Background
The number of blood group antigens currently recognized by the International Society of Blood Transfusion is 360, and 322 of them are clustered within 36 blood group systems [
1]. The Rh blood group system is the most complex among all blood group systems [
2]. The D (RH1) antigen is the most immunogenic and clinically significant antigen, which directly affects the hemolytic transfusion reaction and hemolytic diseases of fetuses and newborns [
2,
3]. Besides D-positive and D-negative, RhD blood groups have multiple variants, including weak D, partial D and DEL phenotype [
4]. A Working Group of the American Association of Blood Banks and College of American Pathologists published a proposal to use the term “serologic weak D phenotype” to distinguish the results of serological weak D testing using anti-human globulin with those of weak D genotyping based on molecular methods [
5,
6].
The genetic alterations of
RHD alleles differentially influence the RhD protein expression level and the number of RhD epitopes [
7]. Weak D and most DEL have all D epitopes; partial D lack one or more D epitopes [
3]. Anti-D production in RhD negative recipients transfused with blood from weak D, particle D and DEL donors has been reported [
8‐
11]. Therefore, it is of great significance to accurately determine a serologic weak D phenotype. Nearly all serologic weak D phenotypes can be traced back to changes at the DNA level, including nonsense mutations, missense and synonymous mutations, frame shifts, unequal exchange, gene exchange and gene deletion, as well as others. This enables us to study the molecular mechanism of a serologic weak D phenotype at the gene level, and to determine the type of serologic weak D phenotype.
To date, more than 460
RHD alleles have been registered and nominated [
12‐
14]. Serologic weak D phenotypes are often found in the blood samples of blood donors and patients, and molecular studies have been mainly conducted in Caucasian and African populations [
15‐
23]. Corresponding research on the diversity of serologic weak D phenotypes has been reported in southern [
24‐
28], but rarely in northeastern populations in China. Herein, we tested samples from a cohort of 132,479 blood donors in northeastern China for the serologic weak D phenotype. We subsequently sequenced the
RHD gene of the 45 samples identified in this study as showing a serologic weak D phenotype. We built and optimized three-dimensional (3D) models of serologic weak D phenotypes identified in this study to explore their effect on RhD protein structure. Bioinformatics tools were employed to provide computational predictions on the RhD protein structure of serologic weak D phenotypes and enhance our understanding of how mutations affect phenotypes at the same time.
Materials and methods
Study participants
All 132,479 samples were collected from blood donors at the Blood Center of Liaoning Province, which is located in northeastern China, over a 5-year period (January 2012 to December 2016). Some donors may have donated repeatedly, which is common in similar large studies of the past and is known not to affect the statistics and conclusions. The study was approved by the Ethics Committee of the Liaoning Blood Center, Liaoning, China.
Serological studies
The D antigen was serologically determined using a monoclonal anti-D reagent (IgM, Clone BS226, Bio-Rad Medical Diagnostics GmbH Industriestrabe, Germany) using a microplate test protocol and a fully automated blood grouping instrument (Hemo-Type automatic blood group analyzer; GSG Robotix, Milan, Italy). For the microplate test protocol and testing in a fully automatic blood grouping instrument, 6 μL of whole blood from a sample tube was added to 333 μL of 0.9% saline in a test tube and mixed. An erythrocyte suspension (35 μL) was absorbed to a micropore and mixed with 25 μL of anti-D reagent in accordance with the manufacturer’s instructions.
We retested all samples showing negative or equivocal agglutination by tube method with three commercially available anti-D reagents (1-IgM/IgG blend, Clone D175-2 and D415 1E4, Dominion Biologicals Ltd., Dartmouth, Nova Scotia, Canada; 2-IgM/IgG blend, Clone P3X61, P3X21223B10, P3X290 and P3X35, Diagast Ltd, Loos, France; 3-IgM/IgG blend, Clone TH-28 and MS-26, Merck Millipore Ltd, Livingston, UK). An indirect antiglobulin test (IAT) was performed in the case of negative reactions. RhD-negative phenotyping was performed for all samples by hemagglutination using two techniques (microtiter plate and tube); samples were not identified by serologic adsorption–elution techniques. We performed an antibody screening test for blood group alloantibodies on all D-negative and serologic weak D phenotype samples using a gel method (DiaMed-ID, microtyping system, DiaMed China Limited, Hong Kong, China). Routine Rh typing for C, c, E, and e antigens was performed by the tube method with commercial monoclonal immunoglobulin (IgM) reagents (anti-C, Clone MS-24; anti-c, Clone MS-33; anti-E, MS-80 + 258; and anti-e, Clone MS-16 + 21 + 63, Shanghai Hemo-Pharmaceutical & Biological, Inc., Shanghai, China).
Molecular analysis of genomic DNA
Genomic DNA was extracted from a 0.2 mL blood sample using a DNA whole blood isolation kit (Tiangen Biotech, Beijing, China) in accordance with the manufacturer’s instructions. The
RHD gene was sequenced in all serologic weak D phenotypes and 117 D antigen negative samples by IAT as previously described [
24]. The nucleotide sequences of all 10 exons as well as adjacent flanking intronic regions, including partial 5′ and 3′ untranslated regions (UTRs), were determined (Table
1). Genomic DNA (50 to 100 ng) was used in a 25 μL reaction mix containing 200 mM dNTPs, 0.1 mM of each specific primer, 1.5 mM MgCl
2, 1× PCR buffer, and 1 unit of GoTaq polymerase (Promega, Madison, WI, USA), supplemented with ddH
2O. The following PCR program was used: 5 min of denaturation at 95 °C, 35 cycles of 30 s at 94 °C, 30 s at 62 °C (exons 1, 3, 4, 6–10), 30 s at 58 °C (exons 2, 5), and 1 min at 72 °C, followed by a final 10-min extension at 72 °C. The PCR procedure was carried out in a PE-9700 thermal cycler (Applied Biosystems, Foster City, CA, USA). Sequencing data were analyzed with FinchTV software (Geospiza Inc., Seattle, WA, USA) and all results compared to a NCBI Reference Sequence (RefSeq) database number NG_007494.1. The amino acid alignment of RhD was analyzed by CLUSTAL X (version 2.1) and the amino acid sequences used in the analysis were obtained from a protein database (
https://www.ncbi.nlm.nih.gov/protein).
RHD zygosity was determined on all sequencing samples by the presence or absence of a hybrid Rhesus box as described [
29].
Table 1
Primers for RHD gene amplification and sequencing
E1-s(= E1-seq) | TCCATAGAGAGGCCAGCACAA | D | AJ252314 | 5′UTR − 152 to − 132 | 340 |
E1-a | GCTATTTGCTCCTGTGACCACTT | D | Z97363 | +40 to +18 | |
E2-s | TGACGAGTGAAACTCTATCTCGAT | D | U66341 | -1060 to -1037 | 1602 |
E2-a | GGCATGTCTATTTCTCTCTGTCTAAT | D/CE | U66341, AB035189 | +355 to +330 | |
E2-seq | CCTGGATTCCTTGTGATACACG | D/CE | U66341, U66340 | +227 to +206 | |
E3-s | GTCGTCCTGGCTCTCCCTCTCT | D | AB035190 | − 29 to − 8 | 219 |
E3-a | CTTTTCTCCCAGGTCCCTCCT | D/CE | AB035192, AB035191 | +39 to +19 | |
E3-seq | GGTCCCTCCTCCCAGCAC | D/CE | AB035192, AB035191 | +28 to +11 | |
E4-s | GCCGACACTCACTGCTCTTAC | D/CE | U77079, U77078 | − 36 to − 16 | 378 |
E4-a | TGAACCTGCTCTGTGAAGTGC | D | Y10605 | +194 to +174 | |
E4-seq | GGGAGATTTTTTCAGCCAG | D/CE | Y10605, Y10604 | +82 to +64 | |
E5-s | TACCTTTGAATTAAGCACTTCACAG | D | Y10605 | − 267 to − 243 | 1458 |
E5-a | TTATTGGCTACTTGGTGCC | D/CE | Z97334, AB035197 | +1024 to +1006 | |
E5-seq | AGACCTTTGGAGCAGGAGTG | D/CE | Y10605, Y10604 | − 53 to − 34 | |
E6-s(= E6-seq) | CAGGGTTGCCTTGTTCCCA | D/CE | Z97334, Z97333 | − 95 to − 97 | 274 |
E6-a | CTTCAGCCAAAGCAGAGGAGG | D | Z97334 | +41 to +21 | |
E7-s | TGCCCATCCCCCTTTGGTGGCC | D | Z97334 | − 106 to − 85 | 411 |
E7-a | CCAAGGTAGGGGCTGGACAG | D | AB035194 | +171 to +152 | |
E7-seq | GTCTCACCTGCCAATCTGCT | D/CE | Z97334, Z97333 | − 41 to − 22 | |
E8-s | GGTCAGGAGTTCGAGATCAC | D | AB035194 | − 593 to − 574 | 770 |
E8-a(= E8-seq) | GATGGGGCACATAGACATCC | D/CE | AB035196 | +97 to +78 | |
E9-s(= E9-seq) | GGTCCAGGAATGACAGGGCT | D | AB035196 | − 162 to − 143 | 530 |
E9-a | CGCTGAGGACTGCAGATAGG | D | AB035185 | +294 to +275 | |
E10-s | CAAGAGATCAAGCCAAAATCAGT | D/CE | AB035185, AB035184 | − 67 to − 45 | 381 |
E10-a | AGCTTACTGGATGACCACCA | D | X63097 | +290 to +271 | |
E10-seq | CAGTCTGTTGTTTACCAGATGTTGTTAT | D | X63097 | 3′UTR +261 to +234 | |
Statistical analysis
Allele frequencies were calculated from corresponding genotype counts. According to Hardy–Weinberg equilibrium, genotype frequency of D negative homozygote is equal to the square of the D negative allele frequency, and genotype frequency of the heterozygote (D variant and D negative) is equal to twice the product of the two allele frequencies. Allele frequencies for each molecular background of serologic weak D and D negative phenotypes were calculated.
Computational modeling of RhD protein and amino acid substitutions
The 3D structure of the RhD protein was visualized using Swiss-Pdb Viewer 4.1.0 (
https://spdbv.vital-it.ch/), which was used to generate models of the selected protein structure for the corresponding amino acid substitutions [
30,
31]. Sorting Intolerant From Tolerant (SIFT) [
32], Polymorphism Phenotyping algorithmV2 (PolyPhen-2) [
33] and Protein Variation Effect Analyzer (PROVEAN) [
34] software were used to predict the impact of amino acid substitutions on RhD protein structure.
Discussion
In the present study, we investigated the molecular characteristics of serologic weak D phenotypes in a northeastern population in China. The bioinformatics of 17 variant
RHD alleles for serologic weak D phenotypes, including two novel alleles, were analyzed. The
RHD allele distribution varies widely between Asian [
24‐
28,
47‐
49] and European centers [
15‐
21]. Differences in populations and routine serologic screening procedures employed, as well as in the molecular examinations used, may account for such differences to date, highlighting the need for standardization. In this study,
Weak D type 15, DVI Type 3 and DEL (RHD1227A) were the most prevalent D variant alleles measured in the northeastern Chinese population, which were consistent with those reported in southern Chinese population [
24,
25,
27]; however, they were rare in other populations. Therefore, the frequency of distribution of serologic weak D phenotypes varies among populations and ethnic groups.
Our tests detected two mutation types for DEL variants. One type was
RHD1227A (c.1227G > A), and the other was
weak D type 61 (c.28C > T).
Weak D type 61 was determined on the basis of weak agglutination in the IAT procedure; it was first reported in the Chinese population [
40]. The DEL
(RHD1227A) variant with very low levels of D antigen detectable only by the adsorption-elution method accounts for 10% to 33% of apparent D negative phenotypes in eastern Asia [
26,
40,
50]. As estimated, the maximum antigen site density per red cell was 36 and often no more than 22 [
51]. In this study,
RHD1227A was detected eight in 45 serologic weak D phenotypes and 28 in 117 RhD negative individuals by sequencing. Primary and second immunization of RhD negatives by
RHD1227A blood have been shown to occur [
10,
11,
52]. First, as the measure for improvement of transfusion safety in China, RhD negative individuals should be
RHD genotyped, in order to reduce the number of immunizations of RhD negatives with
RHD1227A positive blood, not identified by standard serological techniques. Second, testing of “serological weak D phenotype” donors would be of interest among donors, of higher importance in recipients. For blood samples of patients or donors with serological weak D phenotype, some are hard to determine serologically. Patients with several serologic weak D phenotypes (DFR, DV, DVI, and Weak D type 15) reported in this study have been found to develop alloanti-D [
3]. Therefore, it is necessary to identify different
RHD alleles and their frequencies in different populations. More practical investigations of Rh-related transfusion and obstetrics in China and other Asian populations are encouraged.
The 12 nonsynonymous variant mutations were dispersed throughout RhD protein, with no clustering at specific sites. They occurred in the intracellular, exofacial, and transmembraneous red blood cell membrane (Fig.
1). While weak D phenotypes derived mainly from amino acid substitutions in intracellular or transmembrane segments of RHD, partial D is located in extracellular portions of the
RHD polypeptide [
11,
35]. In this study, 12 weak D mutations were found in the intracellular and transmembrane region, except
weak D101G (c.101 A > G) [
25]. The possible reason is that the precise locations of the amino acid residues of RhD protein in the membrane is not yet clear; different models may predict the different locations of some amino acids [
3].The substitutions may also affect the tertiary interactions and stabilization of the RhD protein. The prediction of 3D structures showed that the space conformation of the protein was disrupted in 16 serologic weak D phenotypes. These all affect the normal assembly of the tertiary structure, resulting in an activity change of the D antigen. These results indicate that bioinformatics analysis on RhD protein can give us more interpretation of missense variants of
RHD gene.
The RHD gene coding region, splicing sites, partial introns, and 5′ and 3′ UTRs were detected in 45 samples with serologic weak D phenotypes in this study. The mutation sites of the 45 samples were all located in the coding region. At present, most studies on the serologic weak D phenotype are at the DNA level, and relevant available RNA information is not comprehensive. Therefore, the molecular mechanism(s) underlying serologic weak D phenotypes need to be further investigated. In addition, due to the relative scarcity of RhD negative samples in the Chinese population, especially that of serologic weak D phenotype samples, data about the overall characteristics of various ethnic groups in China are still relatively lacking at the present time. Therefore, increased specimen collection is an urgent problem that remains unresolved.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.