TriReagent or mirVana miRNA isolation Kit according to the manufacturers protocol. The RNA was resuspended in 20 μl RNase-free water and stored at −20 °C. The quantity and quality of RNA were assessed by spectrophotometric and standard electrophoresis methods.
Reverse transcription and real-time PCR
To examine the levels of miR-424-5p expression, TaqMan® miRNA Reverse Transcription kit were used to generate cDNA from miRNAs. Quantitative real-time PCR methods were used to measure the expression level of miR-424-5p using the TaqMan® MicroRNA Assay protocol specific for miR-424-5p. Relative expression values of miR-424-5p were calculated by the CT-based calibrated standard curve method. RNU6B miScript Primer Assay was used as an endogenous control. All of the experiments were done in triplicate.
To quantify the mRNA expression of SMAD7, vimentin, E-cadherin, transScript First-strand cDNA Synthesis SuperMix kit were used to generated cDNA from total RNA. Quantitative real-time PCR were then conducted using STBR Premix Ex Taq™ kit with the following primers: SMAD7 sense: GGAGTGGGGAGGAGTGAGTA, antisense: TCTTTTGTGGCCCACGTCTC; E-cadherin sense: ATGCTGATGCCCCCAATACC, antisense: GCTGTGAGGATGCCAGTTTC; vimentin sense: GGACCAGCTAACCAACGACA, antisense: AAGGTCAAGACGTGCCAGAG; β-actin sense: CTGAGGCTCTTTTCCAGCCT, antisense: CGCTCAGGAGGAGCAATGAT. The CT values were determined by setting a fixed threshold. The relative amount of mRNA was normalized to β-actin. All of the experiments were done in triplicate.
Western blot assay
EC-1 cells in different groups were harvested and lysed for protein extraction. The concentration of protein was calculated with a BCA protein assay kit. Fifty microgram proteins were separated by SDS-PAGE, and the proteins were transferred by electro method to PVDF membranes. Subsequently, the PVDF membrane was blocked in 5 % fat-free milk for 2 h. Then, the PVDF membrane was incubated with the primary antibody against SAMD7, vimentin, E-cadherin and β-actin at 4 °C overnight. After that, the PVDF membrane were washed, and incubated with horseradish peroxidase-labelled secondary antibody for 1 h. After exposure and development, the protein expression was analyzed using a gel imaging analysis system. The Western blot assay was in triplicate.
Transwell invasion assay
The invasion ability of EC-1 cells was measured by transwell invasion assay. Briefly, EC-1 cells in different groups cultivated with RPMI-1640 medium without FCS were put on the upper chamber coated with Matrigel. RPMI-1640 medium with 20 % FCS as chemoattractants were put to the lower chamber of the 24-well pates. After 48 h incubation, cotton swabs were used to wipe off the cells from the upper chamber. The number of cells migrating to the lower chamber was calculated by inverted microscopy after hematoxylin and eosin (HE) staining. And the number of and the mean of number of cells in each field represented the invasive ability of the cells. All of the experiments were done in triplicate.
Wound healing assay
EC-1 cells were seeded into 12-well plates and cultured to 70 % confluence. One millimeter width wounds were made with a plastic tip, and EC-1 cells were cultivated in a serum-free RPMI-1640 medium. EC-1 cells migrated into wound place, then after 48 h the average distance of migrating cells was measured under an inverted microscopy.
Cell proliferation assay
Cell proliferation ability was measured using the MTT assay. In brief, cells were placed into 96-well plates (BD Biosciences) at a cell density of 1 × 103 cells/well in growth medium. 24, 48 and 72 h after transfection, 100 μl of fresh serum-free RPMI-1640 medium with 0.5 g/l MTT replaced RPMI-1640 medium in each well. After incubation for 4 h at 37 °C, the MTT medium was removed and 50 μl of DMSO was added to each well. The staining intensity in each group was measured by detecting the absorbance at 450 nm. All of the experiments were done in triplicate.
Luciferase activity assay
The pmir-REPORT system was used to determine whether SMAD7 was a target of miR-424-5p. The wild-type SMAD7 3’UTR luciferase reporter vector (pmirGLO-SMAD7-WT) was constructed by amplifying 3’UTR of the SMAD7 gene and then cloning them into the Hind III and Spe I sites of pmirGLO-control vector and amplified in chemically competent DH5α. Site-directed mutagenesis kit (Promega) were used to made the mutant type of SMAD7 3’UTR luciferase reporter vector (pmirGLO-SMAD7-MUT). All constructs were verified by sequencing. MiR-424-5p mimics or control oligotides, 100 ng luciferase reporter plasmid were cotransfected into EC-1 cells in 6-well plates. After 24 h, cells were lysed and luciferase activity was measured using a Dual-Luciferase Reporter Assay System (Promega).
Statistical analysis
The database was determined by the SPSS 11.0 software for analysis. Data were showed as mean ± SD. Student’s T-test was always performed between two sets of data. The criteria for T-test significance was based on the two-tailed distribution and for paired or equal variance type. A p-value of <0.05 was viewed as statistically significant.
Discussion
Lately, miRNAs have been shown to regulate tumor invasion, metastasis, providing for us a new view on the invasion process [
18]. MiR-424-5p had been showed to participate in various cellular processes especially the invasion and metastasis processes [
12]. Nonetheless, there had been no reports on the expression and role of miR-424-5p in ESCC.
In this study, the expression of miR-424-5p was examined in paraffin-embedded blocks. We showed that the expression of miR-424-5p were greatly lower in ESCC tissues compared with those in adjacent normal mucosa tissues. Furthermore, the three kinds of ESCC cell lines (EC9706, Eca109 and EC-1) we chose were also showed lower expression levels of miR-424-5p compared to that in SHEE cells, stating clearly that the loss of miR-424-5p might be a common event in tumorigenesis. Strikingly, the expression of miR-424-5p were also greatly lower in ESCC tissues with lymph node metastasis, compared to that without lymph node metastasis, indicating that the expression of miR-424-5p might be negatively linked to metastasis in ESCC.
Based on these, we supposed that miR-424-5p might play an important role as a tumor suppressor in the invasion and metastasis in ESCC. We then performed functional analyses to study on the role of miR-424-5p in the invasion and metastasis ability of EC-1 cells (expressed the lowest miR-424-5p levels in the three kinds of ESCC lines) transfected with miR-424-5p mimics. As expected, in our real-time PCR analysis of the EC-1 cells, miR-424-5p expression was markedly up-regulated in EC-1 cells transfected with miR-424-5p mimics compared to those in negative and blank control. In addition, miR-424-5p overexpression dramatically inhibited EC-1 cells invasion and metastasis ability. Cell proliferation ability of EC-1 cells transfected with miR-424-5p mimics was also decreased. These results further validated our suggestion that miR-424-5p might function as a tumor suppressor and played an important role in inhibition on the invasion and metastasis of ESCC cells. By detecting the expression of miR-424-5p can perhaps help us to tell the possibility of invasion and metastasis.
As part of our research on how the down-regulation of miR-424-5p influenced EC-1 cells invasion and metastasis, we used TargetScan and PicTar to identify target genes of miR-424-5p. This approach allowed us to verify SMAD7 as a potential target of miR-424-5p. We performed 3’UTR luciferase assay, and observed that luciferase activity was decreased after co-transfection of miR-424-5p mimics and a pmirGLO-SMAD7-WT. We also demonstrated that restoration of miR-424-5p expression levels tightly regulated SMAD7 expression and further confirmed that SMAD7 as a direct target of miR-424-5p. SMAD7 was initially isolated as an oncogene and was the downstream mediator of transforming growth factor beta (TGF-β), which is an important multifunctional cytokine that regulates cell proliferation and progression [
19‐
21]. TGF-β-SMAD7 signaling pathway has been showed to be a key signaling pathway of epithelial-mesenchymal transition (EMT) in cancers [
22,
23]. EMT was viewed as the first step in cancer invasion and metastasis, a number of evidences had recently confirmed that some microRNAs were involved in this process [
24]. In the current study, we demonstrated that with the restoration of miR-424-5p, the expression of epithelial marker E-cadherin which was also a hall marker of the occurrence of EMT was increased while the expression of mesenchymal marker vimentin decreased. In addition, overexpression of SMAD7 could enhance the EMT weakened by miR-424-5p mimics. These results indicated that miR-424-5p could also take part in EMT in ESCC cells and miR-424-5p perhaps participated in EMT in ESCC cells via the SMAD7 signaling pathway.
Conclusion
Our data indicated that down-regulated miR-424-5p was implicated in ESCC tissues and cell lines, particularly in ESCC tissues with lymph node metastasis. In addition, we demonstrated the function role of miR-424-5p in invasion and metastasis in EC-1 cells by up-regulating miR-424-5p expression levels in EC-1 cells. Finally, we elucidated overexpression of miR-424-5p decreased EC-1 cells invasion and metastasis through mechanisms involving SMAD7 signaling pathway and EMT. We are now investigating the role of SMAD7 signaling pathway in miR-424-5p mediated EMT and the potential role of miR-424-5p as prognostic and predicative biomarkers in ESCC.
Acknowledgements
The authors sincerely thank Dr. Qingxia Fan at Zhengzhou University for her valuable suggestions.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (
http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.