Skip to main content
Erschienen in: BMC Nephrology 1/2018

Open Access 01.12.2018 | Research article

No evidence for point mutations in the novel renal cystine transporter AGT1/SLC7A13 contributing to the etiology of cystinuria

verfasst von: Kathrin Olschok, Udo Vester, Sven Lahme, Ingo Kurth, Thomas Eggermann

Erschienen in: BMC Nephrology | Ausgabe 1/2018

Abstract

Background

Cystinuria is caused by the defective renal reabsorption of cystine and dibasic amino acids, and results in cystine stone formation. So far, mutations in two genes have been identified as causative. The SLC3A1/rBAT gene encodes the heavy subunit of the heterodimeric rBAT-b0,+AT transporter, whereas the light chain is encoded by the SLC7A9/ b0,+AT gene. In nearly 85% of patients mutations in both genes are detectable, but a significant number of patients currently remains without a molecular diagnosis. Thus, the existence of a further cystinuria gene had been suggested, and the recently identified AGT1/SLC7A13 represents the long-postulated partner of rBAT and third cystinuria candidate gene.

Methods

We screened a cohort of 17 cystinuria patients for SLC7A13 variants which were negative for SLC3A1 and SLC7A9 mutations.

Results

Despite strong evidences for an involvement of SLC7A13 mutations in cystinuria, we could not confirm a relevant role of SLC7A13 for the disease.

Conclusion

With the exclusion of SLC7A13/AGT1 as the third cystinuria gene accounting for the SLC3A1 and SLC7A9 mutation negative cases, it becomes obvious that other genetic factors should be responsible for the cystinuria phenotype in nearly 15% of patients.

Background

Cystinuria (OMIM 220100) is a congenital disorder characterized by the defective renal reabsorption of cystine and other dibasic amino acids in the proximal renal tubule and in the epithelial cells of the gastrointestinal tract (for review: [1]). The resulting hyperexcretion of cystine leads to its precipitation in the distal tubule and formation of cystine stones. In adults cystine stones account for only 1–2% of all nephrolithiasis patients, whereas cystine stones account for 6–8% of pediatric urolithiasis patients [2].
So far, two autosomal genes have been identified to harbor genetic variants causing cystinuria. The SLC3A1/rBAT gene in 2p21 encodes the heavy subunit of the heterodimeric rBAT-b0,+AT transporter, the light chain is encoded by the SLC7A9/ b0,+AT gene in 19q12 [37]. The transporter is localized in the apical membrane of proximal tubules in the kidney and mediates the reabsorption of cystine, arginine, ornithine and lysine. Genomic variants in both genes have been identified in cystinuria patients. Whereas mutations in SLC3A1 are commonly inherited in an autosomal recessive manner, SLC7A9 alterations show a broad variability of inheritance, ranging from autosomal recessive to dominant. In some patients large genomic deletions in 2p21 affecting the SLC3A1 gene and its neighbored PREPL gene can be detected, in that case urolithiasis is associated with hypotonia and further clinical symptoms (Hypotonia-Cystinuria syndrome - HCS, OMIM 606407).
Comprehensive mutation analyses in both genes allow the detection of genetic variants in more than 85% of patients, but a significant number of patients currently remain without a molecular diagnosis. In fact, the lack to detect pathogenic mutations can be explained by the applied methods and their different sensitivities, the influence of the ethnic origin on the distribution of mutations, and the autosomal dominant impact of some mutations in SLC7A9 (and SLC3A1). However, they do not explain that a significant number of patients remains without any detectable mutation.
This observation as well as results of expression studies in the proximal renal tubule for rBAT and b0,+AT indicated that further subunits of the plasma membrane protein rBAT are involved in the renal cystine reabsorption. In particular, the opposing expression of rBAT and b0,+AT with a decline of rBAT expression from S3 towards the S1 segment and vice versa points to the existence of a further factor. With AGT1 as the second partner of rBAT in the S3 segment, the long-postulated partner of rBAT in the S3 segment of the renal proximal tubule cystine transport has recently been identified [8].
Consequently, AGT1/ SLC7A13 has been suggested as a further candidate gene for cystinuria, mutations in this factor might explain the so far unsolved cases of cystinuria in which mutations in SC3A1 and SLC7A9 had been excluded. We here report on the results of our search for pathogenic genetic variants in SLC7A13 in a cohort of 17 patients without disease-causing variations in the known cystinuria genes.

Methods

In total, 103 patients from Germany, Turkey, Greece, Italy and Eastern Europe had been ascertained in precedent studies [915] aiming on the identification of SLC3A1 and SLC7A9 variants or in the course of routine molecular diagnostics of cystinuria because of (recurrent) nephrolithiasis or cystinuria. The study had been approved by the ethical committee of the Medical Faculty at the University Hospital Aachen (RWTH Aachen, EK302–16), Germany.
Analyses for disease-causing variants in SLC3A1 and SLC7A9 comprised Sanger sequencing analysis of their coding regions and the intron-exon boundaries (NM_000341.3, NM_014270.4), and search for whole exon deletions and duplications by multiplex ligation probe-dependent amplification (MLPA; kit P426-A1, mrc Holland, Amsterdam/NL).
The coding exons and the neighboring intron regions of SCL7A13 (NM_138817.2) were analyzed by Sanger sequencing after PCR amplification. Primers are listed in Table 1, PCR as well as sequencing conditions are available on request.
Table 1
Primers used for Sanger sequencing of the coding sequences and exon-intron boundaries of the SLC7A13 gene
Exon
Foward Primer
Reverse Primer
Length of PCR product
1
SLC7A13_1.1F: CTTTGCAGCTACATAGGCAGG
SLC7A13_1.2F: TGGACATCCTTGTTTCTGGGG
SLC7A13_1.1R: TAGGCAGCTTTGGGACAGAG
SLC7A13_1.2R: GGCTGGCATGATCTGATTCAG
471
537
2
SLC7A13_2F: TAAAATCATGCTTGTACCCC
SLC7A13_2R: AACAGTGGTTCTGACTGGTG
330
3
SLC7A13_3F: TCATTAGTATTTCTCTTTTAACAC
SLC7A13_3R: TGTGTTTCACAGTAACTGAG
541
4
SLC7A13_4F: TGCAGGTATCATTCATGGATGTTC
SLC7A13_4R: TGTTTAACCTTGATTTGGAATCTG
367

Results

In 103 cystinuria patients, 83.5% had at least one SLC3A1 or SLC7A9 mutation (Table 2). In 49.5% (n = 51) of patients, two mutations could be observed, either as homozygosity / compound heterozygosity in one of the two genes or as mixed heterozygosity in both genes. In 17.5% (n = 18), one mutation was detected for which a penetrance in heterozygous state can be expected, i.e. the duplication of exons 5 to 9 in SLC3A1 or SLC7A9 mutations. In 16.5% (n = 17), only one mutation in SLC3A1 was identified which would not explain the phenotype, in these cases a second mutation can be expected but is still undetected. In two patients we identified homozygosity / compound heterozygosity for large 2p21 deletions, these patients were molecularly diagnosed as HCS as both SLC3A1 and PREPL were affected.
Table 2
Summary of the mutation detection results for SLC3A1 and SLC7A9 in a cohort of 103 cystinuria patients
 
two mutations
one mutation explaining cystinuriaa
only one mutation
no mutation
SLC3A1
39°
2
17
/
SLC7A9
11
16
/
/
mixed
1
/
/
/
total
51 (49.5%)
18 (17.5%)
17 (16.5%)
17 (16.5%)
aheterozygosity of the duplication of exons 5 to 9 in SLC3A1 and of SLC7A9 mutations without parallel occurrence of a second mutation has been reported to be sufficient to cause cystinuria; °including large HCS deletions
Mutation analysis for the two genes was negative in 16.5% of patients, and these 17 individuals (Table 3) were screened for pathogenic mutations in the coding sequences and the intron-exon boundaries of SLC7A13. However, with the exception of already known apathogenic polymorphisms (rs7814198, rs4419794, rs4621787, rs4546639, rs202114931, rs56993779, rs9656982) we did not detect any pathogenic genetic variant.
Table 3
Overview on the 17 patients screened for SLC7A13 mutations
patient
ethnic origin
age at first stone
age at examination
number of recurrent stones
published in
Cys3
Italian
4 m
12 y
5–10
[9]
Cys4
Italian
1 y
5 y
< 5
[9]
Cys21
Italian
23 y
none
[9]
Cys23
Turkish
NA
30 y
< 5
[10]
Cys43
German
19 y
51 y
> 10
[10]
Cys58
Turkish
6 y
16 y
< 5
[14]
Cys63
German
13 m
3 y
5–10
[14]
Cys89
Russian
25 y
30 y
< 5
[14]
Cys98
German
3.5 y
5 y
< 5
[14]
Cys105
Russian
1.5 y
12 y
5–10
[14]
Cys116
Turkish
1.5 y
11 y
5–10
[12]
Cys128
Turkish
17 y
23 y
> 10
[12]
Cys152
German
NA
NA
NA
[12]
Cys161
Turkish
1 m
1 m
1
[12]
Cys181
Polish
3 y
9 y
> 10
[13]
Cys183
Polish
6 y
6 y
5–10
[13]
M20679
German
NA
52 y
1
Mutations in the SLC3A1 and SLC7A9 genes had been excluded before (see texts). The majority of patients was in included in precedent studies. (NA not assessed; y year, m months)

Discussion

In contrast to the majority of kidney stones which occur sporadically, cystine stone formation and cystinuria have been suggested to be exclusively caused by genomic mutations. This assumption was supported by the identification of mutations in cystinuria patients in the genes coding the two subunits of the renal rBAT-b0,+AT transporter. However, with the exception of populations with founder mutations (e.g. [16]), the detection rate for mutations in the SLC3A1 and SLC7A9 genes never reaches 100%, and genetic variants in both genes account for 80–85% in the cystinuria population. This incomplete detection rate is certainly caused by methodological restrictions as non-coding regions (introns, promotor region) of the genes are commonly not investigated and the applied methods show different sensitivities. Furthermore, the penetrance of some mutations in both genes differs from the classical modes of Mendelian inheritance. In case of SLC3A1, mutations are generally autosomal recessively inherited, but at least the duplication of exons 5 to 9 in this gene has been suggested to function as an autosomal dominant allele [17]. For SLC7A9 the situation is more complex, in this gene mutations can have both recessive as well as dominant effects. Thus, an autosomal dominant inheritance with incomplete penetrance has been suggested for variants in SLC7A9. In summary, the uncertainties to classify mutations in the already known cystinuria genes make the decision on the final detection rate difficult. Furthermore, it can be asked whether the detection of only one mutated allele in SLC3A1 or SLC7A9 is indeed sufficient to explain the cystinuria phenotype, or whether a second genomic variant in the same or another gene is required.
In addition to this unclear situation in patients with only one disease-causing mutation, there remains a considerable ratio of patients without a mutation in both genes. This observation provides strong evidence for the existence of a further factor mutations in which might cause cystinuria, but precedent mutation detection analyses in different candidate genes did not provide evidence for their involvement in the etiology of the disease (e.g. SLC1A5/ ATB(0), SLC7A10/ASC-1) [14, 1821]. The recently described novel cystine transporter SLC7A13/AGT1 in the renal proximal tubule was a promising candidate to harbor pathogenic mutations in cystinuria patients. In particular, the observation that AGT1 serves as the second partner of the rBAT transporter in the S3 segment and its expression is consistent with the inversed expression of the so far known cystine transporter subunits SLC3A1/rBAT and SLC7A9/ b0,+AT [8] strongly points to SLC7A13 as a candidate gene for cystinuria.
Despite these strong evidences, we could not confirm a relevant role of SLC7A13 as a third gene contributing to the pathology of cystinuria. In our cohort which was comprehensively analysed for SLC3A1 and SLC7A9 variants, we could not detect any pathogenic mutation in the coding sequences and intron-exon boundaries of SLC7A13. In fact, we cannot exclude large deletions or duplications affecting whole exons, or variants in the non-coding regions of the gene. However, these types of mutations generally contribute only to a small proportion of the mutation spectrum of inherited diseases.
With the exclusion of SLC7A13/AGT1 as the third cystinuria gene, the question remains unanswered why analysis for the two cystinuria genes SLC3A1 and SLC7A9 succeeds only in up to 85%. In fact, this finding can be explained by ethnic differences in the distribution of mutations, and by methodological limitations. However, the comprehensive analysis for SLC3A1 and SLC7A9 mutations in a large number of studies (for review see: [1, 22]) does not indicate that a considerable number of genomic mutations in SLC3A1 or SLC7A9 has been missed. We therefore postulate that there is another genomic factor causing cystinuria. This factor might either been another so far unknown renal cystine transportert, or a genomic predisposition factor like a frequent polymorphism in one of the already known genes which – in combination with other predisposing elements (other genomic variants, life style) - causes the disease.

Conclusion

With the exclusion of SLC7A13/AGT1 as the third cystinuria gene accounting for the SLC3A1 and SLC7A9 mutation negative cases, it becomes obvious that other genetic factors should be responsible for the cystinuria phenotype in nearly 15% of patients.

Acknowledgements

We thank A. Hesse, K. Hozyas, B. Golabek, and M. Slowik for providing us with patients DNA samples.

Availability of data and materials

are available on request.
All patients agreed in participation on the basis of a written informed consent template which also includes the use of data for publication. Genetic testing is approved by the ethical committee of the University Hospital Aachen (EK302–16).
The dataset(s) supporting the conclusions of this article is(are) included within the article.
not applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Literatur
1.
Zurück zum Zitat Chillarón J, Font-Llitjós M, Fort J, Zorzano A, Goldfarb DS, Nunes V, Palacín M. Pathophysiology and treatment of cystinuria. Nat Rev Nephrol. 2010;6(7):424–34.CrossRef Chillarón J, Font-Llitjós M, Fort J, Zorzano A, Goldfarb DS, Nunes V, Palacín M. Pathophysiology and treatment of cystinuria. Nat Rev Nephrol. 2010;6(7):424–34.CrossRef
2.
Zurück zum Zitat Stapleton FB, McKay CP, Noe HN. Urothiasis in children: the role of hypercalciuria. Pediatr Ann. 1987;16(12):980–92.CrossRef Stapleton FB, McKay CP, Noe HN. Urothiasis in children: the role of hypercalciuria. Pediatr Ann. 1987;16(12):980–92.CrossRef
3.
Zurück zum Zitat Pras E, Raben N, Golomb E, Arber N, Aksentijevich I, Schapiro JM, Harel D, Katz G, Liberman U, Pras M. Mutations in the SLC3A1 transporter gene in cystinuria. Am J Hum Genet. 1995;56:1297–303.PubMedPubMedCentral Pras E, Raben N, Golomb E, Arber N, Aksentijevich I, Schapiro JM, Harel D, Katz G, Liberman U, Pras M. Mutations in the SLC3A1 transporter gene in cystinuria. Am J Hum Genet. 1995;56:1297–303.PubMedPubMedCentral
4.
Zurück zum Zitat Calonge MJ, Gaparini P, Chillaron J, Chillon M, Gallucci M, Rousaud F, Zelante L, Testar X, Dallapiccola B, Di Silverio F, Barcelo P, Estivill X, Zorzano A, Nunes V, Palacin M. Cystinuria caused by mutations in rBAT, a gene involved in the transport of cystine. Nat Genet. 1994;6:420–5.CrossRef Calonge MJ, Gaparini P, Chillaron J, Chillon M, Gallucci M, Rousaud F, Zelante L, Testar X, Dallapiccola B, Di Silverio F, Barcelo P, Estivill X, Zorzano A, Nunes V, Palacin M. Cystinuria caused by mutations in rBAT, a gene involved in the transport of cystine. Nat Genet. 1994;6:420–5.CrossRef
5.
Zurück zum Zitat Bisceglia L, Calonge MJ, Totaro A, Feliubadaló L, Melchionda S, García J, Testar X, Gallucci M, Ponzone A, Zelante L, Zorzano A, Estivill X, Gasparini P, Nunes V, Palacín M. Localization, by linkage analysis, of the cystinuria type III gene to chromosome 19q13. 1 Am J Hum Genet. 1997;60:611–6.PubMed Bisceglia L, Calonge MJ, Totaro A, Feliubadaló L, Melchionda S, García J, Testar X, Gallucci M, Ponzone A, Zelante L, Zorzano A, Estivill X, Gasparini P, Nunes V, Palacín M. Localization, by linkage analysis, of the cystinuria type III gene to chromosome 19q13. 1 Am J Hum Genet. 1997;60:611–6.PubMed
6.
Zurück zum Zitat Wartenfeld R, Golomb E, Katz G, Bale SJ, Goldman B, Pras M, Kastner DL, Pras E. Molecular analysis of cystinuria in Libyan Jews: exclusion of the SLC3A1 gene and mapping of a new locus on 19q. Am J Hum Genet. 1997;60:617–24.PubMedPubMedCentral Wartenfeld R, Golomb E, Katz G, Bale SJ, Goldman B, Pras M, Kastner DL, Pras E. Molecular analysis of cystinuria in Libyan Jews: exclusion of the SLC3A1 gene and mapping of a new locus on 19q. Am J Hum Genet. 1997;60:617–24.PubMedPubMedCentral
7.
Zurück zum Zitat Feliubadaló L, Font M, Purroy J, Rousaud F, Estivill X, Nunes V, Golomb E, Centola M, Aksentijevich I, Kreiss Y, Goldman B, Pras M, Kastner DL, Pras E, Gasparini P, Bisceglia L, Beccia E, Gallucci M, de Sanctis L, Ponzone A, Rizzoni GF, Zelante L, Bassi MT, George AL Jr, Manzoni M, De Grandi A, Riboni M, Endsley JK, Ballabio A, Borsani G, Reig N, Fernández E, Estévez R, Pineda M, Torrents D, Camps M, Lloberas J, Zorzano A, Palacín M. International Cystinuria consortium. Non-type I cystinuria caused by mutations in SLC7A9, encoding a subunit (Bo,+AT) of rBAT. Nat Genet. 1999;23:52–7.CrossRef Feliubadaló L, Font M, Purroy J, Rousaud F, Estivill X, Nunes V, Golomb E, Centola M, Aksentijevich I, Kreiss Y, Goldman B, Pras M, Kastner DL, Pras E, Gasparini P, Bisceglia L, Beccia E, Gallucci M, de Sanctis L, Ponzone A, Rizzoni GF, Zelante L, Bassi MT, George AL Jr, Manzoni M, De Grandi A, Riboni M, Endsley JK, Ballabio A, Borsani G, Reig N, Fernández E, Estévez R, Pineda M, Torrents D, Camps M, Lloberas J, Zorzano A, Palacín M. International Cystinuria consortium. Non-type I cystinuria caused by mutations in SLC7A9, encoding a subunit (Bo,+AT) of rBAT. Nat Genet. 1999;23:52–7.CrossRef
8.
Zurück zum Zitat Nagamori S, Wiriyasermkul P, Guarch ME, Okuyama H, Nakagomi S, Tadagaki K, Nishinaka Y, Bodoy S, Takafuji K, Okuda S, Kurokawa J, Ohgaki R, Nunes V, Palacín M, Kanai Y. Novel cystine transporter in renal proximal tubule identified as a missing partner of cystinuria-related plasma membrane protein rBAT/SLC3A1. Proc Natl Acad Sci U S A. 2016;113(3):775–80.CrossRef Nagamori S, Wiriyasermkul P, Guarch ME, Okuyama H, Nakagomi S, Tadagaki K, Nishinaka Y, Bodoy S, Takafuji K, Okuda S, Kurokawa J, Ohgaki R, Nunes V, Palacín M, Kanai Y. Novel cystine transporter in renal proximal tubule identified as a missing partner of cystinuria-related plasma membrane protein rBAT/SLC3A1. Proc Natl Acad Sci U S A. 2016;113(3):775–80.CrossRef
9.
Zurück zum Zitat Albers A, Lahme S, Wagner C, Kaiser P, Zerres K, Capasso G, Pica A, Palacin M, Lang F, Bichler KH, Eggermann T. Mutations in the SLC3A1 gene in cystinuric patients: frequencies and identification of a novel mutation. Genet Test. 1999;3(2):227–31.CrossRef Albers A, Lahme S, Wagner C, Kaiser P, Zerres K, Capasso G, Pica A, Palacin M, Lang F, Bichler KH, Eggermann T. Mutations in the SLC3A1 gene in cystinuric patients: frequencies and identification of a novel mutation. Genet Test. 1999;3(2):227–31.CrossRef
10.
Zurück zum Zitat Schmidt C, Albers A, Tomiuk J, Eggermann K, Wagner C, Capasso G, Lahme S, Hesse A, Lang F, Zerres K, Eggermann T. Analysis of the genes SLC7A9 and SLC3A1 in unclassified cystinurics: mutation detection rates and association between variants in SLC7A9 and the disease. Clin Nephrol. 2002;57(5):342–8.CrossRef Schmidt C, Albers A, Tomiuk J, Eggermann K, Wagner C, Capasso G, Lahme S, Hesse A, Lang F, Zerres K, Eggermann T. Analysis of the genes SLC7A9 and SLC3A1 in unclassified cystinurics: mutation detection rates and association between variants in SLC7A9 and the disease. Clin Nephrol. 2002;57(5):342–8.CrossRef
11.
Zurück zum Zitat Schmidt C, Vester U, Wagner CA, Lahme S, Hesse A, Hoyer P, Lang F, Zerres K, Eggermann T, al e. Significant contribution of genomic rearrangements in SLC3A1 and SLC7A9 to the etiology of cystinuria. Kidney Int. 2003;64(5):1564–72.CrossRef Schmidt C, Vester U, Wagner CA, Lahme S, Hesse A, Hoyer P, Lang F, Zerres K, Eggermann T, al e. Significant contribution of genomic rearrangements in SLC3A1 and SLC7A9 to the etiology of cystinuria. Kidney Int. 2003;64(5):1564–72.CrossRef
12.
Zurück zum Zitat Schmidt C, Vester U, Hesse A, Lahme S, Lang F, Zerres K, Eggermann T, al e. The population-specific distribution and frequencies of genomic variants in the SLC3A1 and SLC7A9 genes and their application in molecular genetic testing of cystinuria. Urol Res. 2004;32(2):75–8.CrossRef Schmidt C, Vester U, Hesse A, Lahme S, Lang F, Zerres K, Eggermann T, al e. The population-specific distribution and frequencies of genomic variants in the SLC3A1 and SLC7A9 genes and their application in molecular genetic testing of cystinuria. Urol Res. 2004;32(2):75–8.CrossRef
13.
Zurück zum Zitat Brauers E, Hozyasz K, Golabek B, Slowik M, Schmidt C, Vester U, Zerres K, Eggermann T. Identification of novel cystinuria mutations in pediatric patients. J Ped Urol. 2006;2:575–8.CrossRef Brauers E, Hozyasz K, Golabek B, Slowik M, Schmidt C, Vester U, Zerres K, Eggermann T. Identification of novel cystinuria mutations in pediatric patients. J Ped Urol. 2006;2:575–8.CrossRef
14.
Zurück zum Zitat Brauers E, Vester U, Zerres K, Eggermann T. Search for mutations in SLC1A5 (19q13) in cystinuria patients. J Inherit Metab Dis. 2005;28(6):1169–71.CrossRef Brauers E, Vester U, Zerres K, Eggermann T. Search for mutations in SLC1A5 (19q13) in cystinuria patients. J Inherit Metab Dis. 2005;28(6):1169–71.CrossRef
15.
Zurück zum Zitat Botzenhart E, Vester U, Schmidt C, Hesse A, Halber M, Wagner C, Lang F, Hoyer P, Zerres K, Eggermann T, al e. Cystinuria in children: distribution and frequencies of mutations in the SLC3A1 and SLC7A9 genes. Kidney Int. 2002;62(4):1136–42.CrossRef Botzenhart E, Vester U, Schmidt C, Hesse A, Halber M, Wagner C, Lang F, Hoyer P, Zerres K, Eggermann T, al e. Cystinuria in children: distribution and frequencies of mutations in the SLC3A1 and SLC7A9 genes. Kidney Int. 2002;62(4):1136–42.CrossRef
16.
Zurück zum Zitat Sidi R, Levy-Nissenbaum E, Kreiss Y, Pras E. Clinical manifestations in Israeli cystinuria patients and molecular assessment of carrier rates in Libyan Jewish controls. Isr Med Assoc J. 2003;5(6):439–42.PubMed Sidi R, Levy-Nissenbaum E, Kreiss Y, Pras E. Clinical manifestations in Israeli cystinuria patients and molecular assessment of carrier rates in Libyan Jewish controls. Isr Med Assoc J. 2003;5(6):439–42.PubMed
17.
Zurück zum Zitat Font-Llitjós M, Jiménez-Vidal M, Bisceglia L, Di Perna M, de Sanctis L, Rousaud F, Zelante L, Palacín M, Nunes V. New insights into cystinuria: 40 new mutations, genotype-phenotype correlation and digenic inheritance causing partial phenotype. J Med Genet. 2005;42(1):58–68.CrossRef Font-Llitjós M, Jiménez-Vidal M, Bisceglia L, Di Perna M, de Sanctis L, Rousaud F, Zelante L, Palacín M, Nunes V. New insights into cystinuria: 40 new mutations, genotype-phenotype correlation and digenic inheritance causing partial phenotype. J Med Genet. 2005;42(1):58–68.CrossRef
18.
Zurück zum Zitat Schmidt C, Vester U, Zerres K, Eggermann T. No evidence for a role of SLC7A10 in 19q13 in the etiology of cystinuria. Clin Nephrol. 2004;62(1):71–3.CrossRef Schmidt C, Vester U, Zerres K, Eggermann T. No evidence for a role of SLC7A10 in 19q13 in the etiology of cystinuria. Clin Nephrol. 2004;62(1):71–3.CrossRef
19.
Zurück zum Zitat Chatzikyriakidou A, Sofikitis N, Georgiou I. Identification of novel cystinuria mutations and polymorphisms in SLC3A1 and SLC7A9 genes: absence of SLC7A10 gene mutations in cystinuric patients. Genet Test. 2005;9(3):175–84.CrossRef Chatzikyriakidou A, Sofikitis N, Georgiou I. Identification of novel cystinuria mutations and polymorphisms in SLC3A1 and SLC7A9 genes: absence of SLC7A10 gene mutations in cystinuric patients. Genet Test. 2005;9(3):175–84.CrossRef
20.
Zurück zum Zitat Leclerc D, Wu Q, Ellis JR, Goodyer P, Rozen R. Is the SLC7A10 gene on chromosome 19 a candidate locus for cystinuria? Mol Genet Metab. 2001;73(4):333–9.CrossRef Leclerc D, Wu Q, Ellis JR, Goodyer P, Rozen R. Is the SLC7A10 gene on chromosome 19 a candidate locus for cystinuria? Mol Genet Metab. 2001;73(4):333–9.CrossRef
21.
Zurück zum Zitat Pineda M, Font M, Bassi MT, Manzoni M, Borsani G, Marigo V, Fernández E, Río RM, Purroy J, Zorzano A, Nunes V, Palacín M. The amino acid transporter asc-1 is not involved in cystinuria. Kidney Int. 2004;66(4):1453–64.CrossRef Pineda M, Font M, Bassi MT, Manzoni M, Borsani G, Marigo V, Fernández E, Río RM, Purroy J, Zorzano A, Nunes V, Palacín M. The amino acid transporter asc-1 is not involved in cystinuria. Kidney Int. 2004;66(4):1453–64.CrossRef
22.
Zurück zum Zitat Eggermann T, Venghaus A, Zerres K. Cystinuria: an inborn cause of urolithiasis. Orphanet J Rare Dis. 2012;7:19.CrossRef Eggermann T, Venghaus A, Zerres K. Cystinuria: an inborn cause of urolithiasis. Orphanet J Rare Dis. 2012;7:19.CrossRef
Metadaten
Titel
No evidence for point mutations in the novel renal cystine transporter AGT1/SLC7A13 contributing to the etiology of cystinuria
verfasst von
Kathrin Olschok
Udo Vester
Sven Lahme
Ingo Kurth
Thomas Eggermann
Publikationsdatum
01.12.2018
Verlag
BioMed Central
Erschienen in
BMC Nephrology / Ausgabe 1/2018
Elektronische ISSN: 1471-2369
DOI
https://doi.org/10.1186/s12882-018-1080-5

Weitere Artikel der Ausgabe 1/2018

BMC Nephrology 1/2018 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Notfall-TEP der Hüfte ist auch bei 90-Jährigen machbar

26.04.2024 Hüft-TEP Nachrichten

Ob bei einer Notfalloperation nach Schenkelhalsfraktur eine Hemiarthroplastik oder eine totale Endoprothese (TEP) eingebaut wird, sollte nicht allein vom Alter der Patientinnen und Patienten abhängen. Auch über 90-Jährige können von der TEP profitieren.

Niedriger diastolischer Blutdruck erhöht Risiko für schwere kardiovaskuläre Komplikationen

25.04.2024 Hypotonie Nachrichten

Wenn unter einer medikamentösen Hochdrucktherapie der diastolische Blutdruck in den Keller geht, steigt das Risiko für schwere kardiovaskuläre Ereignisse: Darauf deutet eine Sekundäranalyse der SPRINT-Studie hin.

Bei schweren Reaktionen auf Insektenstiche empfiehlt sich eine spezifische Immuntherapie

Insektenstiche sind bei Erwachsenen die häufigsten Auslöser einer Anaphylaxie. Einen wirksamen Schutz vor schweren anaphylaktischen Reaktionen bietet die allergenspezifische Immuntherapie. Jedoch kommt sie noch viel zu selten zum Einsatz.

Therapiestart mit Blutdrucksenkern erhöht Frakturrisiko

25.04.2024 Hypertonie Nachrichten

Beginnen ältere Männer im Pflegeheim eine Antihypertensiva-Therapie, dann ist die Frakturrate in den folgenden 30 Tagen mehr als verdoppelt. Besonders häufig stürzen Demenzkranke und Männer, die erstmals Blutdrucksenker nehmen. Dafür spricht eine Analyse unter US-Veteranen.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.