Introduction
Cationic host defense peptides (HDPs) are naturally occurring effector molecules of innate immunity. These peptides are 12 to 50 amino acids in length, with a net positive charge ranging from +2 to +7 with up to 50% hydrophobic amino acids [
1]. HDPs exhibit a wide variety of immunomodulatory functions and delicately modulate inflammatory responses without compromising the elements of immunity required for resolution of infections [
2‐
8]. HDPs exhibit anti-inflammatory effects by suppressing certain pro-inflammatory pathways, upregulating anti-inflammatory mechanisms (for example, IL-10), and intervening in the activation of nuclear factor (NF)-κB via multiple mechanisms [
3]. A broad spectrum of cationic HDPs are expressed in human synovium tissues with differential expression patterns under inflammatory conditions [
9]. However, the role of HDPs in synovium biology is not well characterized. It has been suggested that induction of HDPs by vitamin D may play a role in the protection against autoimmune diseases such as rheumatoid arthritis (RA) [
10]. Therefore, HDPs and their derivatives are attractive candidates for modulating the inflammatory responses in chronic inflammatory disorders, including in inflammatory arthritis.
HDPs are widely diverse in sequence and structure, and this wide repertoire provides an extensive template for designing short synthetic peptides with optimized activities and reduced cytotoxicities [
11‐
13]. The synthetic variants of HDP are known as innate defence regulator (IDR) peptides [
14]. Two IDR peptides, IDR-1 and IDR-1002, have been shown to protect against infections largely by modulating innate immune responses of the host and upregulating anti-inflammatory mechanisms [
15,
16]. To our knowledge, no studies to date have investigated the potential of IDR peptides in limiting inflammation in immune-mediated chronic inflammatory disorders such as inflammatory arthritis.
The complex pathophysiology of arthritis involves synergistic interplay primarily between mesenchymal cells such as fibroblast-like synoviocytes (FLS) and immune cells (for example, macrophages and T-lymphocytes). Activation of FLS by pro-inflammatory cytokines results in the production of inflammatory cytokines, chemokines, and matrix-degrading matrix metallopeptidases (MMPs), which lead to the destruction of articular cartilage and bone [
17]. TNF-α and IL-1β are two inflammatory cytokines that are well defined as critical inflammatory mediators in arthritis [
18]. TNF-α is proposed to be the dominant pro-inflammatory cytokine in the inflammatory manifestations of synovitis, whereas IL-1β is thought to be important in the destructive potential of chronic joint inflammation [
19,
20]. IL-1β induces the production of MMP-3 in cell types such as FLS, chondrocytes, and macrophages in arthritic joints, and the subsequent elevated level of MMP-3 mediates cartilage and bone destruction, directly contributing to the pathogenesis of the disease [
21]. Efficacious therapeutic strategies have been developed to target each of these cytokines. Despite this, a major consideration regarding therapeutic agents targeting inflammatory cytokines such as TNF-α is the increased associated risk of infections and neoplasm [
22,
23]. This highlights the need for the development of alternate strategies for the management of chronic inflammatory arthropathies. We hypothesized that one such strategy would be to examine the use of selectively immune-modulatory agents such as IDR peptides [
24].
In this study, we demonstrated that a 12-amino-acid IDR peptide, IDR-1002 [
16], suppressed IL-1β-mediated cellular responses in human FLS, especially MMP-3 and MCP-1 production. However, IDR-1002 did not neutralize all IL-1β-induced chemokine responses that are required for resolution of infections. In contrast, this peptide enhanced the production of negative regulators of IL-1β (for example, IL-1-receptor antagonist (IL-1RA). These observations were consistent with the paradigm of the selective anti-inflammatory mechanism of host defense and IDR peptides [
3,
15,
16]. We explored the molecular mechanism of regulation of IL-1β-induced responses by IDR-1002 in FLSs, by using quantitative proteomics and other immunochemical assays. We demonstrated that IDR-1002 suppressed IL-1β-induced NF-κB, c-Jun kinase (JNK), and p38 mitogen-activated protein kinase (MAPK) activation in synovial fibroblasts. This study provides a rationale for further examining the use of IDR peptides as potential therapeutics for the management of inflammatory arthritis and possibly other diseases characterized by chronic inflammation.
Materials and methods
Cell isolation and culture
Synovial tissues were obtained from patients with osteoarthritis (OA) or rheumatoid arthritis (RA) with informed consent in accordance with a protocol approved by the Institutional Review Board at the University of Manitoba. Human FLS were isolated from the synovial tissues, as previously described [
25]. In brief, the tissues were digested with 1 mg/ml collagenase and 0.05 mg/ml hyaluronidase (Sigma Aldrich) in Hanks' balanced salt solution (Gibco; Invitrogen Inc., Burlington, ON, Canada) for 1 to 2 hours at 37°C. Cells were washed and cultured in DMEM media (Gibco), supplemented with sodium pyruvate and nonessential amino acids (referred to as complete DMEM media henceforth) containing 10% (vol/vol) fetal bovine serum (FBS) in a humidified incubator at 37°C and 10% CO
2. Isolated human FLS (
ex vivo) were seeded at 2 × 10
4 cells/ml, either 0.5 ml per well in 48-well tissue-culture plate, or 3 ml per well in six-well tissue-culture plate, as required, and cultured in complete DMEM media containing 10% (vol/vol) FBS overnight. The following day, the culture media was changed to complete DMEM containing 1% (vol/vol) FBS before the addition of the various stimulants. A rabbit synoviocyte cell line HIG-82 (ATCC CRL-1832) was cultured in Ham's F-12 growth medium containing glutamine (Gibco) supplemented with sodium pyruvate (referred to as complete F-12 media henceforth), containing 10% (vol/vol) FBS in a humidified incubator at 37°C and 5% CO
2. Confluent human FLS or HIG-82 cells were trypsinized with 1:3 dilution of 0.5% trypsin-EDTA (Invitrogen) in Hanks' balanced salt solution. Cellular cytotoxicity was evaluated by monitoring the release of lactate dehydrogenase (LDH) by using a colorimetric detection kit (Roche Diagnostics, Laval, QC, Canada).
Peptides and recombinant cytokines
Recombinant human cytokines TNF-α and IL-1β were obtained from eBioscience, Inc (San Diego, CA, USA). IDR-1002 peptide (VQRWLIVWRIRK-NH2) [
16] was synthesized by using F-moc chemistry at the Nucleic Acid/Protein Synthesis Unit of University of British Columbia, Vancouver, BC, Canada, and IDR-1 peptide (KSRIVPAIPVSLL-NH2) [
15] was obtained from GenScript USA Inc. (Piscataway, NJ, USA). The peptides were resuspended in endotoxin-free water, aliquoted, and stored at -20°C. Based on previous studies demonstrating the anti-inflammatory and anti-infective properties of the IDR peptides, in
in vitro cell studies and
in vivo models of various infections models [
15,
16], and on preliminary dose-titration studies, standard doses were used for IDR-1002 (100 μg/ml) and IDR-1 (200 μg/ml) for all experiments.
ELISA and multiplex flow cytometry
Tissue culture (TC) supernatants were centrifuged at 1,500 g for 7 minutes to obtain cell-free samples, aliquoted, and stored at -20°C until further use. Production of MMP-3 was monitored by using Quantikine human MMP-3 (total) ELISA kit (R&D Systems, Inc. Minneapolis, MN, USA), as per the manufacturer's instructions. Production of IL-1RA was monitored in the TC supernatants by using specific antibody pairs from eBioscience, Inc. The production of chemokines IL-8, RANTES, MIG, MCP-1, IP-10 was determined by using a preconfigured multiplex BDCytometric Bead Array (CBA) human chemokine kit by using the FACS Calibur flow cytometer (BD Biosciences, Mississauga, ON, Canada) as per the manufacturer's instructions. The concentration of the cytokines or chemokines in the TC supernatants was evaluated by establishing a standard curve with serial dilutions of the recombinant human cytokines or chemokines, as required.
Quantitative real-time (qRT-PCR)
Human FLS were stimulated with either IL-1β (10 ng/ml), IDR-1002, or the combination of IL-1β and IDR-1002, for 2 hours. RNA was isolated by using the Qiagen RNeasy kit as per the manufacturer's instructions. Gene expression was subsequently analyzed with qRT-PCR by using SuperScript III Platinum Two-Step qRT-PCR Kit with SYBR Green (Invitrogen), according to the manufacturer's instructions, in the ABI PRISM 7300 sequence-detection system (Applied Biosystems). Fold changes were calculated by the comparative Ct method [
26], after normalization with 18sRNA. The list of primers used is shown in Table
1.
Table 1
Summary of primers used for quantitative real-time PCR
IL-1RA | ttggaaggctctgaacctca | ctgaaggcttgcatcttgct |
SIGIRR | ctcagagccatgccaggt | cctcagcacctggtcttca |
18sRNA | gtaacccgttgaaccccatt | ccatccaatcggtagtagcg |
Quantitative proteomics using isobaric tag for relative and absolute quantitation (iTRAQ)
Amine-modifying iTRAQ reagents multiplex kit (Applied Biosystems) was used for relative quantitation of proteins in human FLS stimulated with IL-1β in the presence and absence of IDR-1002 compared with unstimulated (control) cells. Human FLS (2 × 104/ml) were seeded in a total volume of 3 ml per well in a six-well tissue-culture plate in complete DMEM media containing 10% FCS. The cells were allowed to adhere overnight. The following day, the media was changed to 3 ml complete DMEM containing 1% FCS per well. The cells were either unstimulated or treated with IL-1β (10 ng/ml) in the presence or absence of IDR-1002. The peptide was added 45 min before stimulation with IL-1β. After 24 hours of stimulation, the cells were washed with cold PBS and lysed in 250 μl of buffer containing 10 mM Tris-HCl pH 7.5, 150 mM NaCl, 2 mM EDTA, 1% NP-40, and protease inhibitor cocktail (Sigma-Aldrich), on ice for 30 minutes with intermittent vortexing. Cells were centrifuged at 10,000 g for 10 minutes at 4°C. Total protein content was estimated in each cell lysate by using micro BCA assay (Pierce; Thermo Scientific, Rockford, IL, USA) with a bovine serum albumin (Sigma-Aldrich) standard curve. The samples were acetone precipitated at -20°C overnight. Proteins were dissolved in 20 μl of iTRAQ dissolution buffer (Applied Biosystems) and further processed as per the manufacturer's instructions. In brief, proteins were reduced and the cysteines blocked by using the reagents in the kit, followed by digestion of the protein samples with provided trypsin solution overnight at 37°C. The trypsin-digested protein samples were labelled with the iTRAQ isobaric tags as follows: unstimulated (control) sample was labeled with iTRAQ isobaric tag 115; IL-1β-stimulated sample, with tag 116; and the isobaric tag 117 was used for labeling the sample obtained from cells treated with IL-1β in the presence of IDR-1002. The contents from each of the iTRAQ reagent-labeled sample was combined together in 1:1 ratio and processed for nanoflow liquid chromatography coupled to tandem mass spectrometry (LC-MS/MS) by using a QStar Elite mass spectrometer (ABSciex, Toronto, ON, Canada).
Monitoring activation of NF-κB
Rabbit synoviocyte HIG-82 cells were transiently transfected with pNFκB-MetLuc2-Reporter Vector (Clontech Laboratories Inc., Mountain View, CA, USA) or the provided control vector as per the manufacturer's instructions. Various stimulants were added to the transfected cells in culture media containing 1% (vol/vol) FBS. The cells were stimulated with recombinant human IL-1β in the presence and absence of IDR-peptides, either IDR-1002 or IDR-1, for 6 hours. The peptides were added at the time of cytokine stimulation. The activation of NF-κB was monitored by using the Ready-To-Glow Secreted NF-κB Luciferase Reporter Assay (Clontech) as per the manufacturer's instructions.
Human OA FLS were stimulated with IL-1β in the presence and absence of IDR-peptides, IDR-1002 and IDR-1. The peptides were added either 45 minutes before, or at the time of cytokine stimulation. Nuclear extracts were prepared by using NE-PER extraction reagents (Thermo Fisher Scientific) as per the manufacturer's instructions. Nuclear extracts (5 μg) were resolved on 4% to 12% NuPAGE Bis-Tris gels (Invitrogen) and probed with antibodies specific for either NF-κB subunit p50 (Cell Signaling Technology) or antibody to β-actin (Thermo Fisher Scientific) by using immunoblots.
Monitoring functional JNK activity
Human FLS (5 × 10
4/ml) were seeded in a total volume of 20 ml per 75-cm
2 tissue-culture flask in complete DMEM media containing 10% (vol/vol) FBS for each condition. The cells were allowed to adhere overnight. The next day, the media was changed to 10 ml complete DMEM containing 1% (vol/vol) FBS. The cells were either unstimulated or treated with IL-1β (10 ng/ml) in the presence or absence of IDR-1002 for 15 minutes. IL-1β is known to induce JNK activation after 15 minutes in human FLSs [
27]. Total protein concentration was evaluated for each cell lysate by using micro BCA (Thermo Scientific). Kinase activity specific to JNK was monitored by using the JNK activity assay kit (Abcam Inc.) as per the manufacturer's instructions. In brief, 20 μg of total protein per cell lysate was used for immunoprecipitation (IP) by using a JNK-specific antibody. The eluate was treated with c-Jun substrate and ATP mixture. Subsequent phosphorylation of the c-Jun substrate was evaluated by probing immunoblots with anti-phospho-c-Jun (Ser73)-specific antibody.
Monitoring p38 MAPK activity
Human FLS (5 × 10
4/ml) were seeded in a total volume of 20 ml per 75-cm
2 tissue culture flask in complete DMEM media containing 10% (vol/vol) FBSs for each condition, allowed to adhere overnight, followed by changing the media to 1% (vol/vol) FBS. The cells were either unstimulated or treated with IL-1β (10 ng/ml) in the presence or absence of either IDR-1002 or IDR-1 for 15 minutes. The peptides were added either (a) 45 minutes before cytokine stimulation, or (b) simultaneous with cytokine stimulation. The p38 MAPK activation has been demonstrated in human FLSs on stimulation with IL-1β for 15 minutes [
28]. Total protein concentration was evaluated for each cell lysate by using micro BCA (Thermo Scientific). Kinase activity specific to p38 MAPK was monitored by using the p38 MAPK activity assay kit (Cell Signaling Technology) as per the manufacturer's instructions. In brief, 10 μg of total protein per cell extract was used for IP by using a p38 MAPK-specific monoclonal antibody. Kinase activity was evaluated by treating the IP eluates in the presence of ATP and kinase substrate ATF-2 fusion protein. Phosphorylation of the substrate ATF-2 was monitored with Western blot by using a phospho-ATF-2 (Thr76) antibody.
Immunoblots
The IP eluates or nuclear extracts were electrophoretically resolved on a 4% to 12% NuPAGE Bis-Tris gels (Invitrogen Corporation), followed by transfer to nitrocellulose membranes (Millipore). The nitrocellulose membranes were blocked with TBST (20 mM Tris pH 7.5, 150 mM NaCl, 0.1% Tween 20) containing 5% (vol/vol) skimmed milk powder. Affinity-purified HRP-linked anti-rabbit secondary antibody was used for detection. The membranes were developed with Amersham ECL detection system (GE Healthcare, Baie d'Urfe, QC, Canada) according to the manufacturer's instructions.
Microscopy
A modified IDR-1002 was synthesized by incorporating a C-terminal cysteine (IDR-1002C) to allow the presence of a thiol group for biotinylation of the peptide. IDR-1002C was biotinylated, as previously described [
29]. In brief, IDR-1002C was biotinylated by using desthiobiotin polyethyleneoxide iodoacetamide (Sigma) as per the manufacturer's instructions. Biotinylated IDR-1002 peptide (IDR-1002B) was purified by HPLC and confirmed by using MALDI mass spectrometry. To facilitate monitoring cellular uptake of the peptide, 150 μl of human FLS (2 × 10
4/ml) was seeded in 96-well glass-bottom Nunc plates in DMEM containing 10% (vol/vol) FBS, overnight. The following day, the media was changed to DMEM containing 1% (vol/vol) FBS. The cells were stimulated with IDR-1002B (100 μg/ml) for 0, 15, or 30 min. The cells were fixed by using 2% (vol/vol)
para-formaldehyde, the reaction quenched with 10 m
M ethanolamine and permeabilized with 0.1% Triton × 100. The cells were washed in PBS and blocked with 3% (vol/vol) FBS in PBS. The cells were stained for actin by using Alexa Fluor 546 phalloidin (Invitrogen) and stained with Streptavidin Alexa Fluor 488 conjugate (Invitrogen) to detect biotin. The cells were counterstained with Hoescht 33258 (Invitrogen) for nuclear staining.
Discussion
In this study, we examined the use of innate immune-modulatory IDR peptides in limiting IL-1β-induced inflammatory responses in synovial fibroblasts. We demonstrated that a 12-amino-acid IDR peptide, IDR-1002 [
16], controlled IL-1β-induced inflammatory responses in synovial fibroblasts largely by intervening with IL-1β-induced NF-κB, JNK, and p38 MAPK activation. A recent study demonstrated the ability of IDR-1002 to protect against bacterial infections largely by modulating host immune responses [
16]. A distinct advantage of the class of IDR peptides is the likelihood that these agents can control inflammation while maintaining elements of innate immunity required for efficient anti-infective mechanisms [
3,
14,
15,
46], which is speculated to be distinct from current anti-TNF therapies.
In this study, we showed that IDR-1002 significantly suppressed IL-1β-induced MMP-3 and MCP-1 protein production in FLS. MMP-3 (stromelysin 1) is known to be elevated in both OA and RA, and it promotes the destruction of matrix components of the joints [
21]. MCP-1 is a monocyte chemoattractant highly expressed in the synovial fluid and tissues of RA patients [
47]. Production of MCP-1, either by macrophages or by FLS, results in an autocrine or paracrine stimulation of cells within the synovial microenvironment, resulting in overall extracellular matrix degradation [
48]. For example, MCP-1 increases collagenase activity and induces MMP-3 release from chondrocytes [
48]. Therefore, significant suppression of IL-1β-induced production of both MMP-3 and MCP-1 in human FLS demonstrates the therapeutic potential of IDR-1002.
We showed that even though IDR-1002 significantly suppressed IL-1β-induced MMP-3 production (Figures
1 and
3a), and chemokine MCP-1 production (Figure
3b), the peptide did not significantly suppress the expression of an anti-infective neutrophil chemokine (that is, IL-8 production in human FLS; Figure
3c). In contrast, IDR-1002 induced gene expression of endogenous inhibitor of IL-1β (for example, IL-1RA (Figure
2c) and enhanced IL-1β-induced production of IL-1RA protein (Figure
2b) in human FLS). It should be noted that recombinant IL-1RA (anakinra) has been extensively explored as a potential therapy for RA [
33]. This selective and differential modulation of inflammatory responses by the IDR-peptide is consistent with previous studies. For example, both HDP and IDR peptides can modestly induce classic pro-inflammatory responses, such as certain chemokine production in macrophages required for anti-infective immunity [
3,
15,
16]. In contrast, these peptides significantly induce anti-inflammatory mediators such as IL-10 [
3,
15,
16]. These peptides result in a net balancing of inflammation. In this study, we showed such "selective" modulation of cytokine-mediated inflammatory response by IDR-1002 in synovial fibroblasts. Thus, based on previous study [
16] and this study, we can speculate that IDR-1002 can exhibit a targeted immune-modulatory activity on both immune cells (for example, macrophages [
16]), and mesenchymal cells, such as FLS.
We demonstrated that IDR-1002 modulated IL-1β-induced responses in synovial fibroblasts primarily by intervening with the activation of JNK and p38 MAPK (Figure
4) and NF-κB (Figure
5) signaling pathways. In this study, it was demonstrated that IDR-1002 suppressed IL-1β-induced proteins that are regulated by the JNK and NF-κB pathways (Additional file
1, Table S2). Consistent with this, by using immunochemical assays, we showed that IDR-1002 abrogated both IL-1β-induced JNK and p38 MAPK activity in human FLS (Figure
4), and significantly suppressed the IL-1β-induced activation of NF-κB in synovial fibroblasts (Figure
5). These results are consistent with previous studies that have demonstrated that both HDP and IDR-peptides can influence MAPK pathways and selectively modulate pathogen-induced NF-κB regulation [
3,
15,
16,
49]. IL-1β-induced JNK and p38 MAPK are critical in the induction of MMPs and subsequent tissue destruction in arthritis [
42,
50]. Consequently, both JNK and p38 MAPK are defined as a valuable therapeutic targets for arthritis [
51‐
53]. It should be noted that HDP (for example, the human cathelicidin LL-37) by itself can transiently and differentially activate the NF-κB subunits [
49]. However, in this study, IDR-1002 did not induce NF-κB activity by itself in synovial fibroblasts at the time point monitored (Figure
5a). Taken together, this is consistent with the paradigm of "selective" immunomodulation of inflammatory responses by HDP and IDR-peptides (that is, suppression of excessive activation of NF-κB in the presence of exogenous infectious/inflammatory stimuli, while maintaining transient NF-κB activity), overall resulting in a net balanced inflammation.
An interesting observation from the computational analysis of the proteomics data in this study was the implication of the involvement of transcription factor HNF-4α-targets in IDR-1002-mediated anti-inflammatory activity (Additional file
1, Table S2). A publication in 2009 by Chenomx Inc. describing the analysis of serologic metabolite profiles in RA, demonstrated the interconnectedness between the IL-1β-induced inflammatory protein networks and the transcription factor HNF-4α-mediated signaling. The modulation of HNF-4α-target elements by IDR peptides warrants further investigation [
54].
In this study we also demonstrated cellular uptake and cytosolic localization of IDR-1002 in human FLS (Figure
6). Cellular uptake and endocytic mobilization of cationic HDP has been shown in monocytic cells and epithelial cells, and it was previously suggested that cellular uptake may be essential for immune-modulatory activity for cationic peptides [
43,
44]. Even though some intracellular interacting protein partners and putative cell-surface receptors have been identified for both human HDP LL-37 and IDR-1 [
29,
43,
55], the mechanism of receptor interaction for IDR peptides is yet to be completely elucidated. A recent study suggested that IDR-1002 activity may be mediated by a Gi-coupled receptor [
16]; however, no direct interacting protein partner or receptor has been defined for IDR-1002. Taken together, based on previous studies and this study, we can speculate the action of IDR-1002 on FLS as follows. IDR-1002 may be internalized by FLS either interacting with putative cell surface receptors or, more likely, by inserting directly into the cell membrane, as proposed by previous studies for cationic peptides [
45,
56]. A vesicle-mediated uptake pathway, as previously implicated for HDP [
44,
45,
56], is likely to facilitate the internalization of IDR-1002, and subsequent interaction with putative intracellular interacting protein partners or receptors, as described for other HDP and IDR peptides [
29,
43]. Identification of intracellular receptors for IDR-1002 in mesenchymal cells such as human FLS warrants further investigation and is beyond the scope of this article. Interaction of the peptide with putative intracellular protein partners may be facilitating alteration of innate immune signaling pathways, overall resulting in the modulation of inflammatory responses by IDR-1002 in synovial fibroblasts. Results from this study provide evidence that supports further research into the development of IDR-peptides as potential therapeutics in immune-mediated chronic inflammatory diseases such as RA.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
ETB performed all experiments, except proteomics and microscopy, and contributed to writing the manuscript. KGC performed all experiments, except proteomics and microscopy. DNDL performed the microscopy experiments. JPC performed the computational analysis for the proteomics data. REWH provided the IDR-1002 peptide and edited the manuscript. HEG provided tissues for isolation of human FLS, provided intellectual input, and edited the manuscript. NM conceived the study, performed the proteomics iTRAQ experiments, and wrote the manuscript. All authors contributed to the conception and/or acquisition of data and analysis for this project, and to either drafting or revising the manuscript.