Introduction
Interleukin-1 (IL-1) was the first cytokine described to act on the brain. It exerts multiple actions on the nervous system including induction of fever, suppression of appetite, and modulation of sleep, as well as alterations in immune or neuroendocrine functions [
1]. While IL-1 is not neurotoxic to neurons in culture or upon injection in a normal healthy brain [
2], it exacerbates neuronal death and damage caused by other insults such as ischemia, trauma, or excitotoxic injury [
2,
3]. IL-1 expression levels are strongly elevated in several conditions of acute injury to the central nervous system (CNS), just like in human neurodegenerative patients [
4]. Inhibition of IL-1 in vivo by using blocking antibodies, the IL-1 receptor antagonist IL-1ra, or genetic mouse models for caspase-1 deficiency leads to a dramatic reduction in neuronal loss upon stroke or brain trauma [
5,
6]. As such, IL-1 has been postulated as a major culprit in acute neurodegeneration [
1,
5].
The term interleukin-1 refers to two closely related family members, IL-1α and IL-1β, that are both synthesized as precursor proteins [
7]. Unlike pro-IL-1α, pro-IL-1β is strictly dependent on processing by caspase-1 to gain biological activity [
7]. Processing occurs in a molecular platform, called the inflammasome [
8‐
10]. Inflammasomes are assembled around a pattern recognition receptor (PRR) molecule that belongs to the NOD-like receptor (Nlr) or HIN-200 protein family [
11]. Upon ligand binding, they recruit an adaptor protein apoptosis-associated speck-like protein containing a CARD (ASC) that serves as a scaffold for recruitment, oligomerization, and autoprocessing of caspase-1 [
10]. Several inflammasomes have been described, the best characterized being centered around Nlrp1, Nlrp3, ICE-protease activating factor (IPAF)/Nlrc4, and the HIN-200 members absent in melanoma 2 (AIM2) and IFN-γ inducible protein 16 (IFI16) [
9]. In addition, the Nlrs Nlrp6 and Nlrp12 have also been suggested to assemble inflammasomes, although they also have been linked to regulation of MAP kinase and NF-κB signaling [
12].
While they were originally described in immune cells, recent data show expression of inflammasome components in the CNS [
13‐
16] and their activation by prototypical neurological insults such as amyloid-beta [
13]. Limited data shows that inhibition of inflammasome components with antibodies against ASC or by using Nlrp3 knock-out mice protects against spinal cord injury [
17,
18] and cuprizone-mediated demyelination [
19]. In the peripheral nervous system (PNS), the role of IL-1 and especially the inflammasome is less well established. Therefore, we aimed to analyze expression of inflammasome components in the PNS and to evaluate their role in a model of acute peripheral nerve injury.
Material and methods
Mice work
All animal experiments were approved by the local ethics committee (University of Antwerp and University of Ghent) and conducted according to the guidelines of the Federation of European Laboratory Animal Science Associations (FELASA). In this study, wild type, caspase-1/-11 double knock-out, and ASC, Nlrp3, and Nlrp6 single knock-out mice were used [
12,
20‐
22]. All mice had a C57BL/6 background, and either sex was used.
Cell isolation
All primary cell isolations were conducted as described previously [
23]. Briefly, primary Schwann cells were isolated from neonatal mouse sciatic nerve taken from P4–P6 pups from C57BL/6 mice [
24,
25]. Neonatal animals were decapitated, and sciatic nerves were isolated. The peri- and epineurium of the sciatic nerves were removed, and the nerves were enzymatically and mechanically dissociated. The Schwann cells were plated on poly-
l-lysin- and laminin-coated culture plates in DMEM/5 % horse serum supplemented with 10 μM cytosine b-D arabinofuranoside to remove mitotic cells. After 72 h, the medium was replaced with defined medium [
26] and refreshed every 2 days. Motor neurons were isolated from the ventral part of spinal cord from E13 mouse embryos [
27]. The ventral part of the spinal cord was dissociated both mechanically and enzymatically. Glial cells and motor neurons were separated by centrifugation in a 6.2 % OptiPrep gradient. Motor neurons were plated on poly-
l-ornithine- and laminin-coated plates in NB medium (Invitrogen) supplemented with 2 % B27 supplement, 4 g/l glucose, 2 mM
l-glutamine, and 50 ng/ml NGF. Sensory neurons were isolated from dorsal root ganglia (DRGs) from E13 mouse embryos [
28]. The spinal cord was dissected, and DRGs were carefully removed. DRGs were enzymatically and mechanically dissociated, and cells were plated on poly-
l-lysin- and laminin-coated dishes in NB medium supplemented with 2 % B27 supplement, 4 g/l glucose, 2 mM
l-glutamine, and 50 ng/ml NGF. To obtain pure sensory neuron cultures, cycling every 2 days between the above-described medium and the same medium enriched with 1 % (
v/
v) FUDR (final 10 μM FdU and 10 μM uridine) was necessary. Peritoneal macrophages were isolated from adult mice that were injected with 3 % thioglycollate [
29]. On day 4 after injection, mice were euthanized and the peritoneal cavity rinsed with ice-cold phosphate-buffered saline (PBS). Macrophages were collected and resuspended in RPMI with 1 % fetal calf serum (FCS). Erythrocytes, in suspension, were removed after 45 min. The remaining cells were kept in RPMI with 10 % FCS. The next day, dendritic cells in suspension were removed and macrophages were kept in culture.
Induction of peripheral nerve injury
Axotomy experiments of the
Nervus
ischiadicus (sciatic nerve) were conducted in 6- to 8-week-old C57BL/6 mice as previously described [
23]. Briefly, mice were anesthetized with a single intraperitoneal injection of ketamine (Ketalar; Pfizer; 150 mg/kg) and xylazine (Rompun; Bayer; 10 mg/kg). An incision was made at the right thigh, and gluteal and hamstring muscles were carefully separated to expose the sciatic nerve. The sciatic nerve was transected or crushed, and the wound was closed by sutures. The contralateral (control) side was left untouched. For analgesia, bupronorphinum (Temgesic; Schering-Slough; 0.1 mg/kg) was injected after surgery. We first evaluated the effect of sham operation on the induction of several Nlrs, but did not find rigorous effects (data not shown).
Intravenous injection of LPS
Lipopolysaccharide (LPS; TLR4-ligand) (Sigma; 10 mg/kg) was injected intravenously in 6- to 8-week-old C57BL/6 mice. PBS was injected in the control mice.
RNA isolation and RT-qPCR
At 4, 24, 48, or 72 h after sciatic nerve transection, the mice were euthanized. The distal part of the transected
N. ischiadicus and the contralateral control side were removed, snap frozen, and stored at −80 °C until use. The nerves were homogenized in TRIzol with a Potter-Elvehjem homogenizator, and small fragments were further homogenized by sonication. Total RNA was extracted using the RNeasy Lipid Tissue kit (Qiagen) according to the manufacturer’s protocol. DNase treatment was performed with TURBO DNase (Ambion), and cDNA synthesis was done with the Superscript III first strand synthesis system for RT-PCR (Invitrogen). RNA from cell populations that were isolated from the sciatic nerve was obtained using the RNEasy Plus Micro Kit (Qiagen) following the manufacturer’s instructions, and RNA integrity was assessed using a Bioanalyzer 2100 (Agilent). Using the Ambion WT Expression Kit, per sample, an amount of 50 ng of total RNA spiked with bacterial poly-A RNA positive controls (Affymetrix) was converted to double-stranded cDNA in a reverse transcription reaction. Real-time quantitative polymerase chain reactions (RT-qPCRs) were performed with 10 ng cDNA in SYBR Green I mix and run on a ViiA 7 Real-Time PCR System (Applied Biosystems). All PCR reactions were done in triplicate. Primers were designed making use of PrimerBank. Primer sequences are listed in Table
1. The RT-qPCR data were normalized according to the method described by Vandesompele et al. [
30], by geometric averaging of multiple internal control genes. Processing of raw data and calculation of normalized relative quantities were done by using an improved version of the ΔΔCt method [
31]. The mRNA expression levels are expressed relative to the basal condition (not-operated mice or not-injected mice). The two most stable housekeeping genes out of five for the different experiments were hydroxymethylbilane synthase (HMBS) and 60S ribosomal protein L13a (RPL13a).
Table 1
Primer sequences for RT-qPCR
Nlr- and inflammasome-related genes |
ASC | CAGCACAGGCAAGCACTCA | GGTGGTCTCTGCACGAACT |
IPAF | AGGAATTCCAAGCTCACACC | ATCACCTGAAGCTCCACCTC |
Casp1 | GGGACCCTCAAGTTTTGCC | GACGTGTACGAGTGGTTGTATT |
Casp11 | AGGCTTTGCAGAGAAAAGACAC | CCCATACCTCAGTGAGAGATGT |
Nlrp1a | TTAGATGAGCATGCCATTGC | ACTCCTGAAGACACAAGTGG |
Nlrp2 | AAGGAGCTAAAAGGCCAGAGG | TCTTTGGGTTACACAATGCCAG |
Nlrp3 | TGTGAGAAGCAGGTTCTACTCT | GGATGCTCCTTGACCAGTTGG |
Nlrp4e | ATATCCAAGTAAGAAAAGCC | GAGAGCCTCCTCAGCAAACAC |
Nlrp5 | GAAAGCACAATGGGTCCTCCA | CTGACGCCTGTTCCACTTCT |
Nlrp6 | AGCTGAGAACGCTGTGTCG | AACTTGGGAACCCCGAAGC |
Nlrp9b | CGAAAATCGAGAATTCTTCC | ACCTGTAGAAACAGGCTTAAC |
Nlrp10 | TCAAGACGCTGAAGTTCCACT | TGCTCCGTACATTGAAATCAGTT |
NAIP1 | TGCCCAGTATATCCAAGGCTAT | AGACGCTGTCGTTGCAGTAAG |
NAIP2 | GCTGTGGATTGAGTGTCTTAGAG | GTTCTCCCTCGAAGGAACTGC |
NAIP5 | TGCCAAACCTACAAGAGCTGA | CAAGCGTTTAGACTGGGGATG |
NAIP6 | AGCCACCAGCTATAAATGAGGA | CAGATTCCAGTACCCTTCACTGA |
NOD1 | GAAATTGGCTTCTCCCCTTC | ATAGGTCTCCTCCAGCAGCA |
NOD2 | CTCCACTGCCTCTGCCTTAC | GCAGCTCCAAGATGTTCTCC |
Interleukin-1-family-related genes |
IL-1β | GCAACTGTTCCTGAACTCAACT | ATCTTTTGGGGTCCGTCAACT |
IL-1α | CTGATGAAGCTCGTCAGGCAG | TGGTGCTGAGATAGTGTTTGTC |
IL-18 | GACTCTTGCGTCAACTTCAAGG | CAGGCTGTCTTTTGTCAACGA |
IL-1ra | GCTCATTGCTGGGTACTTACAA | CCAGACTTGGCACAAGACAGG |
Immune mediators |
MIP-1α | TTCTCTGTACCATGACACTCTGC | CGTGGAATCTTCCGGCTGTAG |
TNF | CCCTCACACTCAGATCATCTTCT | GCTACGACGTGGGCTACAG |
IL-6 | TAGTCCTTCCTACCCCAATTTCC | TTGGTCCTTAGCCACTCCTTC |
MCP-1 | TTAAAAACCTGGATCGGAACCAA | GCATTAGCTTCAGATTTACGGGT |
Housekeeping genes |
ACTB | GCTTCTAGGCGGACTGTTACTGA | GCCATGCCAATGTTGTCTCTTAT |
B2M | ATGCACGCAGAAAGAAATAGCAA | AGCTATCTAGGATATTTCCAATTTTTGAA |
HMBS | GAAACTCTGCTTCGCTGCATT | TGCCCATCTTTCATCACTGTATG |
RPL13a | CCTGCTGCTCTCAAGGTTGTT | TGGTTGTCACTGCCTGGTACTT |
TBP | TCTACCGTGAATCTTGGCTGTAAA | TTCTCATGATGACTGCAGCAAA |
Sorting of different cell populations from the peripheral nerve
Sciatic nerves were cut and digested with Liberase TM (0.02 mg/ml; Roche) and Dnase I recombinant (0.01 U/μl; Roche) for 30 min at 37 °C in RPMI. The cell suspension was filtered over a 100-μm nylon mesh. The cells were first stained with P75NTR-biotin and subsequently with Ly6C-FITC, SiglecF-Pe, CD11c-PeCy7, CD64-APC, MHCII-APCCy7, Ly6G-Alexa Fluor 700, CD11b-Pacific Blue, CD3-PeCy5, CD19-PeCy5, streptavidin-Pe Texas Red, and a live-dead marker conjugated to AmCyan. Schwann cells were isolated by cell sorting gating on FSC/SSC/singlets/P75NTR+/alive. Resident macrophages were isolated by cell sorting gating on FSC/SSC/singlets/CD11b+/SiglecF−/Ly6G−/CD3−/CD19−/Ly6C−/CD64+/MHCII+/alive whereas monocytes were isolated by gating on FSC/SSC/singlets/CD11b+/SiglecF−/Ly6G−/CD3−/CD19−/MHCII−/CD64lo/Ly6C+/alive. Cell sorting was performed on a FACSAria (BD Biosciences).
Western blot analysis
For Western blot analysis, 5-mm segments distal to the transected N. ischiadicus and the contralateral control side were carefully removed, snap frozen, and stored at −80 °C until use. Protein lysates were prepared in E1A lysis buffer (1 % NP-40, 20 mM HEPES (pH 7.9), 250 mM NaCl, 20 mM β-glycerophosphate, 10 mM NaF, 1 mM sodium orthovanadate, 2 mM dithiothreitol, 1 mM EDTA, and a protease inhibitor cocktail) by homogenization in a Potter-Elvehjem homogenizator. Total protein concentration was determined by Bradford. Equal amounts of protein lysates (30 to 40 μg) were separated on NuPAGE gels, transferred to nitrocellulose membranes, and analyzed by immunoblotting. Briefly, membranes were blocked using blocking buffer (5 % milk in PBS containing 0.1 % Tween-20 or 5 % BSA in TBS containing 0.1 % Tween-20) and incubated overnight at 4 °C with a primary antibody. Secondary HRP-conjugated antibodies were used to visualize antibody signals on films using the ECL system (Thermo Scientific). As a positive control for caspase-1 antibody, the intestine of WT and caspase-1/-11-deficient mice that were given dextran sodium sulfate (DSS; 2 %; orally) was used. For the detection of IL-1β in Schwann cell cultures, Schwann cells were stimulated with LPS (2 μg/ml) for 4 h and ATP (5 mM) for the last 30 min. The proteins in the supernatant were precipitated using methanol and chloroform. Total protein samples were loaded on NuPAGE gels and processed as described above. Antibodies used were anti-Nlrp3 (Adipogen; Cryo-1), anti-IL-1β (R&D Systems; AF-401), anti-caspase-1 (Santa Cruz; sc-514), and anti-beta-actin (Abcam; A5441).
ELISA
To determine cytokine levels in C57Bl/6 mice, segments 5 mm long (n = 4) distal to the injury were dissected and protein lysates were obtained in cell lysis buffer (E1A). IL-1β protein levels were determined in the protein lysates using enzyme-linked immunosorbent assays (ELISA) according to the manufacturer’s protocol (BD Biosciences) and with an anti-IL-1β antibody from eBiosciences (cat. no. 88-7013). The absorbance was recorded at 450 nm with a plate reader.
Behavioral analysis
Recovery of the locomotor function after sciatic nerve injury was assessed by using the sciatic functional index (SFI). The SFI was calculated by using the formula adapted for mice by Inserra et al. [
32]. Footprints were analyzed pre-operatively and every week until 7 weeks post-surgery. The behavioral analyses were done blind with respect to the identity of the animals. The SFI values of the knock-out mice were compared to the SFI value of the control group (wild type C57Bl/6 mice). Data on SFI are presented as mean ± SEM.
Statistical analysis
For the different groups of animals included in the behavioral analysis experiments, the SFI values, before and after nerve injury, were compared using an ANOVA. Post hoc comparisons were made using the Bonferroni test. Comparisons of SFI values between groups were made using two-way repeated measures ANOVA followed by the Bonferroni test. All statistical analyses were performed using SPSS software.
Discussion
The role of IL-1β in the peripheral nervous system is still debated. Several studies claim increased expression of IL-1β in the damaged nerve upon sciatic nerve lesion or in models of chronic constriction of the sciatic nerve [
33,
35,
37,
42,
43]. Recent data from the CNS showed the role of the P2X7 and P2X4 receptors in purinergic regulation of the inflammasome [
18,
44]. In the PNS, hardly anything is known on how IL-1β is produced. From a functional perspective, many studies clearly link expression of IL-1β in the PNS with the development of neuropathic pain and spontaneous ectopic neuronal activity [
33,
35,
45,
46]. Genetic studies demonstrated reduced mechanical allodynia in mice lacking the IL-1β receptor as well as in mice lacking both IL-1β and TNF [
35,
43]. Despite this, loss of IL-1β did not lead to improved functional recovery in models of sciatic nerve injury but rather aggravated the phenotype [
35]. This was confirmed by several other studies claiming a neuroprotective role for IL-1β in sciatic nerve regeneration [
36,
38]. IL-1β would be required for promoting Schwann cell migration, extracellular matrix remodeling, and neurite outgrowth [
36,
38].
In the present study, we dissected the role of several key components of the inflammasome, the molecular platform needed for IL-1β processing, on functional recovery in a mouse model of sciatic nerve crush. Since no data were available yet on the expression profile of different inflammasome components in the PNS, we first set out on a detailed expression study of several Nlrs. In basal conditions, predominantly members of the Nlrb and Nlrc family are represented, while hardly any Nlrp family members could be detected. Peripheral nerve injury led to a strong increase of several Nlrp (NALP) and Nlrb (NAIP) family members, while the Nlrc (NOD and IPAF) subfamily was not affected. In the context of bacterial infection, especially the Nlrc and Nlrp family were induced, while this time the Nlrb family remained unaffected, showing distinct expression profiles of Nlr family members in the context of sterile versus bacterial inflammation. Despite the elevated expression of all essential components of the Nlrp1 and/or Nlrp3 inflammasome, we could not demonstrate release of mature IL-1β upon peripheral nerve injury, in contrast to earlier studies [
33,
35,
37,
42,
43]. However, a closer look at the techniques used in these studies (RT-qPCR, ELISA, or immunohistochemistry) learned that most of them rely on techniques that do not allow making a distinction between inactive pro-IL-1β and mature active IL-1β. Antibodies available for ELISA and immunohistochemistry detect both the pro-form and mature IL-1β (see Fig.
6a, b and [
47]), and the only validated technique to date to unambiguously demonstrate the presence of active IL-1β is to show Western blot data of the mature form running at 17 kDa. As to our knowledge, this was only convincingly included in the study by [
35] which did observe expression of mature IL-1β in the sciatic nerve upon ligation. While we could detect mature IL-1β release from cultured Schwann cells upon LPS stimulation (Fig.
6c), we were never able to detect any major release of mature IL-1β upon sciatic nerve injury.
In line with these findings, we also did not observe any improvement or worsening of sciatic nerve functioning upon deletion of
ASC,
Nlrp3, or
caspase-1/-11. As such, we could not conclude upon any essential role for the inflammasome during acute nerve injury in the PNS. An earlier study making use of IL-1β/TNF single and double knock-outs did show reduced mechanical allodynia and impaired recovery in a similar model of partial nerve ligation [
35]. At the moment, we cannot reconcile these findings with our data as one would suspect that the caspase-1/-11-deficient mice should have a similar defect as the IL-1β-deficient mice (although caspase-1-independent cleavage mechanisms for IL-1β have been suggested as well [
8]). Still, it should be noted that in the Nadeau paper the defect was especially pronounced in the double IL-1β/TNF knock-out, showing that both cytokines could compensate for each other.
In the CNS, the devastating role of IL-1β in acute neurodegeneration was convincingly demonstrated [
1,
5,
6]. A major difference between acute injury in the CNS and the PNS, however, is the induction of a predominantly M1-polarized versus a predominantly M2-polarized response, respectively [
48]. Whereas the pro-inflammatory M1 responses are typically associated with the induction of cytokines such as TNF and IL-1β, the inflammation-resolving M2 response is rather associated with the presence of anti-inflammatory cytokines [
49]. It has been demonstrated that in macrophages polarization towards the M2 state does not affect their ability to induce pro-IL-1β in response to several triggers. However, ATP no longer leads to the induction of caspase-1 cleavage or mature IL-1β release in M2-polarized macrophages and this despite the presence of a fully intact Nlrp3 inflammasome [
47]. This is very similar to what we observed during sciatic nerve injury and might explain why we do not see any effect of inflammasome loss on sciatic nerve recovery. The authors suggest that the uncoupling of ATP-mediated P2X7 stimulation to caspase-1 activation is part of a major switch to induce resolution of inflammation.
While in humans 22 Nlr family members have been described and in mice up to 34, only for a few of them their in vivo function has been unraveled [
9]. In the peripheral nerve, a very transient expression of Nlrp6 could be noticed upon nerve injury. Nlrp6 has been shown to play critical roles in defense against infection and tumorigenesis and in maintaining intestinal homeostasis and a healthy, equilibrated intestinal microbial flora [
12,
41,
50,
51]. The latter function has been suggested to be controlled by regulating IL-18 levels in an inflammasome-dependent manner [
52]. Nlrp6 regulates the goblet mucus secretion [
53], and self-renewal of the intestinal epithelium and its deficiency leads to aberrant wound healing, promoting colitis-associated colon carcinogenesis [
41]. Recent studies showed that Nlrp6 is a negative regulator of the mitogen-activated kinase (MAPK) and canonical nuclear factor-kappa B (NF-κB) pathways [
12]. Deficiency of Nlrp6 leads to resistance against infection with bacterial pathogens like
Listeria monocytogenes,
Escherichia coli, and
Salmonella typhimurium. Upon infection, the mice show increased monocyte and neutrophil numbers and enhanced levels of cytokines and chemokines. This latter function is non-inflammasome dependent [
12]. Based on its function in tissue repair and wound healing, we decided to look at the role of Nlrp6 in sciatic nerve recovery upon crush injury. In contrast to the
ASC
−/−,
Nlrp3
−/−, and
Casp-1/-11
−/− mice, we did notice strongly decreased nerve function immediately upon nerve injury. The mice therefore recovered more slowly, although from 3 weeks post-surgery on they regained similar nerve function capacity. Confirming the data from [
12], this was associated with enhanced levels of ERK phosphorylation and occurred independently from the inflammasome. Nerve injury is known to cause ERK activation [
54,
55]. This is associated with increased pain sensation [
56,
57] but at the same time also leads to Schwann cell dedifferentiation, which is needed for optimal repair [
55,
58]. As such, the enhanced activation of ERK in the absence of
Nlrp6 could explain the decreased sciatic nerve function immediately upon the surgery, while later on it might actually help and even stimulate nerve recovery.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
EY carried out the experiments and wrote the manuscript, together with SJ. DD, GL, and VDW assisted in the animal surgery and experiments. DD and ML contributed to the interpretation of the results and discussed analyses. VT and SJ designed the methods and experiments. All the authors read and approve the final version of the manuscript.