Skip to main content
Erschienen in: Gut Pathogens 1/2017

Open Access 01.12.2017 | Research

Multiple etiologies of infectious diarrhea and concurrent infections in a pediatric outpatient-based screening study in Odisha, India

verfasst von: Arpit Kumar Shrivastava, Subrat Kumar, Nirmal Kumar Mohakud, Mrutyunjay Suar, Priyadarshi Soumyaranjan Sahu

Erschienen in: Gut Pathogens | Ausgabe 1/2017

Abstract

Background

There are multiple etiologies responsible for infectious gastroenteritis causing acute diarrhea which are often under diagnosed. Also acute diarrhea is one of the major causes of morbidity and mortality among children less than 5 years of age.

Methods

In our study, fecal samples (n = 130) were collected from children (<5 years) presenting with symptoms of acute diarrhea. Samples were screened for viral, bacterial, and parasitic etiologies. Rotavirus and Adenovirus were screened by immunochromatographic tests. Diarrheagenic Escherichia coli (EPEC, EHEC, STEC, EAEC, O157, O111), Shigella spp., Salmonella spp., Vibrio cholera, Cryptosporidium spp., and Giardia spp. were detected by gene-specific polymerase chain reaction.

Results

Escherichia coli was detected to be the major etiological agent (30.07%) followed by Rotavirus (26.15%), Shigella (23.84%), Adenovirus (4.61%), Cryptosporidium (3.07%), and Giardia (0.77%). Concurrent infections with two or more pathogens were observed in 44 of 130 (33.84%) cases with a predominant incidence particularly in <2-year-old children (65.90%) compared to children of 2–5 years age group (34.09%). An overall result showed significantly higher detection rates among children with diarrhea in both combinations of two as well as three infections concurrently (p = 0.004915 and 0.03917, respectively).

Conclusion

Suspecting possible multiple infectious etiologies and diagnosis of the right causative agent(s) can aid in a better pharmacological management of acute childhood diarrhea. It is hypothesized that in cases with concurrent infections the etiological agents might be complementing each other’s strategies of pathogenesis resulting in severe diarrhea that could be studied better in experimental infections.
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​s13099-017-0166-0) contains supplementary material, which is available to authorized users.
Abkürzungen
CI
confidence interval
DEC
diarrheagenic Escherichia coli
EPEC
enteropathogenic Escherichia coli
EHEC
enterohemorrhagic Escherichia coli
STEC
shiga toxin-producing Escherichia coli
EAEC
enteroaggregative Escherichia coli
PCR
polymerase chain reaction
WHO
World Health Organization

Background

Global and national estimates clearly indicate that diarrheal disease is a major public health concern [1, 2]. According to the World Health Organization (WHO), diarrheal diseases are the second leading cause of death (~760,000 per year) in children <5 years of age. Recent studies suggested that diarrheal diseases are the leading cause of childhood deaths in developing countries. Infectious agents, viz., viruses (Rotavirus, Adenovirus, Hepatitis A&E, Norwalk), bacteria (E. coli, Salmonella, Shigella, Vibrio), protozoa (Giardia, Cryptosporidium, Cyclospora, Microsporidia, Isospora), etc., are usually responsible for serious diarrheal disease outbreaks [35]. Among these pathogens, diarrheagenic E. coli (DEC), Rotavirus, and Shigella spp. are the major contributors of childhood morbidity and mortality [68].
Globally Rotavirus is responsible for around 0.5 million-child deaths annually [9], while national estimates from India showed that Rotavirus is responsible for almost 0.1 million deaths, 0.4–0.8 million hospitalization, and 2 million outpatient visits in children <5 years of age [10]. Among DECs, enteropathogenic E. coli (EPEC) strain accounts for 5–10% of pediatric diarrhea in resource-poor countries [11]. Shigellosis, caused by enteroinvasive E. coli or Shigella spp., plays an important role in morbidity and mortality among children <5 years of age. About 125 million cases of endemic shigellosis occur every year in Asian countries [12, 13].
Also past studies from developing countries suggest Cryptosporidium to be the leading cause of parasitic diarrhea among children [3, 14], while Giardia infects 200 million people each year in developing countries such as Africa, Asia and Latin America [15]. Various studies have elucidated the prevalence of different etiological agents in children with diarrhea [1618].
Poor hygiene and sanitation condition increases the transmission dynamics of diarrheal diseases in community settings. All these diarrheal agents are transmitted either through contaminated food, water, or through the fecal oral route. However, there are limited numbers of studies focusing on multiple etiologies particularly in children with diarrhea [19, 20].
Concurrent infection with more than single pathogen might be common among children with diarrhea. Also multiple infections of diarrheal pathogens might cause more severe diarrhea compared to infection with a single pathogen, thereby complicating the treatment management procedures [17, 21]. Due to scarcity of reports on concurrent infections causing diarrhea among children from the studied province in India, we attempted to estimate the overall burden of major diarrheal pathogens and possible concurrent infections with multiple infectious agents among children in a hospital-based screening study.

Methods

Study design

This study was conducted in a tertiary care teaching hospital in Bhubaneswar, Odisha (India). Fecal samples were collected from 130 children from June 2015 to April 2016. Stool samples were collected from children considering the inclusion and exclusion criteria. Inclusion criteria were children less than 5 years of age and 3 or more than 3 diarrheal episodes in a day. Children having malabsorption, immunocompromised individuals, and patients who have undergone immune suppressive therapy and prolonged steroid treatment were excluded from our study. Fecal samples were also collected from 48 non-diarrheal children less than 5 years of age, which acted as a control group. The study protocol was reviewed and approved by the Institutional Ethics Committee. Informed consent and patient datasheets were maintained for each participant.

Sample collection and DNA extraction

From each of these participants, fecal samples were collected in a sterile vial. Samples were placed on ice and transported to lab within 4 h and processed immediately. Total fecal genomic DNA was extracted from stool using QIAamp Fast DNA stool Mini Kit (Qiagen, Germany) according to the manufacturer’s instruction. The quantity and purity of extracted DNA were measured using a Nanodrop (Epoch BioTek, USA).
Extracted DNA samples were stored at −20 °C until further processing. Bacterial genomic DNA was isolated from pure cultures of S. enterica subsp., serovar typhimurium, V. cholera, S. flexneri, and E. coli (from the repository) using blood and tissue genomic DNA isolation kit (Qiagen, Germany) as per the manufacturer’s protocol. These were used as positive controls for pathogen detection by polymerase chain reaction (PCR).

Immunochromatographic test for detecting viral pathogen

Fecal specimens were screened for the presence of Rotavirus and Adenovirus by using immunochromatographic test (Combi-Strip C-1004, Coris Bioconcept ltd- Belgium) in accordance with the manufacturer’s instructions. This is a rapid diagnostic test based on homogenous membrane system with colloidal gold particles. The test was carried out as described previously [22].

PCR assay for detecting bacterial and parasitic pathogens

Fecal genomic DNA extracted from stool was used as a template in a series of PCR amplification reactions using primers specific for each pathogen (Table 1). Bacteria-specific genomic DNA isolated from pure cultures was used as a positive amplification control in PCR screening. For detecting protozoan parasites, positive DNA control for Cryptosporidium was obtained from Christian Medical College, Vellore (India), while standard Giardia DNA was obtained from the Institute of Parasitology, University of Zurich. PCR cycling conditions for different bacterial and protozoan parasites were as follows: Initial denaturation at 95 °C for 5 min, followed by 34 cycles of denaturation of 94 °C for 30 s, annealing at primer-specific temperature at 30–45 s and extension at 72 °C for 1 min, and final extension for 72 °C for 7 min. All PCR products were subjected to 1–1.5% agarose gel electrophoresis to confirm positive samples.
Table 1
Detailed description of pathogen-specific polymerase chain reaction primers for their specific detection in stool
Pathogen
Target gene
Primer name
Primer sequence (5′ to 3′)
Tm (°C)
Size (bp)
References
Escherichia coli
EAEC
EAEC pCVD432
EAEC_pCVD432_F_11
CTGGCGAAAGACTGTATCAT
51
630
[23]
  
EAEC_pCVD432_R_12
AAATGTATAGAAATCCGCTGTT
   
EPEC
EPEC bfpA
EPEC_bfpA_F_9
TTCTTGGTGCTTGCGTGTCTTTT
53
367
[23]
  
EPEC_bfpA_F_10
TTTTGTTTGTTGTATCTTTGTAA
   
EPEC
EPEC eae gene
EPEC_eaeA_F
GACCCGGCACAAGCATAAGC
59
384
[24]
  
EPEC_eaeA_R
CCACCTGCAGCAACAAGAGG
   
STEC
EHEC vt1
EHEC_vt2_R_7
ACCGTTTTTCAGATTTT(G/A)CACATA
52
298
[23]
  
EHEC_vt2_R_8
TACACAGGAGCAGTTTCAGACAGT
   
STEC
EHEC hlyA gene
EHEC_hlyA_F
GCATCATCAAGCGTACGTTCC
57
534
[24]
  
EHEC_hlyA_R
AATGAGCCAAGCTGGTTAAGCT
54
180
 
STEC
stx1
E. coli_stx1F
ATAAATCGCCATTCGTTGACTAC
  
[24]
  
E. coli_stx1R
GGCACTGTCTGAAACTGCTCC
   
STEC
stx2
E. coli_stx2F
GGCACTGTCTGAAACTGCTCC
56
255
[24]
  
E. coli_stx2R
TCGCCAGTTATCTGACATTCTG
   
STEC
rfbE 157:H7
O157_F
CGGACATCCATGTGATATGG
52
259
[24]
  
O157_R
TTGCCTATGTACAGCTAATCC
   
STEC
H7 FLIC
H7_FLIC-R_13
GCGCTGTCGAGTTCTATCGAGC
59
625
[23]
  
H7_FLIC-R_14
CAACGGTGACTTATCGCCATTCC
   
STEC
O111 rfb region
O111_F
TAGAGAAATTATCAAGTTAGTTCC
49
406
[24]
  
O111_R
ATAGTTATGAACATCTTGTTTAGC
   
Shigella spp.
 
ShET 1
Shigella_1A_F
CAG CGT CTT TCA GCG ACA GTG TTT
57
530
[8]
  
Shigella_1A_R
AGC ATG ATA CTC AAC AGC CAG ACC
   
  
Shigella_1B_F
ATA CTG GCT CCT GTC ATT CAC GGT
   
  
Shigella_1B_R
GGA AGT GAC AGG GCA TTT GTG GAT
   
Salmonella spp.
 
Sdf I
Salmonella_sdf1_FW
TGT GTT TTA TCT GAT GCA AGA GG
53
304
[25, 26]
  
Salmonella_sdf1_RW
TGA ACT ACG TTC GTT CTT CTG G
   
Vibrio cholera
 
Vc
Vibrio_Vc_FW
GTTCGCGCTGGTGAAGGTTCA
57
192
[27]
  
Vibrio_Vc_RW
TGGCATACCAGAGTCTTTCTGTG
   
Cryptosporidium spp.
 
18 s SSU rRNA locus
18 s Morgan F
AGTGACAAGAAATAACAATACAGG
60
298
[28]
 
18 s Morgan R
CCTGCTTTAAGCACTCTAATTTTC
   
Giardia spp.
 
gdh gene
GDHeF
TCAAGCTYAAYGCYGGYTTGCGT
57
432
[29]
  
GDHiF
CAGTACAACTCYGCTCTCGG
   
  
GDHiR
GTTRTCCTTGCACATCTCC
   

Statistical analysis

To examine associations between the presence or absence of diarrheal pathogen and risk factors within the different age groups (<2 or ≥2 years) and different multiple infections in children, logistic regression was used. Residence location (rural or urban) was considered for their possible association with the occurrence of diarrheal pathogen infections. Descriptive statistics was done to calculate odds ratios and 95% confidence intervals (CI), and p values were used to infer statistical associations based on one-tailed t test (Mantel–Haenszel Chi-square statistics) using free statistical software Epi-Info (http://​www.​openepi.​com).

Results

In the present study, overall result showed the highest detection rate for diarrheagenic E. coli (DEC) followed by Rotavirus and Shigella spp. in cases with symptoms of diarrhea (Table 2). Besides DEC (30.7%), the other pathogens with a decreasing order of detection rates were Rotavirus (26.15%), Shigella (23.84%), Adenovirus (4.61%), Cryptosporidium (3.07%), and Giardia (0.7%). Different strains of DEC such as EPEC (21.53%), STEC (10.76%), EAEC (6.90%), 0157 (4.61%), and EHEC (0.77%) were detected in the stool samples from cases. All these samples were negative for Salmonella spp. and Vibrio cholera. Surprisingly DEC, Shigella spp. and Adenovirus were also detected in 20.83, 4.61, and 2.08% of the healthy control subjects, respectively (Table 2). Representative gel image and immunochromatographic test positive strips are shown in Additional file 1.
Table 2
Frequencies of detection of etiological agents causing diarrhea in children
Infectious agent detected
Method of detection
Frequency (%) of detection in
p value
Diarrheal group (n = 130)
Non-diarrheal group (n = 48)
DECa
PCR
40 (30.7)
10 (20.83)
0.1935
STEC
PCR
14 (10.76)
3 (6.25)
0.3685
EPEC
PCR
28 (21.53)
5 (10.41)
0.0975
EHEC
PCR
1 (0.77)
0
0.9434
EAEC
PCR
9 (6.9)
1 (2.08)
0.2412
O 157
PCR
6 (4.61)
1 (2.08)
0.4525
Shigella spp.
PCR
31 (23.84)
2 (4.16)
0.0086*
Rotavirusb
Immunochromatography
34 (26.15)
0
0.0135*
Adenovirusb
Immunochromatography
6 (4.61)
1 (2.08)
0.4525
Cryptosporidium spp.
PCR
4 (3.07)
0
0.4091
Giardia spp.
PCR
1 (0.77)
0
0.3652
* Statistically significant
a DEC includes all detected strains of diarrheagenic E. coli. Each of those strains were diagnosed using strain-specific primers as recommended in the previously published reports (see details as shown in Table 1)
b Rotavirus and Adenovirus were detected by Immunochromatography test using commercially procured kit (Combi-Strip C-1004, Coris Bioconcept ltd- Belgium)
Among the control subjects for which DEC was detected, the majority had infections with EPEC (10.41%) followed by STEC (6.25%), EAEC (2.08%), and O 157 (2.08%). No healthy subject was detected with Rotavirus, Giardia, Cryptosporidium spp., Salmonella spp., and Vibrio spp. The pathogen detection rates for cases and controls for each pathogen category are statistically analyzed which showed a significantly higher detection rate for Shigella spp (p = 0.0086) and Rotavirus (p = 0.0135), whereas the differences were not significant for rest of the detected pathogens.
Gender-wise distributions of diarrheal incidences for different etiological agents are shown in Table 3. The total detection rate for at least one infectious etiology among the cases with acute diarrhea was slightly lower in male patients (54.28%) than in female patients (60%). Only Rotavirus detection was significantly higher among male cases (p = 0.0003). Among all the cases with diarrhea, detection rate of DEC was slightly higher among males (31.42%) compared to females (30%). Cryptosporidium, Shigella, and Giardia were also detected with relatively higher rate in males compared to females. However, Adenovirus detection rate was moderately higher among females though the difference was not significant on statistical analysis.
Table 3
Gender-wise distribution of incidences of infectious etiologies of diarrhea in children
Total no of samples
Total no. with an infectious diagnosis
No (%) of cases tested positive for different etiologies
Cryptosporidium
Adenovirus
Rotavirus*
Shigella stx
Giardia
DEC
Male
 70
38 (54.28)
3 (4.28)
2 (2.85)
28 (40)
20 (28.57)
1 (1.42)
22 (31.42)
Female
 60
36 (60)
1 (1.66)
4 (4.66)
6 (10)
11 (18.33)
0 (0)
18 (30)
Statistics
 p value
0.5121
0.406
0.3158
0.0003
0.1749
0.5589
0.8604
 95% CI (lower, upper)
0.3937, 1.5919
0.2675, 26.0903
0.0727, 2.3316
2.2755, 15.8209
0.7734, 4.1051
0.1044, 65.3068
0.5062, 2.2595
 Odds ratio
0.7917
2.642
0.4118
6
1.7818
2.6115
1.0694
Percentages are calculated based on the total number of male and female cases with symptoms of diarrhea as included in the present study (n = 70 and 60, respectively)
DEC diarrheagenic Escherichia coli
* Statistically significant
Among cases with diarrhea, at least one infectious etiology was detected in 24 of 40 (60%) children living in rural settings in comparison to 50 of 90 (55.55%) children from urban settings. Adenovirus was more prevalent in rural children (p = 0.026) (Table 4). Cryptosporidium was also detected with higher rate among rural children when compared to urban ones (p = 0.02623). Though DEC was also detected predominantly in rural children, the difference however was not significant (p > 0.05). Among DEC, only STEC was found significantly higher (p = 0.014) in rural children (Additional file 2). In contrast, Rotavirus was more prevalent in urban children (p = 0.027). Shigella and Giardia detection rates were only slightly higher among the urban in comparison to rural children but not statistically significant (p > 0.05).
Table 4
Location-wise distribution of incidences of infectious etiologies of diarrhea
Total no of samples
Total no. with an infectious diagnosis
No (%) of cases tested positive for different etiologies
Cryptosporidium*
Adenovirus*
Rotavirus*
Shigella stx
Giardia
DEC
Rural
40
24 (60)
3 (7.5)
4 (10)
6 (15)
9 (22.5)
0 (0)
16 (40)
Urban
90
50 (55.55)
1 (1.11)
2 (2.22)
28 (31.11)
22 (24.45)
1 (1.11)
24 (26.66)
Statistics
P value
0.3190
0.02623*
0.0260*
0.0273*
0.4055
0.2525
0.0650
95% CI (lower, upper)
48.33, 65.12
0.9403, 7.907
1.921, 9.915
19.33, 34.34
17.3, 31.89
0.0, 4.657
23.46, 39.18
Odds ratio
1.2
7.216
4.889
0.3908
0.8974
0
1.833
Percentages are calculated based on the total number of rural and urban children with symptoms of diarrhea as included in the present study (n = 40 and 90, respectively)
DEC diarrheagenic Escherichia coli
* Statistically significant
The data on age group (<2 years, and 2–5 years)-wise distribution of various etiological agents in children presenting with symptoms of acute diarrhea are depicted in Table 5. We observed that Rotavirus, Shigella, and DEC were the three major etiological agents detected in children under both the age groups. Cases positive for at least one infectious etiology were higher among children <2 years of age (58.53%) in comparison to those between 2 and 5 years (54.16%) which was not significant though (p > 0.05). Of all etiologies, only Rotavirus infection was found significantly associated with children under <2 years age group (p = 0.003).
Table 5
Age group-wise distribution of incidences of different etiological agents causing diarrhea in children in diarrheal group
 
No (%) of cases under age groups
Statistical analysis
<2 years (n = 82)
2–5 years (n = 48)
p value
Odds ratio (95% CI)
At least one infectious etiology
48 (58.53)
26 (54.16)
0.316
1.195 (0.582, 2.449)
DEC
22 (26.82)
18 (37.49)
0.106
0.611 (0.285, 1.309)
Shigella flexneri
20 (24.39)
11 (22.91)
0.429
1.085 (0.468, 2.515)
Rotavirus
28 (34.14)
6 (12.49)
0.003**
3.63 (1.377, 9.57)
Adenovirus
2 (2.43)
4 (8.33)
0.079
0.275 (0.048, 1.562)
Cryptosporidium
4 (4.87)
0
0.076
Undefined#
Giardia
1 (1.21)
0
0.315
Undefined#
Percentages are calculated based on the total number of children with symptoms of diarrhea under <2 years and 2–5 years age groups (n = 82 and 48, respectively)
** Extremely statistically significant
Among the different DEC strains, EPEC was detected significantly higher in <2 years children in comparison to >2 years age group (p = 0.001) (Table 6), while no significant differences were observed on detection rates of STEC and EAEC when compared between the above two age groups. Moreover, E. coli O157 was detected with higher frequency among <2-year-old children, although statistically not significant (p < 0.28). Cryptosporidium, Giardia, and E. coli O157 were observed more predominantly in children >1 year of age (data not shown).
Table 6
Age group-wise distribution of incidences of different strains of Diarrheagenic E. coli causing diarrhea in children
 
No (%) of cases under age groups
Statistical analysis
<2 years (n = 22)
2–5 years (n = 18)
p value
Odds ratio (95% CI)
STEC
7 (31.81)
7 (38.88)
0.328
0.733 (0.198–2.704)
EPEC
20 (90.9)
8 (44.44)
0.001**
12.5 (2.226–70.18)
EHEC
1 (4.54)
0
0.275
Undefined#
O 157
4 (18.18)
2 (11.11)
0.288
1.778 (0.286–1.04)
EAEC
5 (22.72)
4 (22.22)
0.635
1.56 (0.243–10.03)
Percentages are calculated based on the total number of children with symptoms of diarrhea with detection of DEC under <2 years and 2–5 years age groups (n = 22 and 18, respectively)
** Extremely statistically significant
The detection rates and their distribution among each individual pathogen type (only a single pathogen detection) comparing cases and controls are shown in the bar graphs as in Fig. 1. There was a significantly higher rate of detection only for Rotavirus mono-infection among cases with diarrhea in comparison to the controls (p = 005014). Also the overall rate of detection of a single infection only was significantly higher among cases in comparison to control subjects (p = 0.0268).
In this study, we observed many children infected with multiple pathogens, and the detection rates under different combinations of concurrent infections are presented in Table 7. Overall result showed simultaneous detection of two or more pathogens in 30% of cases included in this study. Of a total 44 cases with co-infections, 33 had double infections, 10 had triple infection, and only 1 had infection with more than three pathogens concurrently. Surprisingly, in case of control group of 48 children with no diarrhea, co-infections were detected in 3 (6.25%) children.
Table 7
Co-infection combinations with two or more infectious etiologies detected in diarrheagenic group vs controls
Combinations of pathogens
Frequency (%) of detection cases (n = 130)
Frequency (%) of detection controls (n = 48)
Statistical analysis
Double infections
 Shigella+STEC
5 (3.84)
0
Two-tailed p value by Mantel–Haenszel Chi-square test = 0.004915*
 Shigella+EPEC
3 (2.3)
0
 Cryptosporidium+EPEC
1 (0.76)
1 (2.08)
 EPEC+O157
1 (0.76)
1 (2.08)
 Rotavirus+Shigella
7 (5.38)
0
 Adenovirus+EPEC
2 (1.53)
0
 Adenovirus+Cryptosporidium
1 (0.76)
0
 Rotavirus+EPEC
6 (4.61)
0
 Shigella+O157
2 (1.53)
0
 Shigella +EAEC
2 (1.53)
0
 Adenovirus+EAEC
1 (0.76)
0
 Rotavirus+EAEC
1 (0.76)
0
 EPEC+EAEC
2 (1.53)
0
 EPEC+STEC
0
1 (2.08)
 Double infection (total)
33 (25.38)
3 (6.25)
Triple infections
 Shigella+STEC+EPEC
2 (1.53)
0
Two-tailed p value by Mid-P exact test = 0.03917*
 EPEC+EHEC+O157
1 (0.76)
0
 Rotavirus+Shigella+STEC
2 (1.53)
0
 Rotavirus+Cryptosporidium+EPEC
1 (0.76)
0
 Rotavirus+Shigella+EPEC
1 (0.76)
0
 Rotavirus+Shigella+EPEC
1 (0.76)
0
 Shigella+STEC+EPEC
1 (0.76)
0
 Adenovirus+Shigella +EPEC
1 (0.76)
0
 EAEC+O157+EAEC
1 (0.76)
0
 Triple infection (total)
10 (7.69)
0
 Adenovirus+Shigella+STEC+EPEC+O157+EAEC
1 (0.76)
0
Two-tailed p value by Mid-P exact test = 0.7303
Combination of Pathogens (more than three infections)
 
Statistical analysis is shown considering only total number of cases and control subjects and respective co-isolation rates (double, triple, or more than three infections). In a 2 × 2 table analysis for comparison of proportions between cases and controls for double infections group, all expected values (row total X column total/grand total) were ≥5. So Chi-square analysis was recommended. For triple infections group and more than three infections one, at least one expected value (row total X column total/grand total) was <5. So Mid-P exact test was recommended rather than Chi-square (http://​www.​openepi.​com)
n total number of subjects
* Statistically significant
An overall analysis showed statistically significant differences between detection rates for combinations of two infections concurrently among cases vs controls (p = 0.004915). Co-infection of Rotavirus with Shigella was the most frequent combination, which was detected in 5.38% cases, followed by Rotavirus with EPEC (4.61%) and Shigella with STEC (3.84%). Co-infections with detection of two pathogens were detected in one healthy control child each with the following combinations, viz., EPEC with Shigella, EPEC with STEC, and EPEC with O 157.
Overall analysis also showed statistically significant differences between detection rates for combinations of three infections concurrently among cases vs controls (p = 0.03917). There were two cases each under the following combinations with triple infection: (1) Rotavirus and Shigella with STEC; (2) Shigella and STEC with EPEC. Other combinations of triple infections were detected only in one child in each combination of concurrent infections (Table 7).
Age group-wise distributions of mono-infections and multiple infections are shown in Fig. 2. Of the total 30 cases with detection of a single infection, there was a predominance under the younger age group (<2 years) children. Similar observation was recorded in case of multiple infections where majority was detected in the younger age group. There was no statistical difference when mono- and multiple infections were analyzed vs two age groups (<2 years and 2–5 years). When data were analyzed considering the cases with no infectious agent detection as control groups (30 cases under <2 years age group, and 26 cases under 2–5 years age group), two-tailed p value by Mantel–Haenszel Chi-square test = 0.0369 for single infections showed a significant difference between the two age groups for single infection.
Overall data on disease severity (only in terms of numbers of liquid motions per day) compared between two groups, i.e., cases with detection of single infection vs cases with detection of more than one infections, are presented in Table 8. Two-sample independent t test analysis revealed significantly higher number of motions per day among cases with multiple infections compared to those with single infection based on both equal variance (p = 0.001015) and unequal variance (p = 0.006885). Other major associated symptoms were vomiting (46%) and fever (23%); when the symptoms were correlated with the test positivity for different etiologies, majority of cases positive for Shigella and Rotavirus had vomiting (29%) and fever (27%) (data not shown).
Table 8
Comparison of the role of single infection vs multiple infections on average motions per day
 
n
No. of motions/day (min–max)
Mean average no
SD
Two-sample independent t test
Single infection
30
2–30
10.71
12.6
Equal variance (0.001015)**
More than one infections
44
12–25
17.5
3.2
Unequal variance (0.006885)**
n total number of cases
min minimum, max maximum
Two-sample independent t test using OpenEpi (Version 3), open source calculator revealed significantly higher number of motions per day among cases with multiple infections compared to those with single infection based on both equal variance (p = 0.001015) and unequal variance (p = 0.006885)
** Statistically extremely significant

Discussion

Infectious diarrhea is a frequent problem in low-income countries which is a leading cause of death among children under 5 years of age [3]. Though many different types of agents are reported to be associated with infectious diarrhea, DEC has however been known to be the most commonly diagnosed etiology in India [30]. The overall result in our study showed that 56.92% of the children with diarrhea were diagnosed to be positive for at least one infectious etiology among the children with diarrhea. A study in the past showed E. coli (different strains) to be responsible for as much as 25% of all diarrheal diseases in developing countries [31]. In this study, we also found DEC to be the most common diarrheal agent in the study population.
In the diarrheal group, more than 1 infectious agent was diagnosed in 44 (33.84%) cases. In our study, we found Rotavirus+Shigella to be the most frequent co-infection combination, while a previous study from Leon Nicaragua reported EAEC along with EPEC to be the most frequent co-infection [23].
The number of males suffering with diarrheal diseases was slightly more in comparison to females, which is similar to another study from India [30]. Our study showed that at least one infectious etiology in diarrhea is more frequently detected among children living in rural settings than urban settings. This may be due to the poor hygiene and sanitation conditions of rural population that posses a high risk of infection among children as recommended earlier.
In this study, the major etiological agent was identified to be DEC followed by Rotavirus and Shigella in the age group of <2 years. Study elsewhere showed DEC being responsible for acute diarrhea in 30–40% of the affected children [31]. EPEC, EAEC, and ETEC were the most common strains of E. coli detected in diarrheal diseases as reported elsewhere [23]. In our study, EPEC was found more frequent than other DEC pathotypes, while in other studies EAEC was detected more frequently [32]. Few studies have also highlighted the role of Shigella as an important etiological agent for diarrheal disease [33, 34]. In our study, we observed that Shigella was responsible for 23.84% of infection in children with acute diarrhea.
Rotavirus infection was associated with substantial hospitalization and deaths among children [7]. In our study, we observed Rotavirus as the second leading cause of childhood diarrhea. Rotavirus was also present as multiple mixed infections with other diarrheal pathogens. Previously in a study from China, co-occurrence of Rotavirus and Sapovirus, Astrovirus, ETEC, or Campylobacter jejuni was observed in children [35]. In this Chinese study, co-infections between pathogens were found to be common; especially the two pairs, Rotavirus and Adenovirus, and Norovirus GII and Salmonella were reported to be positively associated with diarrhea.
Cryptosporidium and Giardia were shown to affect children younger than five years of age in India [36]. In this study, we observed that 4.61% of diarrheal cases were due to Cryptosporidium and 0.77% of cases ware due to Giardia. Giardia lamblia was not significantly associated with diarrhea in a study from Bangladesh [37].
Few studies from Africa have reported that almost one-third of studied children were infected with bacterial pathogens and about ten percent of them were co-infections [17, 38]. In our study, we observed that about 65.90% of cases have multiple infection in children <2 years of age. We could not observe any statistical significance among mono-infections and multiple infections with respect to age group between <2 years of age and 2–5 year age group (p = 0.32). A recent study from China reported viral–bacterial co-infection in <5-year-old children [35]. In our study, we observed several mixed infections such as DEC with Shigella, Rotavirus with EPEC, and Rotavirus with Shigella. We observed that especially with Rotavirus and Adenovirus co-infections there was an increase in the diarrheal episodes per day.
Rotavirus co-infection with other enteric bacterial and protozoan pathogens was reported previously [39]. In our study, mixed infections of Cryptosporidium with Rotavirus, Adenovirus, and EPEC were observed. Cryptosporidium infection was more frequently observed in <2 year age group in comparison to 2–5 year age group, although this was not statistically significant. We could not observe any association between Cryptosporidium infection along with vomiting and fever in the infected individuals. A synergistic effect between Rotavirus and other co-infecting pathogen(s) on diarrheal disease was also reported from a Latin American study [21].
Most studies of the causes of diarrhea in low-income and middle-income countries have looked at severe disease in people presenting for care, and there are few estimates of pathogen-specific diarrheal burdens in the community. In a recent cohort study, a substantial heterogeneity in pathogen-specific burdens of diarrhea was identified where the most important determinants were revealed to be age, geography, season, vaccine usage, and symptoms [40]. Community screening was beyond scope of the present study. However, considering disease severity to be the most important criteria to access the possibility of a synergistic effect due to mixed infection in childhood diarrhea, in our study we could note an increased frequency of diarrheal episodes in cases that were diagnosed to have multiple infectious etiologies. A recent study from China also supports the above fact where virus–bacteria and virus–parasite co-infections are the aggravating factors of severe diarrhea in children [39].
There are limited number of studies in India, which can really enlighten on acute childhood diarrhea and far lesser in number when it comes to its bacterial enteropathogenesis. However, E. coli has been recorded as the predominant bacteria followed by Shigella, Salmonella, Klebsiella, and Campylobacter [29]. A study from Bangladesh identified C. jejuni, ETEC, Shigella spp., and V. cholerae O1 as major bacterial pathogens that are significantly associated with diarrhea [37], while in our study EPEC and Shigella were found to be the most common diarrheal etiological agents.
Earlier studies support increased severity of diarrhea in the presence of Rotavirus-E. coli co-infection [41, 42]. Simultaneous interaction of Rotavirus and E. coli or Rotavirus and Shigella results in a greater risk of having diarrhea than would be expected if the co-infected organism acted independently of one another [21]. Similar co-infection patterns of Rotavirus with E. coli and Rotavirus with Shigella were observed most predominately in our study population. Shigella along with several other types of bacteria has been shown to have a recycling mechanism for their peptidoglycan, which is designed to prevent its release and interact with Nod1 [43]. In our study we found Shigella infection with different other diarrheal bacterial pathogens that may be the possible reason for disease severity in the patients.
At cellular and molecular level, diarrhea is simply an altered movement of ions and water. Enteric pathogens however can alter this balance towards net secretion. Together, co-infection might cause more severe diarrhea than infection with either pathogen alone [42]. Specific co-infecting pathogens might also act synergistically resulting in even greater pathogenesis and a large contribution to an overall diarrheal disease burden. In our study, we found high prevalence of co-infection similar to the other studies reported previously [4144]. Rotavirus is mainly responsible for decreased absorption without any significant intestinal inflammation, Shigella species causes inflammatory and invasive diarrhea and EPEC alters the intestinal epithelial integrity [43]. We observed several mixed infections with all these three pathogens. On an average >10 diarrheal episodes/day in cases with concurrent infections might be due to an aggravated effect and a number of cellular mechanisms activated simultaneously by various pathogen factors. A true understanding of pathogenesis of diarrheal disease is incomplete without the thorough understanding of biological connections of these pathogens and synergistic interaction between co-infecting pathogens. We may be able to improve our understanding of the pathogenic potential of enteric infection consistently by distinguishing between single and mixed infection.
It is also important to include healthy controls in order to compare the distribution of exposure in healthy controls compared to cases as recommended elsewhere [35]. The overall result in our study showed that 20.83% cases in non-diarrheal children also had at least one infectious agent as detected in the stool specimens. Reports originated from other studies also showed the detection of some of those agents in stool samples from human subjects with no symptoms of diarrhea [25, 26]. In the non-diarrheal group, only 3 (6.25%) subjects were found positive for multiple infections. However, it is not clear why those apparently normal individuals had the infectious agents but no symptoms of diarrhea was noticed. However, the frequency of detection of any diarrheal infectious agent or multiple agents in these apparently healthy subjects were much less, compared to those in case of the symptomatic subjects as supported on statistical analysis.
The overall finding on a broad spectrum of etiological agents of diarrhea and different combinations of concurrent infections in the pediatric patients will probably aid in planning future studies on various aspects of diarrheal diseases in this population. It is hypothesized that in cases with concurrent infections, different combinations of etiological agents might be complementing each other’s strategies of pathogenesis resulting in an increased disease severity, and other complications, which is a matter of concern.

Conclusion

This hospital-based study highlighted the overall burden of major bacterial, viral, and protozoan parasites in childhood diarrhea in the study region where multiple infections in nearly one-third of the cases pose a significant question to understand the synergistic role contributed by each associated pathogen in the overall pathogenesis of diarrheal diseases. Nevertheless, the results suggested that DEC strains such as EPEC and STEC, which are normally not screened routinely, should also be suspected in childhood diarrhea. Suspecting possible multiple infectious etiologies and diagnosis of the right causative agent(s) can help in a better pharmacological management of acute childhood diarrhea. Also it is recommended to address the issues of combined pathologies of co-existing diarrheagenic agents in experimental infection studies.

Authors’ contributions

PSS, SK, and AKS designed the study. NKM was key in classifying cases and gathered patients’ clinical history and other relevant information. AKS collected specimens and performed the tests. NKM and PSS contributed to the patients’ diagnoses. AKS, SK, and PSS interpreted data and wrote the manuscript. MS did critical review of the manuscript. All authors read and approved the final manuscript.

Acknowledgements

The authors duly acknowledge Dr. Jyotiprakash Mishra (pediatrician) for his kind assistance in patient identification and sample collection. Authors are also thankful to Miss. Swagatika Panda for her help in the laboratory. The kind gift of standard Cryptosporidium genomic DNA from Prof. Gagandeep Kang, Christian Medical College, Vellore (India) is greatly acknowledged. We are also thankful to Prof. Adrian Hehl, Institute of Parasitology, University of Zurich for providing us the standard genomic DNA of Giardia used in this study.

Competing interests

The authors declare that they have no competing interests.

Availability of data and materials

Data will not be shared because the data generated out of patients contain personal information of the patients.
All infants’ parents provided written informed consent, and this study was approved by the Ethical Committee of Kalinga Institute of Medical Sciences, KIIT University.

Funding

This study was supported by KIIT University. The Cryptosporidium and Giardia diagnostic reagents were used from the fund granted by Bill and Melinda Gates Foundation through a supplemental fund transfer to KIIT University from the University of California, Davis via the London School of Hygiene & Tropical Medicine under the Orissa Rural Sanitation Health Impact Trial (Registration No. NCT01214785).

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Literatur
1.
Zurück zum Zitat Walker CLF, Rudan I, Liu L, Nair H, Theodoratou E, Bhutta ZA, et al. Global burden of childhood diarrhoea and pneumonia. Lancet. 2013;381:1405–16.CrossRefPubMed Walker CLF, Rudan I, Liu L, Nair H, Theodoratou E, Bhutta ZA, et al. Global burden of childhood diarrhoea and pneumonia. Lancet. 2013;381:1405–16.CrossRefPubMed
2.
Zurück zum Zitat Lakshminarayanan S, Jayalakshmy R. Diarrheal diseases among children in India: current scenario and future perspectives. J Nat Sci Biol Med. 2015;6:24.CrossRefPubMedPubMedCentral Lakshminarayanan S, Jayalakshmy R. Diarrheal diseases among children in India: current scenario and future perspectives. J Nat Sci Biol Med. 2015;6:24.CrossRefPubMedPubMedCentral
3.
Zurück zum Zitat Kotloff KL, Nataro JP, Blackwelder WC, Nasrin D, Farag TH, Panchalingam S, et al. Burden and aetiology of diarrhoeal disease in infants and young children in developing countries (the Global Enteric Multicenter Study, GEMS): a prospective, case-control study. Lancet. 2013;382:209–22.CrossRefPubMed Kotloff KL, Nataro JP, Blackwelder WC, Nasrin D, Farag TH, Panchalingam S, et al. Burden and aetiology of diarrhoeal disease in infants and young children in developing countries (the Global Enteric Multicenter Study, GEMS): a prospective, case-control study. Lancet. 2013;382:209–22.CrossRefPubMed
4.
Zurück zum Zitat Kotloff KL, Blackwelder WC, Nasrin D, Nataro JP, Farag TH, Van Eijk A, et al. The Global Enteric Multicenter Study (GEMS) of diarrheal disease in infants and young children in developing countries: epidemiologic and clinical methods of the case/control study. Clin Infect Dis. 2012;55:S232.CrossRefPubMedPubMedCentral Kotloff KL, Blackwelder WC, Nasrin D, Nataro JP, Farag TH, Van Eijk A, et al. The Global Enteric Multicenter Study (GEMS) of diarrheal disease in infants and young children in developing countries: epidemiologic and clinical methods of the case/control study. Clin Infect Dis. 2012;55:S232.CrossRefPubMedPubMedCentral
5.
Zurück zum Zitat O’Ryan M, Prado V, Pickering LK. A millennium update on pediatric diarrheal illness in the developing world. Semin Pediatr Infect Dis. 2005;16:125–36.CrossRefPubMed O’Ryan M, Prado V, Pickering LK. A millennium update on pediatric diarrheal illness in the developing world. Semin Pediatr Infect Dis. 2005;16:125–36.CrossRefPubMed
6.
Zurück zum Zitat Batabyal P, Mookerjee S, Sur D, Palit A. Diarrheogenic Escherechia coli in potable water sources of West Bengal, India. Acta Trop. 2013;127:153–7.CrossRefPubMed Batabyal P, Mookerjee S, Sur D, Palit A. Diarrheogenic Escherechia coli in potable water sources of West Bengal, India. Acta Trop. 2013;127:153–7.CrossRefPubMed
7.
Zurück zum Zitat Kawai K, O’Brien MA, Goveia MG, Mast TC, El Khoury AC. Burden of rotavirus gastroenteritis and distribution of rotavirus strains in Asia: a systematic review. Vaccine. 2012;30(7):1244–54.CrossRefPubMed Kawai K, O’Brien MA, Goveia MG, Mast TC, El Khoury AC. Burden of rotavirus gastroenteritis and distribution of rotavirus strains in Asia: a systematic review. Vaccine. 2012;30(7):1244–54.CrossRefPubMed
8.
Zurück zum Zitat Livio S, Strockbine NA, Panchalingam S, Tennant SM, Barry EM, Marohn ME, et al. Shigella isolates from the global enteric multicenter study inform vaccine development. Clin Infect Dis. 2014;59:933–41.CrossRefPubMedPubMedCentral Livio S, Strockbine NA, Panchalingam S, Tennant SM, Barry EM, Marohn ME, et al. Shigella isolates from the global enteric multicenter study inform vaccine development. Clin Infect Dis. 2014;59:933–41.CrossRefPubMedPubMedCentral
9.
Zurück zum Zitat Tate JE, Burton AH, Boschi-Pinto C, Steele AD, Duque J, Parashar UD. 2008 estimate of worldwide rotavirus-associated mortality in children younger than 5 years before the introduction of universal rotavirus vaccination programmes: a systematic review and meta-analysis. Lancet Infect Dis. 2012;12:136–41.CrossRefPubMed Tate JE, Burton AH, Boschi-Pinto C, Steele AD, Duque J, Parashar UD. 2008 estimate of worldwide rotavirus-associated mortality in children younger than 5 years before the introduction of universal rotavirus vaccination programmes: a systematic review and meta-analysis. Lancet Infect Dis. 2012;12:136–41.CrossRefPubMed
10.
Zurück zum Zitat Tate JE, Burton AH, Boschi-Pinto C, Parashar UD. Global, regional, and national estimates of rotavirus mortality in children < 5 years of age, 2000–2013. Clin Infect Dis. 2016;62:S96–105.CrossRefPubMed Tate JE, Burton AH, Boschi-Pinto C, Parashar UD. Global, regional, and national estimates of rotavirus mortality in children < 5 years of age, 2000–2013. Clin Infect Dis. 2016;62:S96–105.CrossRefPubMed
11.
Zurück zum Zitat Langendorf C, Le Hello S, Moumouni A, Gouali M, Mamaty AA, Grais RF, et al. Enteric bacterial pathogens in children with diarrhea in Niger: diversity and antimicrobial resistance. PLoS ONE. 2015;10:1–18.CrossRef Langendorf C, Le Hello S, Moumouni A, Gouali M, Mamaty AA, Grais RF, et al. Enteric bacterial pathogens in children with diarrhea in Niger: diversity and antimicrobial resistance. PLoS ONE. 2015;10:1–18.CrossRef
12.
Zurück zum Zitat Bardhan P, Faruque ASG, Naheed A, Sack DA. Decrease in shigellosis-related deaths without Shigella spp.-specific interventions, Asia. Emerg Infect Dis. 2010;16:1718–23.CrossRefPubMedPubMedCentral Bardhan P, Faruque ASG, Naheed A, Sack DA. Decrease in shigellosis-related deaths without Shigella spp.-specific interventions, Asia. Emerg Infect Dis. 2010;16:1718–23.CrossRefPubMedPubMedCentral
13.
Zurück zum Zitat Zhu JY, Duan GC, Yang HY, Fan QT, Xi YL. Atypical class 1 integron coexists with class 1 and class 2 integrons in multi-drug resistant Shigella flexneri isolates from China. Curr Microbiol. 2011;62:802–6.CrossRefPubMed Zhu JY, Duan GC, Yang HY, Fan QT, Xi YL. Atypical class 1 integron coexists with class 1 and class 2 integrons in multi-drug resistant Shigella flexneri isolates from China. Curr Microbiol. 2011;62:802–6.CrossRefPubMed
14.
Zurück zum Zitat Sarkar R, Tate JE, Ajjampur SSR, Kattula D, John J, Ward HD, et al. Burden of diarrhea, hospitalization and mortality due to cryptosporidial infections in Indian children. PLoS Negl Trop Dis. 2014;8:e3042.CrossRefPubMedPubMedCentral Sarkar R, Tate JE, Ajjampur SSR, Kattula D, John J, Ward HD, et al. Burden of diarrhea, hospitalization and mortality due to cryptosporidial infections in Indian children. PLoS Negl Trop Dis. 2014;8:e3042.CrossRefPubMedPubMedCentral
15.
Zurück zum Zitat Norhayati M, Fatmah MS, Yusof S, Edariah AB. Intestinal parasitic infections in man: a review. Med J Malays. 2003;58(2):296–305. Norhayati M, Fatmah MS, Yusof S, Edariah AB. Intestinal parasitic infections in man: a review. Med J Malays. 2003;58(2):296–305.
16.
Zurück zum Zitat Gasparinho C, Mirante MC, Centeno-Lima S, Istrate C, Mayer AC, Tavira L, et al. Etiology of diarrhea in children younger than 5 years attending the Bengo General Hospital in Angola. Pediatr Infect Dis J. 2016;35:e28–34.CrossRefPubMed Gasparinho C, Mirante MC, Centeno-Lima S, Istrate C, Mayer AC, Tavira L, et al. Etiology of diarrhea in children younger than 5 years attending the Bengo General Hospital in Angola. Pediatr Infect Dis J. 2016;35:e28–34.CrossRefPubMed
17.
Zurück zum Zitat Bonkoungou IJO, Haukka K, Österblad M, Hakanen AJ, Traoré AS, Barro N, et al. Bacterial and viral etiology of childhood diarrhea in Ouagadougou, Burkina Faso. BMC Pediatr. 2013;13:36.CrossRefPubMedPubMedCentral Bonkoungou IJO, Haukka K, Österblad M, Hakanen AJ, Traoré AS, Barro N, et al. Bacterial and viral etiology of childhood diarrhea in Ouagadougou, Burkina Faso. BMC Pediatr. 2013;13:36.CrossRefPubMedPubMedCentral
18.
Zurück zum Zitat Sambe-Ba B, Espié E, Faye ME, Timbiné LG, Sembene M, Gassama-Sow A. Community-acquired diarrhea among children and adults in urban settings in Senegal: clinical, epidemiological and microbiological aspects. BMC Infect Dis. 2013;13:580.CrossRefPubMedPubMedCentral Sambe-Ba B, Espié E, Faye ME, Timbiné LG, Sembene M, Gassama-Sow A. Community-acquired diarrhea among children and adults in urban settings in Senegal: clinical, epidemiological and microbiological aspects. BMC Infect Dis. 2013;13:580.CrossRefPubMedPubMedCentral
19.
Zurück zum Zitat Mukherjee AK, Chowdhury P, Rajendran K, Nozaki T, Ganguly S. Association between Giardia duodenalis and coinfection with other diarrhea-causing pathogens in India. Biomed Res Int. 2014. doi:10.1155/2014/786480. Mukherjee AK, Chowdhury P, Rajendran K, Nozaki T, Ganguly S. Association between Giardia duodenalis and coinfection with other diarrhea-causing pathogens in India. Biomed Res Int. 2014. doi:10.​1155/​2014/​786480.
20.
Zurück zum Zitat Mladenova Z, Steyer A, Steyer AF, Ganesh B, Petrov P, Tchervenjakova T, et al. Aetiology of acute paediatric gastroenteritis in Bulgaria during summer months: prevalence of viral infections. J Med Microbiol. 2015;64:272–82.CrossRefPubMed Mladenova Z, Steyer A, Steyer AF, Ganesh B, Petrov P, Tchervenjakova T, et al. Aetiology of acute paediatric gastroenteritis in Bulgaria during summer months: prevalence of viral infections. J Med Microbiol. 2015;64:272–82.CrossRefPubMed
21.
Zurück zum Zitat Bhavnani D, Goldstick JE, Cevallos W, Trueba G, Eisenberg JNS. Synergistic effects between rotavirus and coinfecting pathogens on diarrheal disease: evidence from a community-based study in northwestern Ecuador. Am J Epidemiol. 2012;176:387–95.CrossRefPubMedPubMedCentral Bhavnani D, Goldstick JE, Cevallos W, Trueba G, Eisenberg JNS. Synergistic effects between rotavirus and coinfecting pathogens on diarrheal disease: evidence from a community-based study in northwestern Ecuador. Am J Epidemiol. 2012;176:387–95.CrossRefPubMedPubMedCentral
22.
Zurück zum Zitat Elhag WI, Saeed HA, Omer EFE, Ali AS. Prevalence of rotavirus and adenovirus associated with diarrhea among displaced communities in Khartoum, Sudan. BMC Infect Dis. 2013;13:209.CrossRefPubMedPubMedCentral Elhag WI, Saeed HA, Omer EFE, Ali AS. Prevalence of rotavirus and adenovirus associated with diarrhea among displaced communities in Khartoum, Sudan. BMC Infect Dis. 2013;13:209.CrossRefPubMedPubMedCentral
23.
Zurück zum Zitat Vilchez S, Reyes D, Paniagua M, Bucardo F, Möllby R, Weintraub A. Prevalence of diarrhoeagenic Escherichia coli in children from León, Nicaragua. J Med Microbiol. 2009;58:630–7.CrossRefPubMed Vilchez S, Reyes D, Paniagua M, Bucardo F, Möllby R, Weintraub A. Prevalence of diarrhoeagenic Escherichia coli in children from León, Nicaragua. J Med Microbiol. 2009;58:630–7.CrossRefPubMed
24.
Zurück zum Zitat Paton AW, Paton JC. Detection and characterization of shiga toxigenic escherichia coli by using multiplex PCR assays for stx1, stx2, eaeA, enterohemorrhagic E. coli hlyA, rfb(O111), and rfb(O157). J Clin Microbiol. 1998;36:598–602.PubMedPubMedCentral Paton AW, Paton JC. Detection and characterization of shiga toxigenic escherichia coli by using multiplex PCR assays for stx1, stx2, eaeA, enterohemorrhagic E. coli hlyA, rfb(O111), and rfb(O157). J Clin Microbiol. 1998;36:598–602.PubMedPubMedCentral
25.
Zurück zum Zitat de Freitas CG, Santana ÂP, da Silva PHC, Gonçalves VSP, Barros MD, Torres FA, et al. PCR multiplex for detection of Salmonella Enteritidis, Typhi and Typhimurium and occurrence in poultry meat. Int J Food Microbiol. 2010;139(15–22):26. de Freitas CG, Santana ÂP, da Silva PHC, Gonçalves VSP, Barros MD, Torres FA, et al. PCR multiplex for detection of Salmonella Enteritidis, Typhi and Typhimurium and occurrence in poultry meat. Int J Food Microbiol. 2010;139(15–22):26.
26.
Zurück zum Zitat Boschi-Pinto C, Velebit L, Shibuya K. Estimating child mortality due to diarrhoea in developing countries. Bull World Health Organ. 2008;86:710–7.CrossRefPubMedPubMedCentral Boschi-Pinto C, Velebit L, Shibuya K. Estimating child mortality due to diarrhoea in developing countries. Bull World Health Organ. 2008;86:710–7.CrossRefPubMedPubMedCentral
27.
Zurück zum Zitat Hossain MT, Kim EY, Kim YR, Kim DG, Kong IS. Development of a groEL gene-based species-specific multiplex polymerase chain reaction assay for simultaneous detection of Vibrio cholerae, Vibrio parahaemolyticus and Vibrio vulnificus. J Appl Microbiol. 2013;114:448–56.CrossRefPubMed Hossain MT, Kim EY, Kim YR, Kim DG, Kong IS. Development of a groEL gene-based species-specific multiplex polymerase chain reaction assay for simultaneous detection of Vibrio cholerae, Vibrio parahaemolyticus and Vibrio vulnificus. J Appl Microbiol. 2013;114:448–56.CrossRefPubMed
28.
Zurück zum Zitat Morgan UM, Constantine CC, Forbes DA. Differentiation between human and animal isolates of Cryptosporidium parvum using rDNA sequencing and direct PCR analysis. J Parasitol. 1997;83:825–30.CrossRefPubMed Morgan UM, Constantine CC, Forbes DA. Differentiation between human and animal isolates of Cryptosporidium parvum using rDNA sequencing and direct PCR analysis. J Parasitol. 1997;83:825–30.CrossRefPubMed
29.
Zurück zum Zitat Read CM, Monis PT, Thompson RCA. Discrimination of all genotypes of Giardia duodenalis at the glutamate dehydrogenase locus using PCR-RFLP. Infect Genet Evol. 2004;4:125–30.CrossRefPubMed Read CM, Monis PT, Thompson RCA. Discrimination of all genotypes of Giardia duodenalis at the glutamate dehydrogenase locus using PCR-RFLP. Infect Genet Evol. 2004;4:125–30.CrossRefPubMed
30.
Zurück zum Zitat Rathaur VK, Pathania M, Jayara A, Yadav N. Clinical study of acute childhood diarrhoea caused by bacterial enteropathogens. J Clin Diagn Res. 2014;8:PC01–5.PubMedPubMedCentral Rathaur VK, Pathania M, Jayara A, Yadav N. Clinical study of acute childhood diarrhoea caused by bacterial enteropathogens. J Clin Diagn Res. 2014;8:PC01–5.PubMedPubMedCentral
31.
Zurück zum Zitat Niyogi SK, Saha MR, De SP. Enteropathogens associated with acute diarrhoeal diseases. Indian J Public Health. 1994;38:29–32.PubMed Niyogi SK, Saha MR, De SP. Enteropathogens associated with acute diarrhoeal diseases. Indian J Public Health. 1994;38:29–32.PubMed
32.
Zurück zum Zitat Hegde A, Ballal MSS. Detection of diarrheagenic Escherichia coli by multiplex PCR. Indian J Med Microbiol. 2012;1:279.CrossRef Hegde A, Ballal MSS. Detection of diarrheagenic Escherichia coli by multiplex PCR. Indian J Med Microbiol. 2012;1:279.CrossRef
33.
Zurück zum Zitat Breurec S, Vanel N, Bata P, Chartier L, Farra A, Favennec L, et al. Etiology and epidemiology of diarrhea in hospitalized children from low income country: a matched case–control study in Central African Republic. PLoS Negl Trop Dis. 2016;10:e0004283.CrossRefPubMedPubMedCentral Breurec S, Vanel N, Bata P, Chartier L, Farra A, Favennec L, et al. Etiology and epidemiology of diarrhea in hospitalized children from low income country: a matched case–control study in Central African Republic. PLoS Negl Trop Dis. 2016;10:e0004283.CrossRefPubMedPubMedCentral
34.
Zurück zum Zitat George CM, Ahmed S, Talukder KA, Azmi IJ, Perin J, Sack RB, et al. Shigella infections in household contacts of pediatric shigellosis patients in rural Bangladesh. Emerg Infect Dis. 2015;21:2006–13.CrossRefPubMedPubMedCentral George CM, Ahmed S, Talukder KA, Azmi IJ, Perin J, Sack RB, et al. Shigella infections in household contacts of pediatric shigellosis patients in rural Bangladesh. Emerg Infect Dis. 2015;21:2006–13.CrossRefPubMedPubMedCentral
35.
Zurück zum Zitat Li LL, Liu N, Humphries EM, Yu JM, Li S, Lindsay BR, et al. Aetiology of diarrhoeal disease and evaluation of viral-bacterial coinfection in children under 5 years old in China: a matched case-control study. Clin Microbiol Infect. 2016;22:381.e9–16.CrossRef Li LL, Liu N, Humphries EM, Yu JM, Li S, Lindsay BR, et al. Aetiology of diarrhoeal disease and evaluation of viral-bacterial coinfection in children under 5 years old in China: a matched case-control study. Clin Microbiol Infect. 2016;22:381.e9–16.CrossRef
36.
Zurück zum Zitat Daniels ME, Shrivastava A, Smith WA, Sahu P, Odagiri M, Misra PR, et al. Cryptosporidium and giardia in humans, domestic animals, and village water sources in rural India. Am J Trop Med Hyg. 2015;93:596–600.CrossRefPubMedPubMedCentral Daniels ME, Shrivastava A, Smith WA, Sahu P, Odagiri M, Misra PR, et al. Cryptosporidium and giardia in humans, domestic animals, and village water sources in rural India. Am J Trop Med Hyg. 2015;93:596–600.CrossRefPubMedPubMedCentral
37.
Zurück zum Zitat Albert MJ, Faruque AS, Faruque SM, Sack RB, Mahalanabis D. Case-control study of enteropathogens associated with childhood diarrhea in Dhaka, Bangladesh. J Clin Microbiol. 1999;37(11):3458–64.PubMedPubMedCentral Albert MJ, Faruque AS, Faruque SM, Sack RB, Mahalanabis D. Case-control study of enteropathogens associated with childhood diarrhea in Dhaka, Bangladesh. J Clin Microbiol. 1999;37(11):3458–64.PubMedPubMedCentral
38.
Zurück zum Zitat Nitiema LW, Nordgren J, Ouermi D, Dianou D, Traore AS, Svensson L, et al. Burden of rotavirus and other enteropathogens among children with diarrhea in Burkina Faso. Int J Infect Dis. 2011;15:e646.CrossRefPubMed Nitiema LW, Nordgren J, Ouermi D, Dianou D, Traore AS, Svensson L, et al. Burden of rotavirus and other enteropathogens among children with diarrhea in Burkina Faso. Int J Infect Dis. 2011;15:e646.CrossRefPubMed
39.
Zurück zum Zitat Zhang SX, Zhou YM, Xu W, Tian LG, Chen JX, Chen SH, Dang ZS, Gu WP, Yin JW, Serrano EZX. Impact of co-infections with enteric pathogens on children suffering from acute diarrhea in southwest China. Infect Dis Poverty. 2016;5:64.CrossRefPubMedPubMedCentral Zhang SX, Zhou YM, Xu W, Tian LG, Chen JX, Chen SH, Dang ZS, Gu WP, Yin JW, Serrano EZX. Impact of co-infections with enteric pathogens on children suffering from acute diarrhea in southwest China. Infect Dis Poverty. 2016;5:64.CrossRefPubMedPubMedCentral
40.
Zurück zum Zitat Platts-Mills JA, Babji S, Bodhidatta L, Gratz J, Haque R, Havt A, et al. Pathogen-specific burdens of community diarrhoea in developing countries: a multisite birth cohort study (MAL-ED). Lancet Glob Health. 2015;3:e564.CrossRefPubMed Platts-Mills JA, Babji S, Bodhidatta L, Gratz J, Haque R, Havt A, et al. Pathogen-specific burdens of community diarrhoea in developing countries: a multisite birth cohort study (MAL-ED). Lancet Glob Health. 2015;3:e564.CrossRefPubMed
41.
Zurück zum Zitat Hori H, Akpedonu P, Armah G, Aryeetey M, Yartey J, Kamiya H, et al. Enteric pathogens in severe forms of acute gastroenteritis in Ghanaian children. Pediatr Int. 1996;38:672–6.CrossRef Hori H, Akpedonu P, Armah G, Aryeetey M, Yartey J, Kamiya H, et al. Enteric pathogens in severe forms of acute gastroenteritis in Ghanaian children. Pediatr Int. 1996;38:672–6.CrossRef
42.
Zurück zum Zitat Velázquez FR, Matson DO, Calva JJ, Guerrero ML, Morrow AL, Carter-Campbell S, Glass RI, Estes MK, Pickering LK, Ruiz-Palacios GM. Rotavirus infection in infants as protection against subsequent infections. N Engl J Med. 1996;335(14):1022–8.CrossRefPubMed Velázquez FR, Matson DO, Calva JJ, Guerrero ML, Morrow AL, Carter-Campbell S, Glass RI, Estes MK, Pickering LK, Ruiz-Palacios GM. Rotavirus infection in infants as protection against subsequent infections. N Engl J Med. 1996;335(14):1022–8.CrossRefPubMed
44.
Zurück zum Zitat Bodhidatta L, McDaniel P, Sornsakrin S, Srijan A, Serichantalergs O, Mason CJ. Case-Control Study of diarrheal disease etiology in a remote rural area in western Thailand. Am J Trop Med Hyg. 2010;83:1106–9.CrossRefPubMedPubMedCentral Bodhidatta L, McDaniel P, Sornsakrin S, Srijan A, Serichantalergs O, Mason CJ. Case-Control Study of diarrheal disease etiology in a remote rural area in western Thailand. Am J Trop Med Hyg. 2010;83:1106–9.CrossRefPubMedPubMedCentral
Metadaten
Titel
Multiple etiologies of infectious diarrhea and concurrent infections in a pediatric outpatient-based screening study in Odisha, India
verfasst von
Arpit Kumar Shrivastava
Subrat Kumar
Nirmal Kumar Mohakud
Mrutyunjay Suar
Priyadarshi Soumyaranjan Sahu
Publikationsdatum
01.12.2017
Verlag
BioMed Central
Erschienen in
Gut Pathogens / Ausgabe 1/2017
Elektronische ISSN: 1757-4749
DOI
https://doi.org/10.1186/s13099-017-0166-0

Weitere Artikel der Ausgabe 1/2017

Gut Pathogens 1/2017 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Battle of Experts: Sport vs. Spritze bei Adipositas und Typ-2-Diabetes

11.05.2024 DDG-Jahrestagung 2024 Kongressbericht

Im Battle of Experts traten zwei Experten auf dem Diabeteskongress gegeneinander an: Die eine vertrat die Auffassung „Sport statt Spritze“ bei Adipositas und Typ-2-Diabetes, der andere forderte „Spritze statt Sport!“ Am Ende waren sie sich aber einig: Die Kombination aus beidem erzielt die besten Ergebnisse.

Vorsicht, erhöhte Blutungsgefahr nach PCI!

10.05.2024 Koronare Herzerkrankung Nachrichten

Nach PCI besteht ein erhöhtes Blutungsrisiko, wenn die Behandelten eine verminderte linksventrikuläre Ejektionsfraktion aufweisen. Das Risiko ist umso höher, je stärker die Pumpfunktion eingeschränkt ist.

Triglyzeridsenker schützt nicht nur Hochrisikopatienten

10.05.2024 Hypercholesterinämie Nachrichten

Patienten mit Arteriosklerose-bedingten kardiovaskulären Erkrankungen, die trotz Statineinnahme zu hohe Triglyzeridspiegel haben, profitieren von einer Behandlung mit Icosapent-Ethyl, und zwar unabhängig vom individuellen Risikoprofil.

Gibt es eine Wende bei den bioresorbierbaren Gefäßstützen?

In den USA ist erstmals eine bioresorbierbare Gefäßstütze – auch Scaffold genannt – zur Rekanalisation infrapoplitealer Arterien bei schwerer PAVK zugelassen worden. Das markiert einen Wendepunkt in der Geschichte dieser speziellen Gefäßstützen.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.