Study subjects
Polish Caucasians were divided into the young (Y,
n = 56, age range 20–39 years, mean age 27.8 ± 3.7 years, 29 females, 27 males), elderly (E,
n = 52, 60–73 years, 65.4 ± 3.4 years, 25 females, 27 males), and long-lived (L,
n = 48, 90–102 years, 94.2 ± 3.7 years, 31 females, 17 males) age groups (Table
1). They were non-obese, without signs and symptoms of current infection, and without history of myocardial infarction, stroke, type 2 diabetes mellitus, cancer, or neurodegeneration. However, in the E and L groups moderate hypertension was allowed, and some study participants belonging to the L group had a mild degree physical or cognitive disability. Physical performance and cognitive functioning were assessed during recruitment for the study with the Activities of Daily Living (ADL) scale [
34] and Mini-Mental State Examination (MMSE) [
35], respectively. The following cut-offs were used for physical performance: ADL score 5–6 – independent, 3–4 – partially dependent, 0–2 – totally dependent, and for cognitive functioning: MMSE score 28–30 – normal cognition, 24–27 – minimal cognitive impairment, 20–23 – mild, 10–19 – moderate, <10 – severe cognitive impairment. Fifteen percent of elderly and 41% of long-lived individuals were taking low-dose acetylsalicylic acid. All participants gave a written informed consent for participation in the study. The anonymity of patients has been preserved at all stages of this investigation. The study protocol was approved by the Bioethics Committee of the Medical University of Warsaw.
Table 1
Basic clinical and biochemical parameters of the elderly and long-lived study subjects
Agea (years) | 65.6 ± 3.4 | 94.2 ± 3.8 |
BMIa (kg/m2) | 28.1 (25.7, 30.10) | 25.3 (21.9, 28.6) |
Fasting glucosea (mg/dl) | 90.2 (81.1, 96.7) | 87.5 (83.8, 92.5) |
Total cholesterola (mg/dl) | 203.2 (177.1, 239.85) | 173 (151.8, 203.9) |
HDLa (mg/dl) | 56 (49.5, 62.3) | 51.9 (47, 67.1) |
IL-6a (pg/ml) | 1.5 (0.8, 2.8) | 2.9 (1.4, 4.6) |
CRPa (mg/l) | 1.9 (1.1, 4.1) | 2.4 (1.5, 10.7) |
MMSEa | 29 (27, 29) | 19 (17, 26) |
ADLa | 6 (6, 6) | 6 (4, 6) |
Real-time quantification of gene expression and of miRNA expression
The expression of IGF-1R, FOXO1 and of FOXO3 was analyzed with semi-quantitative real-time PCR using the LightCycler 480 SYBR Green I Master kit (Roche Diagnostic, Mannheim, Germany) in the Light Cycler 480 (Roche Diagnostic, Mannheim, Germany). The primers for IGF-1R were: forward 5’TGAAAGTGACGTCCTGCATTTC3’ and reverse 5’GGTACCGGTGCCAGGTTATG3’, for FOXO1: forward 5’TGGACATGCTCAGCAGACATC3’ and reverse 5’TTGGGTCAGGCGGTTCA3’, and for FOXO3a: forward 5’GAACGTGGGGAACTTCACTGGTGCTA3’ and reverse 5’GGTCTGCTTTGCCCACTTCCCCTT3’. The reaction was carried out as follows: 5 min at 95 °C, 45 cycles of 12 s at 95 °C, 12 s at 60 °C and 12 s at 72 °C, followed by a melting curve cycle. The results were normalized against the expression of the ACTB gene. Each reaction was performed in duplicate.
To evaluate the expression of miRNAs, a real-time PCR was performed with the miRCURY LNA™ Universal RT microRNA PCR system and SYBR Green kits (EXIQON, Vedbaek, Denmark) in the Light Cycler 480, according to the manufacturer’s protocol. The reaction conditions were: 10 min at 95 °C, 50 cycles of 10 s at 95 °C, 1 min at 60 °C, followed by melting curve cycle. The results were normalized against the expression of endogenous control U6 snRNA. Each reaction was performed in duplicate.
Functional analysis of miRNA
Candidate miRNAs were searched for using
in silico analysis with the TargetScanHuman [
42], miRanda-mirSVR [
43] and the Pictar [
44] programs. Using this approach, we selected miR-96, miR-99a, miR-145, and miR-182 for
IGF-1R mRNA, and miR-9, miR-96, miR-132, miR-145, and miR-182 for
FOXO1 mRNA.
DNA corresponding to the 5’ end (721 bp) of 3’UTR of IGF-1R mRNA was amplified with Dream Taq polymerase (Thero Scientific, Vilnius, Lithuania) with forward 5’ACTAGAGCTCGACCTGCTGATCCTTGG3’ (added SacI restriction site shown in bold, the STOP codon is underlined) and reverse 5’TAAGCTCGAGAGCTGTCTCTCAAATGG3’ (additional XhoI restriction site shown in bold) primers. The PCR reaction conditions were: 4 min at 94 °C, 5 cycles of 1 min at 94 °C, 1 min at 56 °C, 3 min at 72 °C, 35 cycles of 1 min at 94 °C, 1 min at 60 °C and 3 min at 72 °C, and final extension for 10 min at 72 °C. The PCR product was cloned into the pmirGLO reporter vector (Promega, Madison, WI, USA) and sequenced (pmirGLO_IGF-1R_5’ reporter vector). DNA corresponding to the 3’ end (1327 bp) of 3’UTR of IGF-1R mRNA was cloned with forward 5’ACTAGAGCTCCACTGAGGCACATCATGG3’ (added SacI site is shown in bold) and reverse 5’TAAGCTCGAGAGTGATCGTTATGTTCTCGC3’ (added XhoI site is shown in bold) primers. The PCR conditions and cloning (pmirGLO_IGF-1R_3’ reporter vector) were the same as above.
DNA corresponding to the 5’ end (1201 bp) of 3’UTR of FOXO1 mRNA was cloned using forward 5’ACTAGAGCTCTGTCAGGCTGAGGGTTAG3’ (added SacI site is shown in bold, the STOP codon is underlined) and reverse 5’CTAACTCGAGCTTGATGCTATGCAGTACG3’ (added XhoI site is shown in bold) primers, while for cloning of the 3’ end of this mRNA (1358 bp) the starters were forward 5’ACTAGAGCTCCTCTATCATCCTCATTTTGG3’ (added SacI site is shown in bold) and reverse 5’TAAGCTCGAGGGCTGACAAGACTTAACTC3’ (added XhoI site is shown in bold). Both fragments were amplified under the following PCR conditions: 4 min at 94 °C, 5 cycles of 1 min at 94 °C, 1 min at 56 °C, 3 min at 72 °C, 35 cycles of 1 min at 94 °C, 1 min at 58 °C and 3 min at 72 °C, and final extension for 10 min at 72 °C, and then cloned (pmirGLO_FOXO1_5’ and pmirGLO_FOXO1_3’ reporter vectors, respectively) and sequenced.
HEK 293 cells were cultured in a 96-well dish in Dulbecco Modified Eagle’s medium (Sigma Aldrich, St. Louis, MO, USA) supplemented with 10% heat-inactivated fetal bovine serum, without antibiotics, in a humidified incubator with 5% CO2, at 37 °C. Cells were transfected at 80% confluency with 0.5 μl lipofectamine 2000 (Invitrogen, Life Technologies, Carlsbad, CA, USA) in 50 μl Opti-MEM I medium (Gibco, Life Technologies, Grand Island, NY, USA) without serum, according to the lipofectamine manufacturer’s protocol. Eighty ng of pmirGLO with or without cloned 3’UTR-encoding DNA and 5 pmol of pre-miRNA (pre-miR-96, pre-miR-182 or pre-miR miRNA Precursor Negative Control #2 for IGF-1R, and pre-miR-145, pre-miR-132 or pre-miR miRNA Precursor Negative Control #2 for FOXO1, Ambion, Life Technologies, Carlsbad, CA USA) were used. Cells were then cultured for 24 h without changing medium, washed with phosphate-buffered saline, and lysed for 15 min with 20 μl Passive Lysis Buffer (Promega, Madison, WI, USA) on a rocking platform. The luminescence was assessed in the Centro XS3 LB 960 luminometer (Berthold Technologies, Bad Wilbad, Germany). The luminescence of firefly luciferase substrate was normalized against that of Renilla luciferase substrate. Each experiment was repeated 15 times.