Background
Ovarian cancer ranks 7th among cancers in women and 8th cause of cancer death [
1]. The progression of ovarian cancer requires the co-evolution of neoplastic cells as well as the adjacent microenvironment [
2]. It was reported that the main challenge of ovarian cancer treatment was that most patients have advanced disease at the time of diagnosis [
3]. Angiogenesis is a complicated process which greatly affects growth, tissue and organ regeneration, and many pathological conditions [
4]. Currently, it is reported that angiogenesis is a multi-step process which needs highly modulated endothelial cell behavior [
5]. Angiogenesis was reported to be a crucial marker for ovarian cancer development [
6]. Thus, it is urgent to develop new strategy for diagnosing ovarian cancer.
MicroRNAs (miRNAs) are a variety of RNAs that could regulate the translation and stability of mRNAs influencing cell differentiation, migration and apoptosis [
7]. Besides, miRNAs influence various physiological states [
8]. It has been verified that miRNAs are differentially expressed in ovarian cancer and exert functions as both diagnostic and prognostic targets for ovarian cancer treatment [
9]. For example, the relationship between paclitaxel sensitivity and miR-367/miR-30a-5p expression was used as novel therapeutic targets for ovarian cancer treatment [
10].
The lysophosphatidic acid (LPA) is a crucial signaling molecule due to its widespread presence in biological fluids and its relation to disease conditions including fibrosis and cancer [
11]. LPA is an important component of biofilm, an extracellular signal transmitter and intracellular second messenger, it can target endothelial differentiation gene (Edg) family LPA receptors (LPA1, LPA2, and LPA3) and non-Edg family LPA receptors (LPA4, LPA5, and LPA6) to mediate physiological and pathological processes such as angiogenesis, tumor progression, and inflammatory reactions [
12]. The expression of LPA2 or LPA3 contributes to the aggressiveness of ovarian cancer, suggesting that targeting the production and action of LPA may be potential to treat ovarian cancer [
13]. Further, inhibition of LPA1 has effects on metastasis and metastatic dormancy in breast cancer [
14]. It was also suggested that LPA has a variety of biological activities involved in tumor initiation and progression, such as improved cell survival and angiogenesis [
15]. Moreover, the key roles of LPA4 and LPA6 in developing angiogenesis were also addressed before [
16]. Therefore, our study aims to verify our assumption whether miR-367 targeted LPA1 to affect ovarian cancer progression, so as to provide a potential approach to ovarian cancer treatment.
Materials and methods
Ethics statement
The experiment was authorized by the Ethics Committee of the Affiliated Suzhou Science & Technology Town Hospital of Nanjing Medical University and conducted in compliance with the Declaration of Helsinki. All individuals signed informed written consent documents. The experiments involving animals were performed complying with the Guide for the Care and Use of Laboratory Animals. Animal experiments were conducted according to the animal experiment system ethics guidelines approved by the Animal Management Committee of the Affiliated Suzhou Science & Technology Town Hospital of Nanjing Medical University.
Microarray-based analysis
The miRNA expression microarray dataset GSE48485 and mRNA expression microarray data GSE66957 related to ovarian cancer were obtained from the Gene Expression Omnibus (GEO) database (
https://www.ncbi.nlm.nih.gov/), including 5 cancer tissues and 5 adjacent normal tissues in GSE48485 dataset and 57 cancer tissues and 12 adjacent normal tissues in GSE66957 dataset. The threshold of |log Foldchange| > 1,
p value < 0.05 was set to screen differentially expressed genes. Target mRNAs for significantly differential miRNAs, and the binding site map of miRNA and target gene were predicted by the StarBase database (
http://starbase.sysu.edu.cn/index.php). The expression level of the predicted gene was obtained by performing the differential analysis on GSE66957 dataset.
Clinical sample collection
We recruited 48 pairs of ovarian cancer and adjacent normal tissues (non-cancerous tissues verified by pathological examination) collected from ovarian cancer patients (aged 35–65 with a mean age of 48.83 ± 9.53 years old) underwent surgeries at Huzhou central Hospital from January 2014 to January 2016. Among these ovarian cancer patients, 18 were in stage I, 13 were in stage II, and 17 were in stage III [
17]. According to histopathological grading criteria, high- and medium-(G1 + G2) (n = 28) and poor-differentiation (G3) (n = 20) of tumor were classified. Besides, cases of tumor diameter < 2 cm (n = 25) and ≥ 2 cm (n = 23) were assessed. Patients with other malignant tumors, severe infections, cognitive impairment, poor compliance or inability to understand the research process were excluded. The collected sample tissues were mainly divided into two parts. One part of the tissues was stored in a liquid nitrogen immediately for RNA and protein extraction. Another part of the tissues was fixed with paraformaldehyde and embedded in paraffin for subsequent experiments. The patients were followed up for 6–36 months with outpatient review and telephone follow-up, which was ended by June 2019. A total of 48 patients were followed up.
Cell culture
Human ovarian cancer cell line A2780, CP70, SKOV3, and normal ovarian epithelial cell line IOSE80 were purchased from Beijing Beina Science and Technology Co., Ltd. (Beijing, China). (
http://www.bncc.org.cn/default.htm). A2780, CP70, and IOSE80 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM)-H (Gibco; Thermo Fisher Scientific, USA) with 10% fetal bovine serum (FBS; Gibco). SKOV3 cells were cultured in RPMI-1640 medium (Gibco) with 10% FBS. All medium contained 100 U/mL penicillin, and all cell lines were cultured at 37 °C in 5% CO
2 and then subcultured. The human umbilical vein endothelial cells (HUVECs) were from ATCC (ATCC
® CRL-1730).
Cell transfection
Cells were seeded into a 24-well plate (2.5 × 105 cells/well) and transfected after the density reached at 60–70%. Ovarian cancer cells were grouped as mimic NC, miR-367 mimic, inhibitor NC, miR-367 inhibitor, si-NC, siRNA targeting LPA1 (si-LPA1) (si-LPA1-1: GGAGGAUGUCUGAGAGAAAGA; si-LPA1-2: CCAUGUUGUUAACUAUUUAGG; si-LPA1-3: CGAUCUGAUCAGCAAACAAGA), and si-LPA1 + miR-367 mimic groups. miR-367 mimic, miR-367 inhibitor, and si-LPA1 were purchased from Ribobio (Guangzhou, China). Cells were transfected following the instructions of Lipofectamine™ (Invitrogen, Carlsbad, USA).
RT-qPCR
Total RNA was extracted using Trizol (15596026, Invitrogen), and then reversely transcribed into complementary DNA (cDNA) by PrimeScript RT reagent Kit (RR047A, Takara, Tokyo, Japan). For each sample, 1000 ng RNA was reversely transcribed into 20 μL cDNA, and 2 μL cDNA was used for subsequent PCR operation. Primers for miR-367, LPA1, MCM2, MMP2, MMP9, VEGF, U6, and GADPH were designed and synthesized by Shanghai Sangon Biotech (Shanghai, China) (Table
1). The reaction solution was taken for real-time fluorescence quantitative PCR operation by ABI 7500 real time quantitative PCR instrument (7500, ABI, Perkin-Elmer, Applied Biosystems, Foster City, CA, USA). The 2
−△△Ct method was used to calculate the expression levels of miR-367, LPA1, MCM2, MMP2, MMP9, and VEGF in cells.
Table 1
Primer sequences for RT-qPCR
miR-367 | ACTGCAAGAAACGGTTTTCCC | GGCGCGGAACACTGAGATGT |
LPA1 | ATCTTTGGCTATGTTCGCCA | TTGCTGTGAACTCCAGCCA |
MCM2 | CACATCGAGTCCATGATCC | CAAAAGTCTTGCGCATGCT |
MMP2 | TTTGCTCGGGCCTTAAAAGTAT | CCATCAAACGGGTATCCATCTC |
MMP9 | CGGACCCGAAGCGGACAT | GGGGCACCATTTGAGTTT |
VEGF | CATGAACTTTCTGCTGTCTTGG | CCTGGTGAGAGATCTGGTTCC |
GADPH | ACCACAGTCCATGCCATCAC | TTACCACCCTGTTGCTGTA |
U6 | GCTTCGGCAGCACATATACTAAAA | CGCTTCACGAATTTGCGTGTCAT |
Immunoblotting
Total protein was harvested using an assay kit (Beyotime Biotechnology, Shanghai, China). Bio-Rad DC Protein Assay Kit (Guangzhou Ewell Bio-technology Co., Ltd., Guangdong, China) was used for protein quantification. Each sample was added with sodium dodecyl sulfate (SDS) loading buffer, boiled for 10 min in boiling water, and 20 μg protein sample was applied to a 10% SDS-polyacrylamide gel. Then the protein was transferred onto polyvinylidene fluoride membrane and immersed in 1 × Tris-Buffered Saline Tween-20 (TBST) containing 5% skimmed milk powder to block non-specific binding sites. The membrane was then incubated overnight at 4 °C with diluted primary antibody, i.e. one of the rabbit antibodies LPA1 (R&D system, Minneapolis, MN, USA, AF9963, 1:2000), MCM2 (R&D system, AF5778, 1:2000), MMP2 (R&D system, AF902, 1:2000), MMP9 (R&D system, AF909, 1:2000), VEGF (R&D system, AF-493-NA, 1:2000), and GAPDH (R&D system, AF5718, 1:2000). Then the membrane was incubated with secondary goat anti-rabbit anti-immunoglobulin G (IgG) (R&D system, AB-105-C, 1:20,000). Exposure was carried out with an enhanced chemiluminescence. Gray value of each protein was determined by Image J software (NIH free software, Bethesda, MD, USA). The original immunoblotting bands are shown in Additional file
1.
5-ethynyl-2′-deoxyuridine (EdU) assay
A2780 cell proliferation experiments were performed using the EdU assay kit (CA1170, Beijing Solarbio Science & Technology Co., Ltd., Beijing, China). Cells were seeded in 96-well plates with 1 × 104 cells/well. Then 100 μL of 50 μM EdU medium was added to each well. The cells were fixed with 40 g/mL paraformaldehyde for 20 min, incubated with 2 mg/mL glycine for 10 min, and washed twice by phosphate-buffered saline (PBS). Each well was added with 100 μL of penetrant (0.5% Triton X-100 in PBS) (T8200, Beijing Solarbio Science & Technology Co., Ltd.), shaken on a bleaching shaker for 10 min, and then added with 100 μL of Apollo staining solution for incubation for 30 min in the dark. Next, cells were added with Hoechst33342 reaction solution to incubate at room temperature for 30 min, washed twice with 0.5% Triton X, and observed under an inverted fluorescence microscope. Image-pro plus (IPP) 6.0 professional image analysis software (VersionX, Media Cybernetics, Silver Springs, MD, USA) was used to count the number of cells.
Transwell assay
3 × 104 A2780 cells were added in the apical chamber with 200 μL of serum-free medium, and 500 μL of fresh medium containing 10% FBS was supplemented in the basolateral chamber. The insert was coated with 200 mg/mL Matrigel and the cells were incubated for 24 h for invasion assay. After 48 h, the cells invaded in basolateral chamber were stained with 0.1% crystal violet. Images of invaded A2780 cells were observed and collected by a phase contrast microscope.
Dual luciferase reporter gene assay
Bioinformatics website was used to predict binding site of miR-367 and LPA1 and to obtain fragment sequences containing the site of action. The 3′ UTR region of LPA1 was cloned and amplified into a pmirGLO (E1330, Promega, Madison, WI, USA) luciferase vector and named as pWt-LPA (CUUGGUAGCCACACCUGCAAUG). The pMut-LPA vector (CUUGGUAGCCACACCGACGUCG) was also constructed. Then the pRL-TK vector expressing Renilla luciferase (E2241, Promega, Madison, WI, USA), mimic NC, and miR-367 mimic were co-transfected with luciferase reporter vectors pWt-LPA and pMut-LPA respectively into ovarian cancer cell line A2780. The luminescence intensity was monitored by the Dual Luciferase Reporter Gene Assay Kit (GM-040502A, Qiancheng Bio, shanghai, China) at 560 nm (firefly relative luciferase units (RLU)) and 482 nm (renilla RLU), and the firefly RLU/renilla RLU ratio was measured to determine the binding.
RNA immunoprecipitation (RIP)
Bindings of miR-367 and LPA1 to Ago2 protein were assessed according to Magna RIP RNA-binding protein immunoprecipitation kit (Merck Millipore, Billerica, USA). Cells were washed with pre-cooled PBS and the supernatant was discarded. The cells were lysed with an equal volume of RIPA lysate for 5 min in ice bath, centrifuged at 14,000 rpm for 10 min at 4 °C, followed by the removal of supernatant. A part of the cell extract was taken out as an input, and the rest was incubated with the antibody for coprecipitation. Specifically, 50 μL of magnetic beads for each coprecipitation reaction system was washed and resuspended in 100 μL of RIP wash buffer, and 5 μg of antibody was added for combination. The magnetic bead-antibody complex was washed and resuspended in 900 μL of RIP wash buffer, and 100 μL of cell extract was added. Next, the mixture was incubated, and the sample was placed on the magnetic base to collect the magnetic bead-protein complex. The sample and input were separately treated by proteinase K to extract RNA for subsequent PCR detection. IgG was used as NC.
Tube formation assay was conducted on HUVECs under the treatment of different ovarian cancer cell culture medium. HUVECs were cultured in DMEM medium containing 10% FBS. Ovarian cancer cells A2780 were cultured in DMEM-H with 10% FBS medium at 37 °C. The ovarian cancer cells were transfected, and the culture medium was collected 48 h later. Tumor conditioned medium was prepared by tumor supernatant: DMEM medium: FBS at a ratio of 4:5:1. A total of 50 μL Matrigel glue was added to each well of a 96-well plate and gelled at 37 °C for 30 min. Then cells were added with prepared tumor conditioned medium and HUVECs suspension and cultured. The operation was replicated three times in each group, with 4 fields of view taken for the observation under a phase contrast microscope. The number of small tubes was counted and photographed.
Chick chorioallantois membrane (CAM) assay
Seventy healthy chicken embryos were randomly injected with miR-367 mimic, miR-367 inhibitor, si-LPA1, miR-367 inhibitor and si-LPA1 or their negative control (mimic NC, inhibitor NC, and si-NC). 1 × 107 A2780 cells in the exponential growth phase was inoculated on the 10 days well-developed fertilized CAM using chicken fenestration. After inoculation, the chicken embryos were incubated for 5 days. The number of CAM vessels (number, N), area of blood vessel (area, A), ratio of blood vessel area (VA/A), tissue surface, and tissue area (tissue, T) of each group were detected by image analysis, and blood vessel and tissue changes were observed.
Xenografts in nude mouse
Twenty female BALB/C nude mice were obtained from Guangdong Medical Laboratory Animal Center (Guangdong, China). Mice were injected with cells transfected with si-NC and si-LPA1 (constructed by Shanghai Sangon Biotech) respectively (10 in each group). The above stably transfected cells were subcutaneously injected into the armpits of female BALB/C nude mice (4–6 weeks old, 18–22 g) (1 × 107 cells/each mouse). Tumor growth was monitored every 3 days by measuring the width (W) and length (L) with a caliper, and the volume of the tumor (V) was calculated using the formula V = (W2 × L)/2. Four weeks after the injection, the mice were euthanized and the tumor weight was measured.
Immunohistochemistry
Specimens were fixed with 10% formaldehyde and embedded in paraffin. Then 4 μm serial section was cut. Tissue sections were placed in a 60 °C incubator for 1 h, dewaxed by xylene, dehydrated with gradient alcohol, and incubated in 3% H2O2 (Sigma-Aldrich, St. Louis, MO, USA). Then tissue sections were washed with PBS, placed in 0.01 M citrate buffer, boiled at 95 °C for 20 min, cooled to room temperature, rinsed with PBS, and blocked with normal goat serum working solution with 37 °C for 10 min. Tissue sections were incubated with anti-rabbit CD34 (R&D system, AF4117, 1:100) and LPA1 (R&D system, AF9963, 1:100) at 4 °C for 12 h. After washing with PBS, the corresponding biotin-labeled secondary antibody IgG goat anti-rabbit (R&D system, AB-105-C, 1:20,000) was added and kept for 10 min. Next, horseradish peroxidase-labeled streptavidin working solution (S-A/HRP) was added and kept for 10 min. Tissue sections were developed with diaminobenzidine (DAB) and stored in the dark for 8 min. Then cells were washed with tap water, stained with hematoxylin, dehydrated, transparentized, blocked, and observed by light microscopy. Positive cell counts were performed using Japanese Nikon image analysis software, and three equal-area non-repetitive fields (× 200) were selected for each slice to calculate the number of positive cells. ABCF2 (positive staining is greater than 25% of cells) and brown or brownish yellow particles appear in the cytoplasm were regarded as the criteria for immunohistochemistry. Positive expression rate = number of positive cases/total number of cases.
Statistical analysis
Data statistical analyses were processed using Statistic Package for Social Science (SPSS) 21.0 software (IBM Corp. Armonk, NY, USA). Measurement data were presented as mean ± standard deviation. Paired data between two groups were compared using paired t test, while unpaired data were analyzed using unpaired t-test. Comparisons among multiple groups were conducted by one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test. Chi-square test was used to analyze the number of high and low expression cases. Patients’ survival rate was analyzed using the Kaplan–Meier method, while the difference of miR-367 expression was assessed by logrank test. The correlation between miR-367 and LPA1 was evaluated by Pearson’ correlation coefficient. The xenograft tumors in nude mice at different time points were observed and analyzed by repeated measures ANOVA. Differences were considered statistically significant when p < 0.05.
Discussion
Plasma miRNAs serve as biomarkers for ovarian cancer prognosis and diagnosis [
20]. It is reported that though many hurdles need to be overcome, miRNA therapy might work as a powerful treatment method to prevent and cure ovarian cancer [
21]. For example, overexpression of miR-155 could prevent tumorigenesis in human ovarian cancer by downregulating CLDN1 [
22]. We aimed to investigate the mechanism by which miR-367 involved in ovarian cancer development. Collectively, the data of this study revealed that miR-367 suppressed the development of ovarian cancer by downregulating the expression of LPA1.
The first finding of this study was that miR-367 was poorly-expressed in ovarian cancer cells, and overexpression miR-367 inhibited proliferation, invasion, and angiogenesis of ovarian cancer cells. Firstly, MCM2 positive cells represents the proliferating breast cancer cells [
23]. Another study also reported that the high expression of MCM2 in serrated polyps showed abnormal cell proliferation [
24]. Moreover, MMP2 and MMP9, as proteolytic enzymes, are involved in the degradation of extracellular matrices, which play a crucial role in tumor invasion and metastasis [
25]. In addition, MMPs such as MMP2 and MMP9 could be prognostic biomarkers for ovarian cancer [
26]. It is also revealed that the VEGF receptor endocytosis regulates vessel growth in angiogenesis [
27]. Our results showed that miR-367 inhibited the expression of MCM2, MMP2, MMP9, and VEGF, suggesting that miR-367 may repress tumor cell proliferation, migration, invasion, and angiogenesis in ovarian cancer.
We further found that LPA1 was highly expressed in ovarian cancer tissues and cells, and low expression of LPA1 reduced tumorigenic and angiogenic ability of ovarian cancer cells. LPA was reported to regulate pathological processes such as embryonic development, angiogenesis, and tumor progression [
12]. Besides, LPA is an autocrine growth signal, which is significant for the occurrence of ovarian cancer [
28] influencing the pathology of human ovarian cancer [
29]. Our experiments demonstrated that LPA1 promoted angiogenesis and the ovarian cancer development.
Subsequently, we found that miR-367 targeted LPA1 expression and overexpression of miR-367 downregulated LPA1 expression to repress proliferation, invasion, and angiogenesis of ovarian cancer cells, thereby inhibiting ovarian cancer progression. Consistent with our work, previous studies also presented the targeting relation between miRNAs and other genes in ovarian cancer. For example, miR-17 suppresses peritoneal metastasis in ovarian cancer through ITGA5 and ITGB1 [
30]. Similarly, miR-320 repressed oncogenicity of ovarian cancer by targeting TWIST1 expression [
31]. However, to our best knowledge, this is the first report that revealed the targeting relationship between miR-367 and LPA1 and the mechanism in ovarian cancer.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.