Skip to main content
Erschienen in: Malaria Journal 1/2017

Open Access 01.12.2017 | Research

Multiplex, DNase-free one-step reverse transcription PCR for Plasmodium 18S rRNA and spliced gametocyte-specific mRNAs

verfasst von: Amelia E. Hanron, Zachary P. Billman, Annette M. Seilie, Tayla M. Olsen, Matthew Fishbaugher, Ming Chang, Thomas Rueckle, Nicole Andenmatten, Bryan Greenhouse, Emmanuel Arinaitwe, John Rek, Smita Das, Gonzalo J. Domingo, Kelly Shipman, Stefan H. Kappe, James G. Kublin, Sean C. Murphy

Erschienen in: Malaria Journal | Ausgabe 1/2017

Abstract

Background

Plasmodium gametocytes are sexual stages transmitted to female Anopheles mosquitoes. While Plasmodium parasites can be differentiated microscopically on Giemsa-stained blood smears, molecular methods are increasingly used because of their increased sensitivity. Molecular detection of gametocytes requires methods that discriminate between asexual and sexual stage parasites. Commonly tested gametocyte-specific mRNAs are pfs25 and pfs230 detected by reverse transcription polymerase chain reaction (RT-PCR). However, detection of these unspliced mRNA targets requires preceding DNase treatment of nucleic acids to eliminate co-purified genomic DNA. If gametocyte-specific, spliced mRNAs could be identified, DNase treatment could be eliminated and one-step multiplexed molecular methods utilized.

Results

Expression data was used to identify highly-expressed mRNAs in mature gametocytes that were also low in antisense RNA expression in non-gametocyte stages. After testing numerous candidate mRNAs, the spliced female Pf3D7_0630000 mRNA was selected as a Plasmodium falciparum gametocyte-specific biomarker compatible with Plasmodium 18S rRNA RT-PCR. This mRNA was only detected in samples containing mature gametocytes and was absent in those containing only asexual stage parasites or uninfected human blood. PF3D7_0630000 RT-PCR detected gametocytes across a wide range of parasite densities in both spiked and clinical samples and agreed with pfs25 RT-PCR, the gold standard for RT-PCR-based gametocyte detection. PF3D7_0630000 multiplexed with Plasmodium 18S rRNA RT-PCR was more sensitive than other spliced mRNA targets for one-step RT-PCR gametocyte detection.

Conclusions

Because the spliced target does not require DNase treatment, the PF3D7_0630000 assay can be multiplexed with Plasmodium 18S rRNA for direct one-step detection of gametocytes from whole human blood.

Background

Plasmodium gametocytes are the male and female sexual stages of the parasite responsible for transmission from an infected host into the female Anopheles mosquito vector. While gametocytes do not directly cause clinical disease in the mammalian host, their presence denotes potential continued transmission. Mature gametocytes circulate in peripheral blood for 3 weeks or longer [14]. The frequency and density of gametocyte carriage is correlated with the likelihood that mosquitoes will become infected after taking a blood meal [57]. Persons with sub-microscopic Plasmodium falciparum gametocyte densities can contribute to transmission [2, 79] with transmission possible at densities as low as 250–300 gametocytes/mL of blood [9]. Thus, gametocyte detection strategies should ideally be able to achieve this level of analytical sensitivity.
Gametocytes can be identified by light microscopy of Giemsa-stained thick and thin blood smears but, like all microscopic methods for Plasmodium parasites, only to a density of ~5000–20,000 parasites/mL (5–20/μL) by thick blood smear [10]. Molecular methods are more sensitive and include qualitative or quantitative RT-PCR [3, 1114] and NASBA [9, 15, 16]. mRNA-based methods are used to differentiate gametocytes from asexual stages by detecting stage-specific mRNAs. The most common gametocyte mRNA targets are pfs25 [17, 18] and pfs230 [1820] for P. falciparum and pvs25 for P. vivax [17]. These well-studied targets are all derived from unspliced mRNAs, so a DNase treatment step is required to destroy genomic DNA prior to RT. When manual DNase treatment is performed, there is partial loss of sample material and increased risk for sample cross-contamination due to added handling steps. DNase treatment also makes the process more time consuming. For detection of asexual stage parasites, some laboratories already perform one-step multiplex Plasmodium 18S rRNA RT-PCR directly from extracted whole blood without DNase treatment [21, 22]. In these assays, DNase treatment is not required because Plasmodium 18S rRNAs are more than three orders of magnitude more abundant than the coding 18S rDNA genes [21, 22]. Plasmodium 18S rRNAs are developmentally regulated between sexual and asexual stages [2325] but gametocytes express both S- (sexual) and A- (asexual)-type 18S rRNAs [18]. Because of this expression, 18S rRNAs alone cannot be used to differentiate gametocytes from asexual stage parasites. Spliced mRNAs that were highly expressed in gametocytes and showed nearly absent antisense RNA expression in the asexual stage were hypothesized to be ideal targets for multiplexing with the Plasmodium 18S rRNA assay for one-step RT-PCR Plasmodium detection. Although three spliced gametocyte-expressed mRNAs have been reported as RT-PCR targets [26, 27], it was unknown whether these targets were suitable for multiplexing with the 18S rRNA assay.
Here, bioinformatic methods were used to search for spliced, gametocyte-specific mRNA targets compatible with one-step Plasmodium 18S rRNA RT-PCR methods. After testing candidate targets and identifying several gametocyte-specific spliced mRNAs, the PF3D7_0630000 mRNA was selected as a P. falciparum-specific spliced mRNA for RT-PCR without DNase treatment. This novel mRNA target was then tested against pfs25 and a known spliced mRNA using clinical samples.

Methods

Bioinformatics

mRNA expression fold-change from Lopez-Barragan et al. [28] was evaluated. Fold-change data was summed for asexual or gametocyte stages, sorted and filtered to remove mRNAs with total asexual expression ≥0 or total gametocyte expression ≤0 (all relative to ring stage expression). Single exon genes were eliminated as were those lacking data in http://​www.​plasmodb.​org and those representing redundant mRNA isoforms. Fold change data in [28] were based on RNASeq reads per kilobase of exon per million (RPKM). Since RPKM can originate from sense or antisense transcripts, the strand-specific fragments per kilobase of exon per million (FPKM) [28] were also inspected, and genes with schizont antisense FPKM equal to 50–100% of maximum were eliminated as were those with minimum asexual antisense FPKM within twofold of the maximum gametocyte antisense FPKM values. Remaining genes were sorted on stage V gametocyte expression, and the most highly expressed genes were evaluated for suitable intron-spanning splice RT-PCR designs. RPKM and FPKM data deposited in plasmodb.org from [28] for selected genes is in Additional file 1.

Primer/probes

Primers and probes were designed to target exons using the web-based PrimerQuest tool (http://​www.​idtdna.​com/​Primerquest/​). Primers were commercially synthesized (IDT DNA, Coralville, IA, USA); primer set names (S1, S2, S3, etc.) were arbitrarily assigned by the IDT PrimerQuest software.

Plasmodium falciparum cultures

Asexual stage Plasmodium parasites were cultured as described [21]. Gametocytes were cultured as described [29]. Purity of cultures was confirmed by microscopy. Some asexual stage cultures were further confirmed gametocyte-free by pfs25 RT-PCR.

Human clinical samples

Leftover clinical whole blood specimens (50 μL) were preserved in 2 mL of NucliSens Lysis Buffer (bioMérieux, Marcy-l’Étoile, France). These samples were used under a protocol approved by the University of Washington Institutional Review Board (IRB) (protocol 47026, S. Murphy). Samples were included from a clinical trial of a novel chemical entity DSM265 approved under Fred Hutchinson Cancer Research Center IRB (protocol 8408, J. Kublin). Samples from a field study in Uganda were collected from consenting study participants or with the assent of children and consenting legal care givers within the context of studies approved by the relevant IRBs. Specimens from Nagongera, Tororo District, Uganda were collected under a study approved by the University of California San Francisco IRB 11-05995 and Uganda IRB 2011-0167. In Uganda, EDTA whole blood samples were collected from a previously described surveillance cohort [30]; all participants provided informed consent. Samples from Uganda were collected from May to October 2015.

Nucleic acid extraction

Nucleic acids were extracted on a bioMérieux EasyMAG [21] or an Abbott m2000sp as described [22]. Briefly, on the bioMérieux instrument, 1 mL of the 2.05 mL lysed sample (50 µL whole blood plus 2 mL NucliSENS lysis buffer) was extracted for total nucleic acids and eluted into 40 µL of elution buffer. On the Abbott m2000sp instrument, 1 mL of the 2.05 mL lysed sample was extracted preferentially for RNA and eluted into 53 μL of elution buffer.

RT-PCR

In initial studies of candidate primers, singleplex RT-PCR was performed using the AgPath mastermix kit as described by the manufacturer (Thermo Fisher Scientific, Waltham, MA) in the presence of LCGreen DNA-binding dye as described by the manufacturer (BioFire, Salt Lake City, UT). Some such RT-PCR products were evaluated by 1.5% agarose gel electrophoresis. For multiplex studies of spliced mRNA targets with 18S rRNA, pan-Plasmodium 18S rRNA RT-PCR was performed as described [31] with the addition of the candidate spliced gametocyte primers (200 nM) and probe (100 nM) on an Abbott m2000rt or Bio-Rad C1000 (Bio-Rad, Hercules, CA). Briefly, 15 µL of eluate was combined with 35 µL of mastermix as described in the SensiFAST LO-ROX one step RT-PCR kit product manual (Bioline, Tauton, MA). Cycling conditions were reverse transcription 10 min at 48 °C, 95 °C for 2 min followed by 45 cycles of 95 °C for 5 s followed by 50 °C for 35 s. For pfs25/18S rRNA multiplex RT-PCR, total nucleic acids were DNase treated (TURBO DNA-free Kit, Ambion/Life) and pfs25 and 18S rRNA RT-PCR performed using published cycling conditions and concentrations of Plasmodium 18S rRNA primers/probe [31] supplemented with pfs25 primers (400 nM) and probe (200 nM) [17]. Reagents for a gametocyte-specific mRNA from P. falciparum meiotic recombination protein DMC1-like protein gene (PF3D7_0816800) were as previously reported [26]: forward 5′-ATATCGGCAGCGAAAATGTGT-3′; reverse 5′-GACAATTCCCCTCTTCCACTGA-3′; probe 5′-(6-FAM)-TGCCCTTCTCGTAGTTGATTCGATTATT(BHQ1)-3′. Reagents for the early/mid- (PF3D7_1477700/PF14_0748) and mid/late-gametocyte expressed mRNAs (PF3D7_1438800/PF14_0367) were as previously reported [27]: PF3D7_1477700: forward 5′-CTTATGTGCTGAATTTTGTGTTATGGT-3′, reverse 5′-TTGGCCACACTGCTCTAGGA-3′, probe: 5′(VIC)-CACATAATGAATTCAAGGGTAG(MGBNFQ)-3′; PF3D7_1438800: forward 5′- GTTACATTTCGACCCAGCATAAATT-3′, reverse 5′-TCCCTGTGTTTTTGCTCATCTTC-3′, probe 5′-(VIC)-CAGTGCATATTGTTGCCTGT(MGBNFQ)-3′. All probes were 6-FAM-labelled and sourced from IDT (Coralville, IA) with the exceptions of the CAL Fluor orange 560-labeled pan-Plasmodium 18S rRNA hydrolysis probe (LCG Biosearch Technologies, Novato, CA) and the VIC-labeled PF3D7_1477700 and PF3D7_1438800 probes (Invitrogen). Where indicated, some reactions were tested at other annealing temperatures to investigate specificity. Quantification of parasites was achieved using an absolute 18S rRNA standard curve as described [22, 31], which allowed estimation of gametocyte-specific assay limits of detection (LOD). For gametocyte markers evaluated using whole parasite standard curves, CT values up to 40.0 cycles were converted into quantitative values.

Statistics

To evaluate unlysed sample stability, an unpaired t test was used to compare mean CT values for 18S rRNA and gametocyte-specific markers and the difference in these CT values. For sensitivity analyses, exact confidence intervals were calculated [32]. Statistical significance for both was P < 0.05.

Results

Target selection

One-thousand one-hundred twenty-nine genes evaluated previously by RNAseq [28] were filtered to remove those with increased asexual expression (sum of asexual fold change ≥0) and decreased gametocyte expression (sum of stage II and V gametocyte fold change ≤0). This resulted in 372 genes with gametocyte stage II and/or V expression and an absence of asexual-stage expression. The most well-known gametocyte target pfs25 (PF3D7_1031000) was one of the most highly expressed gametocyte-specific genes in this set (Additional file 1). Six genes were eliminated because they lacked data in plasmodb.org and all single exon genes were also eliminated. Two-hundred genes contained two or more exons. Since antisense transcripts are produced for many Plasmodium genes [28] and since such transcripts can lead to false positive results in primer-specific RT-PCRs [3336], antisense strand-specific FPKM data [28] were evaluated next. Genes with low or absent antisense transcript expression in non-gametocyte stages were retained (48 genes), sorted on stage V gametocyte expression and evaluated for intron-spanning primer/probe designs compatible with the Plasmodium 18S rRNA RT-PCR cycling temperatures. RT-PCR designs for 14 genes were ultimately selected using this strategy as were designs for four additional genes overexpressed in stage II/V gametocytes but not identified by published fold-change data in [28]; published RT-PCRs for pfs25 and three reported multi-exon gametocyte-specific genes [26, 27] were also included (Additional file 1). Based on recently published data [37], two genes were male-specific (PF3D7_1477700, PF3D7_1438800), one showed mixed expression (PF3D7_1020100) and the rest were female-specific (Additional file 1).

RT-PCR with LCGreen intercalating dye for candidate targets

LCGreen RT-PCR was performed on 27 target regions of the 18 novel genes of interest using total nucleic acids obtained from either cultured mature P. falciparum gametocytes or from cultured synchronized ring-stage asexual parasites (Additional file 2). Although these RT-PCR assays do not provide absolute quantification, the difference (Δ) between CT values for the 18S rRNA and the mRNA of interest provide an estimate of spliced mRNA abundance. In cultured samples enriched for mature gametocytes, gametocyte-specific spliced mRNAs were detected 6.9–25.2 cycles later than Plasmodium 18S rRNA (ΔCT Gam mRNA–18SrRNA). In cultured samples containing only asexual-stage parasites, the ΔCT iRBC mRNA–18SrRNA was typically larger than the aforementioned ΔCT Gam mRNA–18SrRNA for each candidate mRNA, as expected for gametocyte-expressed mRNAs (Additional file 2). mRNAs with the smallest ΔCT Gam mRNA–18SrRNA and the largest ΔCT iRBC mRNA–18SrRNA were considered to represent the best balance between high and specific gametocyte expression. Gel electrophoresis was used to evaluate some RT-PCR products. For example, for PF3D7_0630000, a band of the expected size (141 bp) was only generated in the presence of gametocytes by RT-PCR (Fig. 1a). The probe for this target was designed to span an intron (Fig. 1b).

Probe-based RT-PCR

Four primer sets that specifically detected gametocytes by LCGreen, had RT-PCR efficiencies of 90–110% and had probe melting temperatures compatible with the 18S rRNA RT-PCR [PF3D7_0514500 (S1), PF3D7_0518800 (S1), PF3D7_0630000 (S3), PF3D7_1214500 (S1)] were further evaluated using hydrolysis probes (Table 1). These RT-PCRs detected gametocyte mRNA in gametocyte-containing samples (Fig. 2). However, PF3D7_1214500 (S1) reacted with some parasite-negative human blood samples and PF3D7_1214500 (S1) and PF3D7_0518800 (S1) occasionally gave false positives for blood from microscopically-pure cultured asexual-stage parasites, so further study of these targets was discontinued. Positive CTs for PF3D7_0630000 (S3) RT-PCR were ~2–4 cycles earlier than for PF3D7_0514500 (S2) so PF3D7_0630000 was prioritized for development.
Table 1
Candidate primer/probe combinations evaluated for gametocyte-specific targets
Gene ID
# Exons
Exons targeted
Forward primer
Probe (±strand)
Reverse primer
PF3D7_1214500 (S1)
6
2–4
TGGGATGATGAATATGAAG
TGGAACTGGTTCGCTATATTGT  (−)
AAAGGTCTATTAGTTGAATTG
PF3D7_0630000 (S3)
10
3–6
AACGCAGAAATAGAAAATC
TGGTATATTGGGAAGTGTAGAAGAG  (+)
GTCATAAGCAGATACATTC
PF3D7_0514500 (S2)
6
2–3
GATAAGACAAAACGGAAC
CACAGGAGTAGTGACCATATCAG   (+)
CTATAAGGAAAAGATAACAAAG
PF3D7_0518800 (S1)
7
1–2
GCCGTTACTGATTCCTTAC
TGTCTGAGTTACGACAAGAAATTAG (+)
CGAGAATACCCATTTGTC
PF3D7_1031000/pfs25
1
1
GAAATCCCGTTTCATACGCTTG
TGTAAGAATGTAACTTGTGGTAACGGT  (+)
AGTTTTAACAGGATTGCTTGTATCTAA

PF3D7_0630000-specific qRT-PCR

PF3D7_0630000 (aliases MAL6P1.128 and PFF1455c) encodes a CPW-WPC family protein. CPW-WPC protein-coding mRNAs are expressed and post-transcriptionally regulated in gametocytes and later translated into surface proteins in ookinetes [38]. The PF3D7_0630000 (S3) reagents target exons 3–6 of the mature mRNA with the probe and reverse primer spanning introns 4 and 5, respectively (Fig. 1b). The spliced mRNA amplicon was 141 bp. Nucleic acids from a dilution series of mature gametocytes (Day 14 of culture) were tested using RT-PCRs for Plasmodium 18S rRNA, PF3D7_0630000 and pfs25 to generate a standard curve and evaluate assay efficiency and linearity (Fig. 3a; Table 2). Plasmodium 18S rRNA qRT-PCR was able to quantitatively detect as few as 30 parasites/mL of whole blood, consistent with the assay limit of detection of 20 parasites/mL; the CT curve generated for the most dilute sample was below the assay limit of quantification. Probe-based qRT-PCR for pfs25 and PF3D7_0630000 detected gametocytes from 3 × 107 to 3 × 102 parasites/mL, and pfs25 additionally detected parasites at the 3 × 101 parasites/mL dilution. PF3D7_0630000 mRNA was never detected in samples containing asexual-stage parasites (even at high parasite densities) confirming that this spliced target is absent from asexual stages. All reactions demonstrated high cycling efficiencies (Fig. 3b: 18S rRNA slope −3.14, efficiency 108%, y-intercept: 29.4 cycles; pfs25 slope −3.32, efficiency 100%, y-intercept 35.71 cycles; PF3D7_0630000 slope −3.59, efficiency 90%, y-intercept 42.67 cycles). Consistent with RNAseq data [28], PF3D7_0630000 was less abundant than pfs25, and both mRNAs were much less abundant than the highly expressed Plasmodium 18S rRNA.
Table 2
Cycle thresholds for Plasmodium 18S rRNA, PF3D7_0630000 and pfs25 in gametocyte dilution series
Gametocytes/mL
Plasmodium 18S rRNA
PF3D7_0630000
pfs25
3 × 107
5.40
15.70
10.53
3 × 106
9.36
19.70
14.48
8.85
19.38
13.94
3 × 105
12.16
23.13
17.91
12.34
22.98
17.42
3 × 104
15.12
26.47
20.70
15.11
26.50
20.65
3 × 103
18.14
29.43
23.60
18.63
29.60
23.99
3 × 102
21.85
33.86
27.74
21.82
33.65
27.92
3 × 101
24.06
37.89
30.35
ND
ND
ND
3 × 100
ND
ND
ND
ND
ND
ND
Plasmodium 18S rRNA RT-PCR LOD = 20 parasites/mL
ND, not detected; All in duplicate except 3 × 107 gametocyte/mL sample

PF3D7_0630000 mRNA stability

To assess spliced mRNA target stability, intact gametocytes in whole blood were either preserved in lysis buffer immediately or held at room temperature for 3–7 days before processing into lysis buffer. For all samples (nominal densities 3 × 102–3 × 105 gametocytes/mL), mRNA (pfs25 and PF3D7_0630000) degradation was observed at 3 and 7 days of storage, whereas statistically significant 18S rRNA degradation was not observed until 7 days of storage (Fig. 4). PF3D7_0630000 degraded more rapidly than pfs25 at 3 days but this difference was not statistically different at 7 days. These data suggest, while samples for 18S rRNA testing can be stored for several days prior to sample processing, samples for gametocyte-specific pfs25 or PF3D7_0630000 mRNA testing should be processed immediately following collection.

Kinetics of PF3D7_0630000 mRNA expression

To study the time course of PF3D7_0630000 expression, samples were taken from gametocyte cultures during Days 6–14 of culture and compared to expression of the Day 6 sample. This approach was used because on the sixth day of culture, a mix of residual asexual stages and immature gametocytes present, but after the tenth day of culture, most of the parasites were mature gametocytes with ring, trophozoite and schizont stages no longer observed. Unlike asexual-stage parasites that do not express the PF3D7_0630000 spliced mRNA, gametocytes express both pfs25 and PF3D7_630000 mRNAs from by the sixth day of culture. Expression of both targets increased as the cultures matured with pfs25 expression exceeding that of PF3D7_0630000 (Fig. 5). At peak expression (day 14), pfs25 was increased by >2000-fold compared to day 6 of culture while PF3D7_0630000 increased >25-fold.

Detection of gametocytaemia in a volunteer in a controlled human malaria infection trial

To determine if the novel spliced gametocyte-specific mRNA RT-PCR could detect low level gametocytaemia from clinical specimens, samples were first evaluated from a clinical trial in a Seattle-based controlled human malaria infection trial evaluating the prophylactic activity of the drug DSM265. This placebo-controlled prophylactic drug trial was blinded at the time of this manuscript, and it was thus unknown whether subjects received the active compound or the placebo control. Subjects were challenged with 3200 PfSPZ (Sanaria, Inc., Rockville, MD) on Day 0. Final details of the ongoing DSM265 study will be published in a separate manuscript at a later date and do not affect the data described below. Plasmodium infection status was monitored by daily 18S rRNA RT-PCR. One subject developed a late onset infection with 18S rRNA qRT-PCR positivity starting on Day 23 (Fig. 6). The subject was symptomatic (grade 1–2 nausea, vomiting, headache) during this time and was thick blood smear positive on Day 25. The subject was treated on Day 25 with atovaquone–proguanil with rapid conversion to negative blood smears and resolution of symptoms. Plasmodium 18S rRNA concentrations dropped following treatment but did not reach undetectable levels. On Day 33 post-challenge, resurgence in Plasmodium 18S rRNA was noted although the subject was asymptomatic. Persistent asymptomatic positivity for Plasmodium 18S rRNA continued from days 33–42 post-challenge. Neither pfs25 nor PF3D7_0630000 mRNAs were detected during the symptomatic period but both were detected during the second wave of asymptomatic parasitaemia (Fig. 6). The patient was subsequently treated orally with 45 mg primaquine and was negative for all biomarkers at 56 days post-challenge.

Multiplex comparison against other reported gametocyte-specific spliced mRNA targets

In addition to PF3D7_0630000, three other spliced mRNA targets have been reported: the P. falciparum meiotic recombination protein DMC1-like protein gene (PF3D7_0816800) [26], an immature gametocyte marker PHISTa of unknown function (PF3D7_1477700/PF14_0748) [27] and a mature gametocyte marker of unknown function (PF3D7_1438800/PF14_0367) [27]. Each of these targets were individually multiplexed with the pan-Plasmodium 18S rRNA assay and tested against whole blood samples spiked with high (4 × 105 parasites/mL) or low (8 × 102) density pure cultured ring-stage samples or with day 14 cultured gametocytes (Table 3). The PF3D7_1477700 and PF3D7_1438800 markers [27] could not be successfully multiplexed with the pan-Plasmodium 18S rRNA RT-PCR because false positive results were obtained for asexual samples at annealing temperatures of 50 °C (standard for 18S rRNA RT-PCR) and 60 °C (as originally reported for these gametocyte markers [27]). False positive results for the PF3D7_1477700 and PF3D7_1438800 markers were also obtained when testing singleplex reactions against asexual stage parasites (data not shown). PF3D7_0630000 and pfs25, the spliced PF3D7_0816800 target were positive only in the presence of gametocytes (Table 3).
Table 3
Example cycle thresholds for PF3D7_0630000 and published gametocyte-specific RT-PCRs
RT-PCR target (annealing temp.)
Asexual
Gametocyte 3 × 106 g/mL
Negative control
4 × 105 p/mL
8 × 102 p/mL
PF3D7_0630000 (50 °C)
ND
ND
23.02
ND
PF3D7_0816800 (50 °C)
ND
ND
24.98
ND
PF3D7_1477700 (50 °C)
31.96
ND
25.99
ND
PF3D7_1477700 (60 °C)
31.67
38.74
26.50
ND
PF3D7_1438800 (50 °C)
35.42
ND
24.94
ND
PF3D7_1438800 (60 °C)
33.48
ND
25.51
ND
pfs25 (50 °C, DNased template)
ND
ND
17.67
ND
Plasmodium 18S rRNA
14.91
23.82
10.20
ND
ND not detected

One-step multiplex detection of gametocytes in asymptomatic subjects in Uganda

Multiplex qRT-PCRs combining Plasmodium 18S rRNA with either PF3D7_0816800, PF3D7_0630000 or pfs25 were evaluated against 74 Plasmodium-infected samples collected from asymptomatic human volunteers in a Ugandan field study. The parasite densities of these samples ranged from 25 to 2.8 × 107 parasites/mL with estimated gametocyte densities ranging from 1 to 156,828 gametocytes/mL (based on pfs25 standard curves). The pfs25 multiplex assay detected gametocytes in 47/74 samples, PF3D7_0630000 in 50/74 samples and PF3D7_0816800 in 30/74 samples (Additional file 3). pfs25 and PF3D7_0630000 showed a high degree of agreement. Compared to the pfs25 gold standard, the sensitivity of PF3D7_0630000 for gametocyte detection was 97.9% (95% CI 88.7–100.0%) and specificity 85.2% (95% CI 66.3–95.8%). The sensitivity of PF3D7_0816800 qRT-PCR was 63.8% (95% CI 48.5–77.3%) and specificity 100% (87.2–100.0%). Whereas the PF3D7_0630000 reagents detected gametocytes across all pfs25-positive gametocyte densities, PF3D7_0816800 RT-PCR was less sensitive at densities <1000 gametocytes/mL but was positive in all samples with a density of >1000 gametocytes/mL (Table 4; Fig. 7).
Table 4
Performance of gametocyte-specific RT-PCR markers against field samples from Uganda
Gametocytes/mL
n
pfs25
PF3D7_0630000
PF3D7_0816800
Sensitivity (95% CI)
 1–100 (n = 20)
20
100% (83.2–100.0%)
95.0% (75.1–99.9%)
40.0% (19.1–64.0%)
 101–1000 (n = 13)
13
100% (75.3–100.0%)
100.0% (75.3–100.0%)
61.5% (31.6–86.1%)
 >1000 (n = 14)
14
100% (76.8–100.0%)
100.0% (76.8–100.0%)
100.0% (76.8–100.0%)
 All samples (n = 74)
74
100% (92.5–100.0%)
97.9% (88.7–100.0%)
63.8% (48.5–77.3%)
Specificity (95% CI)
 All samples (=74)
74
100% (87.2–100.0%)
85.2% (66.3–95.8%)
100.0% (87.2–100.0%)
Sensitivity = true positive/(true positive + false negative)
Specificity = true negative/(true negative + false positive)
Gametocytes/mL quantities were based on pfs25 standard curve
Quantification of gametocytes in field samples based on pfs25 resulted in estimated densities 1.18 log10 parasites/mL (95% CI 0.89–1.46 log10 parasites/mL) lower on average than the paired estimates made with PF3D7_0630000. Lower pfs25-derived gametocyte quantification could not be explained by overall loss of total nucleic acids during DNase treatment since 35/39 evaluable paired samples (positive by pfs25 and PF3D7_0630000) actually showed earlier 18S rRNA CTs in the pfs25 sample compared to the PF3D7_0630000 sample (Additional file 3).

Discussion

Plasmodium gametocytes can be detected with mRNA-based molecular methods at sub-microscopic densities. Commonly targeted gametocyte-specific P. falciparum mRNAs include those made from single exon genes pfs25 and pfs230 [1720], which necessitates DNase treatment prior to RT-PCR. Here, based on published RNAseq data [28], 18 gametocyte-specific, multi-exon mRNAs were identified and evaluated as DNase-free gametocyte targets to determine if they could be multiplexed with an existing highly sensitive Plasmodium 18S rRNA qRT-PCR. The bioinformatics strategy employed here selected for genes that were highly expressed in mature gametocytes and showed near-zero sense or antisense expression in asexual stages. In wet-lab testing, two female gametocyte-specific mRNAs showed suitable multiplex RT-PCR target characteristics: PF3D7_0630000 and PF3D7_0514500. PF3D7_0630000 encodes a CPW-WPC protein likely expressed in ookinetes, though the coding mRNAs are first expressed and post-transcriptionally regulated in gametocytes [38]. Since the PF3D7_0630000 mRNA accumulates in mature female gametocytes as the parasite awaits ookinete formation, this target may be an ideal gametocyte marker in human blood. PF3D7_0514500 (alias PFE0725C) encodes a six-exon conserved membrane protein of unknown function and was noted to be a member of the sexual development gene cluster in a previous full-genome high-density oligonucleotide microarray study [39]. Interestingly, PF3D7_0630000 was absent from the same gene cluster study.
Since PF3D7_0630000 was the most promising target, it was intended to be compared against RT-PCR assays for pfs25 and for three other known spliced gametocyte-expressed mRNAs: PF3D7_0816800, PF3D7_1477700 and PF3D7_1438800. However, two of the intended comparator targets could not be multiplexed with the 18S rRNA RT-PCR assay and were therefore not studied against PF3D7_0630000. These targets produced positive results when tested against microscopically-pure asexual stage cultures (that were also pfs25-negative). The extraction method and RT-PCR mastermix used here differed from that originally reported for these markers [27], which may account for discrepancies. In addition, unlike the other targets studied in this project, the PF3D7_1477700 and PF3D7_1438800 mRNAs were both male gametocyte-specific [37], which could have led to false positives in asexual samples if male gametocytes (or less apparent exflagellated forms) were present at minuscule concentrations in asexual cultures; such forms would also be pfs25-negative. While PF3D7_1477700 and PF3D7_1438800 mRNAs may be suitable for multiplexing with 18S rRNA in another extraction/mastermix system, this possibility was not further evaluated here.
The PF3D7_0630000 multiplex RT-PCR was comparably sensitive to pfs25 when tested against a samples from asymptomatic Ugandan subjects. Given this performance, PF3D7_0630000 RT-PCR will be able to detect gametocytes at densities that contribute to transmission, although this should be studied in future in prospective studies. Interestingly, PF3D7_0630000-derived gametocyte density estimates were 1.18 log10 higher on average than pfs25-based estimates, which likely reflects degradation of pfs25 mRNA (but not more robust 18S rRNA) during the DNase treatment step. Detection of pfs25 mRNA by QT-NASBA (which does not require DNase treatment) was reportedly more sensitive than pfs25 RT-PCR, and the authors postulated that the DNase treatment step could have reduced the sensitivity of pfs25 RT-PCR [12]. Thus, it is likely that the increased sensitivity of pfs25 RT-PCR (due to its increased expression) is somewhat offset by increased degradation at the DNase treatment step.
By eliminating DNase treatment, gametocyte-specific RT-PCR targets can be directly incorporated into multiplex RT-PCR assays from total nucleic acids. This importance of this workflow improvement may be significant. Although ‘on-column’ DNase treatment is available for some manual RNA purification kits, this was not an option for the platform used here (Abbott m2000sp/rt [22]. Elimination of DNase treatment would be advantageous. In epidemiological studies, simplified sample processing that minimizes hands-on time and eliminates manual steps are desirable since extra steps serve to increase false positive and negative results through cross-contamination, target degradation and other processing errors. The use of spliced gametocyte-specific mRNAs such as those identified here (PF3D7_0630000 and PF3D7_0514500) or those reported previously [26, 27] offer the possibility of this sort of simplified testing. Other spliced mRNA targets beyond these may also be suitable for RT-PCR. Similarly, spliced mRNA RT-PCR may also be useful for detecting asexual stage-specific spliced mRNAs such as the ring-specific transcript from the two-exon PF3D7_0501300 (PFE0065w) gene previously used as an asexual parasite marker [27]. Multiplex assays that include the Plasmodium 18S rRNA, a spliced gametocyte-specific mRNA and a spliced ring/asexual-specific mRNA could eventually provide for one-step P. falciparum infection monitoring that would differentiate between potentially symptomatic and asymptomatic infections. The PF3D7_0630000-specific spliced marker identified here may be useful in future gametocyte screening studies.

Authors’ contributions

AH and SCM performed the bioinformatics analyses. AH, ZPB, TMO, AMS, MC and SCM developed RT-PCR reagents and performed the experiments. MF and SHK cultured P. falciparum gametocytes. TR, NA, KJ, JGK and SCM performed the DSM265 clinical trial. BG, EA, JK, SD and GJD performed the field study. AH, ZPB and SCM reviewed the data and wrote the manuscript that was reviewed. All authors read and approved the final manuscript.

Acknowledgements

The staff of the Insectary at the Center for Infectious Disease Research is acknowledged for assistance with parasite culture. Staff at the Fred Hutchinson Cancer Research Center Prevention Center, the Seattle Malaria Clinical Trials Center and the Medicines for Malaria Venture are acknowledged for assistance with the DSM265 trial. Staff at the clinical site in Uganda are acknowledged for conducting the field study.

Competing interests

The authors declare that they have no competing interests.

Availability of data and materials

The datasets utilized in this manuscript are described in the manuscript or are available at plasmodb.org and in Ref. [28].
The IRB-approved informed consent for the DSM265 and Ugandan studies included the consent to publish.
The DSM265 study was reviewed and approved by the Fred Hutchinson Cancer Research Center IRB (#8408). The study in Uganda was reviewed and approved by the University of California San Francisco IRB (#11-05995) and Uganda IRB (#2011-0167). In all studies, subjects were enrolled in the study only after obtaining informed consent using IRB-approved documents.

Funding

Funding was from the Bill and Melinda Gates Foundation for Plasmodium molecular diagnostic test development (OPP1133622 to S. Murphy). The DSM265 study clinical trial was supported by the Assistant Secretary of Defense for Health Affairs, through the Peer Reviewed Medical Research Program (PRMRP) under Award W81XWH-15-2-0010 and the Medicines for Malaria Venture. Opinions, interpretations, conclusions and recommendations are those of the author and are not necessarily endorsed by the Department of Defense. The Ugandan field samples were funded in part by the National Institutes of Health as part of the International Centers of Excellence in Malaria Research program (U19AI089674).

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Literatur
1.
Zurück zum Zitat Pasay CJ, Rockett R, Sekuloski S, Griffin P, Marquart L, Peatey C, et al. Piperaquine monotherapy of drug-susceptible Plasmodium falciparum infection results in rapid clearance of parasitemia but is followed by the appearance of gametocytemia. J Infect Dis. 2016;214:105–13.CrossRefPubMedPubMedCentral Pasay CJ, Rockett R, Sekuloski S, Griffin P, Marquart L, Peatey C, et al. Piperaquine monotherapy of drug-susceptible Plasmodium falciparum infection results in rapid clearance of parasitemia but is followed by the appearance of gametocytemia. J Infect Dis. 2016;214:105–13.CrossRefPubMedPubMedCentral
2.
Zurück zum Zitat Ouedraogo AL, Bousema T, Schneider P, de Vlas SJ, Ilboudo-Sanogo E, Cuzin-Ouattara N, et al. Substantial contribution of submicroscopical Plasmodium falciparum gametocyte carriage to the infectious reservoir in an area of seasonal transmission. PLoS One. 2009;4:e8410.CrossRefPubMedPubMedCentral Ouedraogo AL, Bousema T, Schneider P, de Vlas SJ, Ilboudo-Sanogo E, Cuzin-Ouattara N, et al. Substantial contribution of submicroscopical Plasmodium falciparum gametocyte carriage to the infectious reservoir in an area of seasonal transmission. PLoS One. 2009;4:e8410.CrossRefPubMedPubMedCentral
3.
Zurück zum Zitat Babiker HA, Abdel-Wahab A, Ahmed S, Suleiman S, Ranford-Cartwright L, Carter R, et al. Detection of low level Plasmodium falciparum gametocytes using reverse transcriptase polymerase chain reaction. Mol Biochem Parasitol. 1999;99:143–8.CrossRefPubMed Babiker HA, Abdel-Wahab A, Ahmed S, Suleiman S, Ranford-Cartwright L, Carter R, et al. Detection of low level Plasmodium falciparum gametocytes using reverse transcriptase polymerase chain reaction. Mol Biochem Parasitol. 1999;99:143–8.CrossRefPubMed
4.
Zurück zum Zitat Smalley ME, Sinden RE. Plasmodium falciparum gametocytes: their longevity and infectivity. Parasitology. 1977;74:1–8.CrossRefPubMed Smalley ME, Sinden RE. Plasmodium falciparum gametocytes: their longevity and infectivity. Parasitology. 1977;74:1–8.CrossRefPubMed
5.
Zurück zum Zitat Jeffery GM, Eyles DE. Infectivity to mosquitoes of Plasmodium falciparum as related to gametocyte density and duration of infection. Am J Trop Med Hyg. 1955;4:781–9.CrossRefPubMed Jeffery GM, Eyles DE. Infectivity to mosquitoes of Plasmodium falciparum as related to gametocyte density and duration of infection. Am J Trop Med Hyg. 1955;4:781–9.CrossRefPubMed
6.
Zurück zum Zitat Bousema T, Drakeley C. Epidemiology and infectivity of Plasmodium falciparum and Plasmodium vivax gametocytes in relation to malaria control and elimination. Clin Microbiol Rev. 2011;24:377–410.CrossRefPubMedPubMedCentral Bousema T, Drakeley C. Epidemiology and infectivity of Plasmodium falciparum and Plasmodium vivax gametocytes in relation to malaria control and elimination. Clin Microbiol Rev. 2011;24:377–410.CrossRefPubMedPubMedCentral
7.
Zurück zum Zitat Churcher TS, Bousema T, Walker M, Drakeley C, Schneider P, Ouedraogo AL, et al. Predicting mosquito infection from Plasmodium falciparum gametocyte density and estimating the reservoir of infection. Elife. 2013;2:e00626.CrossRefPubMedPubMedCentral Churcher TS, Bousema T, Walker M, Drakeley C, Schneider P, Ouedraogo AL, et al. Predicting mosquito infection from Plasmodium falciparum gametocyte density and estimating the reservoir of infection. Elife. 2013;2:e00626.CrossRefPubMedPubMedCentral
8.
Zurück zum Zitat Bousema T, Dinglasan RR, Morlais I, Gouagna LC, van Warmerdam T, Awono-Ambene PH, et al. Mosquito feeding assays to determine the infectiousness of naturally infected Plasmodium falciparum gametocyte carriers. PLoS One. 2012;7:e42821.CrossRefPubMedPubMedCentral Bousema T, Dinglasan RR, Morlais I, Gouagna LC, van Warmerdam T, Awono-Ambene PH, et al. Mosquito feeding assays to determine the infectiousness of naturally infected Plasmodium falciparum gametocyte carriers. PLoS One. 2012;7:e42821.CrossRefPubMedPubMedCentral
9.
Zurück zum Zitat Schneider P, Bousema JT, Gouagna LC, Otieno S, van de Vegte-Bolmer M, Omar SA, et al. Submicroscopic Plasmodium falciparum gametocyte densities frequently result in mosquito infection. Am J Trop Med Hyg. 2007;76:470–4.PubMed Schneider P, Bousema JT, Gouagna LC, Otieno S, van de Vegte-Bolmer M, Omar SA, et al. Submicroscopic Plasmodium falciparum gametocyte densities frequently result in mosquito infection. Am J Trop Med Hyg. 2007;76:470–4.PubMed
11.
Zurück zum Zitat Mlambo G, Vasquez Y, LeBlanc R, Sullivan D, Kumar N. A filter paper method for the detection of Plasmodium falciparum gametocytes by reverse transcription polymerase chain reaction. Am J Trop Med Hyg. 2008;78:114–6.PubMed Mlambo G, Vasquez Y, LeBlanc R, Sullivan D, Kumar N. A filter paper method for the detection of Plasmodium falciparum gametocytes by reverse transcription polymerase chain reaction. Am J Trop Med Hyg. 2008;78:114–6.PubMed
12.
Zurück zum Zitat Jones S, Sutherland CJ, Hermsen C, Arens T, Teelen K, Hallett R, et al. Filter paper collection of Plasmodium falciparum mRNA for detecting low-density gametocytes. Malar J. 2012;11:266.CrossRefPubMedPubMedCentral Jones S, Sutherland CJ, Hermsen C, Arens T, Teelen K, Hallett R, et al. Filter paper collection of Plasmodium falciparum mRNA for detecting low-density gametocytes. Malar J. 2012;11:266.CrossRefPubMedPubMedCentral
13.
Zurück zum Zitat Maeno Y, Nakazawa S, le Dao D, Yamamoto N, Giang ND, Van Hanh T, et al. A dried blood sample on filter paper is suitable for detecting Plasmodium falciparum gametocytes by reverse transcription polymerase chain reaction. Acta Trop. 2008;107:121–7.CrossRefPubMed Maeno Y, Nakazawa S, le Dao D, Yamamoto N, Giang ND, Van Hanh T, et al. A dried blood sample on filter paper is suitable for detecting Plasmodium falciparum gametocytes by reverse transcription polymerase chain reaction. Acta Trop. 2008;107:121–7.CrossRefPubMed
14.
Zurück zum Zitat Kuamsab N, Putaporntip C, Pattanawong U, Jongwutiwes S. Simultaneous detection of Plasmodium vivax and Plasmodium falciparum gametocytes in clinical isolates by multiplex-nested RT-PCR. Malar J. 2012;11:190.CrossRefPubMedPubMedCentral Kuamsab N, Putaporntip C, Pattanawong U, Jongwutiwes S. Simultaneous detection of Plasmodium vivax and Plasmodium falciparum gametocytes in clinical isolates by multiplex-nested RT-PCR. Malar J. 2012;11:190.CrossRefPubMedPubMedCentral
15.
Zurück zum Zitat Schneider P, Schoone G, Schallig H, Verhage D, Telgt D, Eling W, et al. Quantification of Plasmodium falciparum gametocytes in differential stages of development by quantitative nucleic acid sequence-based amplification. Mol Biochem Parasitol. 2004;137:35–41.CrossRefPubMed Schneider P, Schoone G, Schallig H, Verhage D, Telgt D, Eling W, et al. Quantification of Plasmodium falciparum gametocytes in differential stages of development by quantitative nucleic acid sequence-based amplification. Mol Biochem Parasitol. 2004;137:35–41.CrossRefPubMed
16.
Zurück zum Zitat Bousema JT, Drakeley CJ, Mens PF, Arens T, Houben R, Omar SA, et al. Increased Plasmodium falciparum gametocyte production in mixed infections with P. malariae. Am J Trop Med Hyg. 2008;78:442–8.PubMed Bousema JT, Drakeley CJ, Mens PF, Arens T, Houben R, Omar SA, et al. Increased Plasmodium falciparum gametocyte production in mixed infections with P. malariae. Am J Trop Med Hyg. 2008;78:442–8.PubMed
17.
Zurück zum Zitat Wampfler R, Mwingira F, Javati S, Robinson L, Betuela I, Siba P, et al. Strategies for detection of Plasmodium species gametocytes. PLoS One. 2013;8:e76316.CrossRefPubMedPubMedCentral Wampfler R, Mwingira F, Javati S, Robinson L, Betuela I, Siba P, et al. Strategies for detection of Plasmodium species gametocytes. PLoS One. 2013;8:e76316.CrossRefPubMedPubMedCentral
18.
Zurück zum Zitat Niederwieser I, Felger I, Beck HP. Plasmodium falciparum: expression of gametocyte-specific genes in monolayer cultures and malaria-positive blood samples. Exp Parasitol. 2000;95:163–9.CrossRefPubMed Niederwieser I, Felger I, Beck HP. Plasmodium falciparum: expression of gametocyte-specific genes in monolayer cultures and malaria-positive blood samples. Exp Parasitol. 2000;95:163–9.CrossRefPubMed
19.
Zurück zum Zitat Wampfler R, Timinao L, Beck HP, Soulama I, Tiono AB, Siba P, et al. Novel genotyping tools for investigating transmission dynamics of Plasmodium falciparum. J Infect Dis. 2014;210:1188–97.CrossRefPubMedPubMedCentral Wampfler R, Timinao L, Beck HP, Soulama I, Tiono AB, Siba P, et al. Novel genotyping tools for investigating transmission dynamics of Plasmodium falciparum. J Infect Dis. 2014;210:1188–97.CrossRefPubMedPubMedCentral
20.
Zurück zum Zitat Schneider P, Reece SE, van Schaijk BC, Bousema T, Lanke KH, Meaden CS, et al. Quantification of female and male Plasmodium falciparum gametocytes by reverse transcriptase quantitative PCR. Mol Biochem Parasitol. 2015;199:29–33.CrossRefPubMed Schneider P, Reece SE, van Schaijk BC, Bousema T, Lanke KH, Meaden CS, et al. Quantification of female and male Plasmodium falciparum gametocytes by reverse transcriptase quantitative PCR. Mol Biochem Parasitol. 2015;199:29–33.CrossRefPubMed
21.
Zurück zum Zitat Murphy SC, Prentice JL, Williamson K, Wallis CK, Fang FC, Fried M, et al. Real-time quantitative reverse transcription PCR for monitoring of blood-stage Plasmodium falciparum infections in malaria human challenge trials. Am J Trop Med Hyg. 2012;86:383–94.CrossRefPubMedPubMedCentral Murphy SC, Prentice JL, Williamson K, Wallis CK, Fang FC, Fried M, et al. Real-time quantitative reverse transcription PCR for monitoring of blood-stage Plasmodium falciparum infections in malaria human challenge trials. Am J Trop Med Hyg. 2012;86:383–94.CrossRefPubMedPubMedCentral
22.
Zurück zum Zitat Murphy SC, Daza G, Chang M, Coombs R. Laser cutting eliminates nucleic acid cross-contamination in dried-blood-spot processing. J Clin Microbiol. 2012;50:4128–30.CrossRefPubMedPubMedCentral Murphy SC, Daza G, Chang M, Coombs R. Laser cutting eliminates nucleic acid cross-contamination in dried-blood-spot processing. J Clin Microbiol. 2012;50:4128–30.CrossRefPubMedPubMedCentral
23.
Zurück zum Zitat McCutchan TF, Li J, McConkey GA, Rogers MJ, Waters AP. The cytoplasmic ribosomal RNAs of Plasmodium spp. Parasitol Today. 1995;11:134–8.CrossRefPubMed McCutchan TF, Li J, McConkey GA, Rogers MJ, Waters AP. The cytoplasmic ribosomal RNAs of Plasmodium spp. Parasitol Today. 1995;11:134–8.CrossRefPubMed
24.
Zurück zum Zitat Waters AP, Syin C, McCutchan TF. Developmental regulation of stage-specific ribosome populations in Plasmodium. Nature. 1989;342:438–40.CrossRefPubMed Waters AP, Syin C, McCutchan TF. Developmental regulation of stage-specific ribosome populations in Plasmodium. Nature. 1989;342:438–40.CrossRefPubMed
25.
Zurück zum Zitat Thompson J, van Spaendonk RM, Choudhuri R, Sinden RE, Janse CJ, Waters AP. Heterogeneous ribosome populations are present in Plasmodium berghei during development in its vector. Mol Microbiol. 1999;31:253–60.CrossRefPubMed Thompson J, van Spaendonk RM, Choudhuri R, Sinden RE, Janse CJ, Waters AP. Heterogeneous ribosome populations are present in Plasmodium berghei during development in its vector. Mol Microbiol. 1999;31:253–60.CrossRefPubMed
26.
Zurück zum Zitat Lawaly YR, Sakuntabhai A, Marrama L, Konate L, Phimpraphi W, Sokhna C, et al. Heritability of the human infectious reservoir of malaria parasites. PLoS One. 2010;5:e11358.CrossRefPubMedPubMedCentral Lawaly YR, Sakuntabhai A, Marrama L, Konate L, Phimpraphi W, Sokhna C, et al. Heritability of the human infectious reservoir of malaria parasites. PLoS One. 2010;5:e11358.CrossRefPubMedPubMedCentral
27.
Zurück zum Zitat Joice R, Narasimhan V, Montgomery J, Sidhu AB, Oh K, Meyer E, et al. Inferring developmental stage composition from gene expression in human malaria. PLoS Comput Biol. 2013;9:e1003392.CrossRefPubMedPubMedCentral Joice R, Narasimhan V, Montgomery J, Sidhu AB, Oh K, Meyer E, et al. Inferring developmental stage composition from gene expression in human malaria. PLoS Comput Biol. 2013;9:e1003392.CrossRefPubMedPubMedCentral
28.
Zurück zum Zitat Lopez-Barragan MJ, Lemieux J, Quinones M, Williamson KC, Molina-Cruz A, Cui K, et al. Directional gene expression and antisense transcripts in sexual and asexual stages of Plasmodium falciparum. BMC Genomics. 2011;12:587.CrossRefPubMedPubMedCentral Lopez-Barragan MJ, Lemieux J, Quinones M, Williamson KC, Molina-Cruz A, Cui K, et al. Directional gene expression and antisense transcripts in sexual and asexual stages of Plasmodium falciparum. BMC Genomics. 2011;12:587.CrossRefPubMedPubMedCentral
29.
Zurück zum Zitat VanBuskirk KM, O’Neill MT, De La Vega P, Maier AG, Krzych U, Williams J, et al. Preerythrocytic, live-attenuated Plasmodium falciparum vaccine candidates by design. Proc Natl Acad Sci USA. 2009;106:13004–9.CrossRefPubMedPubMedCentral VanBuskirk KM, O’Neill MT, De La Vega P, Maier AG, Krzych U, Williams J, et al. Preerythrocytic, live-attenuated Plasmodium falciparum vaccine candidates by design. Proc Natl Acad Sci USA. 2009;106:13004–9.CrossRefPubMedPubMedCentral
30.
Zurück zum Zitat Kamya MR, Arinaitwe E, Wanzira H, Katureebe A, Barusya C, Kigozi SP, et al. Malaria transmission, infection, and disease at three sites with varied transmission intensity in Uganda: implications for malaria control. Am J Trop Med Hyg. 2015;92:903–12.CrossRefPubMedPubMedCentral Kamya MR, Arinaitwe E, Wanzira H, Katureebe A, Barusya C, Kigozi SP, et al. Malaria transmission, infection, and disease at three sites with varied transmission intensity in Uganda: implications for malaria control. Am J Trop Med Hyg. 2015;92:903–12.CrossRefPubMedPubMedCentral
31.
Zurück zum Zitat Billman ZP, Seilie AM, Murphy SC. Purification of Plasmodium sporozoites enhances parasite-specific CD8+ T cell responses. Infect Immun. 2016;84:2233–42.CrossRefPubMedPubMedCentral Billman ZP, Seilie AM, Murphy SC. Purification of Plasmodium sporozoites enhances parasite-specific CD8+ T cell responses. Infect Immun. 2016;84:2233–42.CrossRefPubMedPubMedCentral
32.
Zurück zum Zitat Clopper C, Pearson S. The use of confidence or fiducial limits illustrated in the case of the Binomial. Biometrika. 1934;26:404–13.CrossRef Clopper C, Pearson S. The use of confidence or fiducial limits illustrated in the case of the Binomial. Biometrika. 1934;26:404–13.CrossRef
33.
Zurück zum Zitat Haddad F, Qin AX, Giger JM, Guo H, Baldwin KM. Potential pitfalls in the accuracy of analysis of natural sense-antisense RNA pairs by reverse transcription-PCR. BMC Biotechnol. 2007;7:21.CrossRefPubMedPubMedCentral Haddad F, Qin AX, Giger JM, Guo H, Baldwin KM. Potential pitfalls in the accuracy of analysis of natural sense-antisense RNA pairs by reverse transcription-PCR. BMC Biotechnol. 2007;7:21.CrossRefPubMedPubMedCentral
34.
Zurück zum Zitat Gunji T, Kato N, Hijikata M, Hayashi K, Saitoh S, Shimotohno K. Specific detection of positive and negative stranded hepatitis C viral RNA using chemical RNA modification. Arch Virol. 1994;134:293–302.CrossRefPubMed Gunji T, Kato N, Hijikata M, Hayashi K, Saitoh S, Shimotohno K. Specific detection of positive and negative stranded hepatitis C viral RNA using chemical RNA modification. Arch Virol. 1994;134:293–302.CrossRefPubMed
35.
Zurück zum Zitat Lanford RE, Sureau C, Jacob JR, White R, Fuerst TR. Demonstration of in vitro infection of chimpanzee hepatocytes with hepatitis C virus using strand-specific RT/PCR. Virology. 1994;202:606–14.CrossRefPubMed Lanford RE, Sureau C, Jacob JR, White R, Fuerst TR. Demonstration of in vitro infection of chimpanzee hepatocytes with hepatitis C virus using strand-specific RT/PCR. Virology. 1994;202:606–14.CrossRefPubMed
36.
Zurück zum Zitat Sangar DV, Carroll AR. A tale of two strands: reverse-transcriptase polymerase chain reaction detection of hepatitis C virus replication. Hepatology. 1998;28:1173–6.CrossRefPubMed Sangar DV, Carroll AR. A tale of two strands: reverse-transcriptase polymerase chain reaction detection of hepatitis C virus replication. Hepatology. 1998;28:1173–6.CrossRefPubMed
37.
Zurück zum Zitat Lasonder E, Rijpma SR, van Schaijk BC, Hoeijmakers WA, Kensche PR, Gresnigt MS, et al. Integrated transcriptomic and proteomic analyses of P. falciparum gametocytes: molecular insight into sex-specific processes and translational repression. Nucleic Acids Res. 2016;44:6087–101.CrossRefPubMedPubMedCentral Lasonder E, Rijpma SR, van Schaijk BC, Hoeijmakers WA, Kensche PR, Gresnigt MS, et al. Integrated transcriptomic and proteomic analyses of P. falciparum gametocytes: molecular insight into sex-specific processes and translational repression. Nucleic Acids Res. 2016;44:6087–101.CrossRefPubMedPubMedCentral
38.
Zurück zum Zitat Kangwanrangsan N, Tachibana M, Jenwithisuk R, Tsuboi T, Riengrojpitak S, Torii M, et al. A member of the CPW-WPC protein family is expressed in and localized to the surface of developing ookinetes. Malar J. 2013;12:129.CrossRefPubMedPubMedCentral Kangwanrangsan N, Tachibana M, Jenwithisuk R, Tsuboi T, Riengrojpitak S, Torii M, et al. A member of the CPW-WPC protein family is expressed in and localized to the surface of developing ookinetes. Malar J. 2013;12:129.CrossRefPubMedPubMedCentral
39.
Zurück zum Zitat Young JA, Fivelman QL, Blair PL, de la Vega P, Le Roch KG, Zhou Y, et al. The Plasmodium falciparum sexual development transcriptome: a microarray analysis using ontology-based pattern identification. Parasitology. 2005;143:67–79. Young JA, Fivelman QL, Blair PL, de la Vega P, Le Roch KG, Zhou Y, et al. The Plasmodium falciparum sexual development transcriptome: a microarray analysis using ontology-based pattern identification. Parasitology. 2005;143:67–79.
Metadaten
Titel
Multiplex, DNase-free one-step reverse transcription PCR for Plasmodium 18S rRNA and spliced gametocyte-specific mRNAs
verfasst von
Amelia E. Hanron
Zachary P. Billman
Annette M. Seilie
Tayla M. Olsen
Matthew Fishbaugher
Ming Chang
Thomas Rueckle
Nicole Andenmatten
Bryan Greenhouse
Emmanuel Arinaitwe
John Rek
Smita Das
Gonzalo J. Domingo
Kelly Shipman
Stefan H. Kappe
James G. Kublin
Sean C. Murphy
Publikationsdatum
01.12.2017
Verlag
BioMed Central
Erschienen in
Malaria Journal / Ausgabe 1/2017
Elektronische ISSN: 1475-2875
DOI
https://doi.org/10.1186/s12936-017-1863-3

Weitere Artikel der Ausgabe 1/2017

Malaria Journal 1/2017 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Notfall-TEP der Hüfte ist auch bei 90-Jährigen machbar

26.04.2024 Hüft-TEP Nachrichten

Ob bei einer Notfalloperation nach Schenkelhalsfraktur eine Hemiarthroplastik oder eine totale Endoprothese (TEP) eingebaut wird, sollte nicht allein vom Alter der Patientinnen und Patienten abhängen. Auch über 90-Jährige können von der TEP profitieren.

Niedriger diastolischer Blutdruck erhöht Risiko für schwere kardiovaskuläre Komplikationen

25.04.2024 Hypotonie Nachrichten

Wenn unter einer medikamentösen Hochdrucktherapie der diastolische Blutdruck in den Keller geht, steigt das Risiko für schwere kardiovaskuläre Ereignisse: Darauf deutet eine Sekundäranalyse der SPRINT-Studie hin.

Bei schweren Reaktionen auf Insektenstiche empfiehlt sich eine spezifische Immuntherapie

Insektenstiche sind bei Erwachsenen die häufigsten Auslöser einer Anaphylaxie. Einen wirksamen Schutz vor schweren anaphylaktischen Reaktionen bietet die allergenspezifische Immuntherapie. Jedoch kommt sie noch viel zu selten zum Einsatz.

Therapiestart mit Blutdrucksenkern erhöht Frakturrisiko

25.04.2024 Hypertonie Nachrichten

Beginnen ältere Männer im Pflegeheim eine Antihypertensiva-Therapie, dann ist die Frakturrate in den folgenden 30 Tagen mehr als verdoppelt. Besonders häufig stürzen Demenzkranke und Männer, die erstmals Blutdrucksenker nehmen. Dafür spricht eine Analyse unter US-Veteranen.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.