Background
Aberrant expression of microRNAs (miRs), which are small non-coding RNA molecules consisting of approximately 22 nucleotides, has been identified in human cancer, where the miRNA signature is associated with specific clinical and biological features [
1]. The microRNAs related to cancers may act as tumor suppressors or oncogenes, depending on the cancer type [
2,
3]. The miR-200 family member genes are clustered at two locations in the genome: the miR-200b/200a/429 cluster and the miR-141/200c cluster [
4]. The miR-200 family members repress the epithelial-to-mesenchymal transition (EMT), cancer cell migration, tumor growth, and metastasis by directly targeting specific genes, such as ZEB1, Suz12, moesin, and AP-2γ [
4,
5]. In contrast, the miR-200 family members have been shown to enhance the migration ability of breast cancer cells and to promote the metastatic colonization of breast cancer cells through up-regulating the expression of E-cadherin and down-regulating that of ZEB2 and Sec23a [
6,
7]. In a recent study, high expression of the miR-200 family was associated with a high probability of relapse, poor survival, and distant metastasis in breast cancer patients [
8]. The loss of miR-200c expression has also been related to the induction of an aggressive, invasive, and chemoresistant phenotype of non–small cell lung cancer [
9]. Conflicting results have been obtained in studies of the role of each miR-200 family member in repressing or enhancing cancer cell migration and invasion as well as the tumor growth and metastasis of diverse cancers, including breast cancer [
10,
11].
Triple-negative breast cancer (TNBC) lacking estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2) expression, is a highly invasive and metastatic form of breast cancer with a generally poorer prognosis than that of other breast cancer subtypes [
12]. It is important to develop new treatment strategies based on a better understanding of the underlying mechanisms regulating the aggressive behavior of TNBCs. TNBCs express the miR-200 family members at a significantly lower level than do other subtypes of breast cancer, such as ER-positive or HER2-positive breast cancer [
13]. Only a small number of the miR-200 target genes that are involved in breast cancer cell migration and metastasis have been identified [
4‐
6], and few studies of the role of the miR-200b/200a/429 or miR-141/200c cluster in human TNBC have been conducted. The biological relevance of the function of the miR-200b/200a/429 or miR-141/200c cluster in human TNBC remains to be discovered.
Synthetic miR-200b directly downregulates vascular endothelial growth factor (VEGF) in endothelial cells and prevents the diabetes-induced increase in VEGF, thus inhibiting angiogenesis in diabetic retinopathy [
14]. Chemokine CCL5 (formerly RANTES) of the CC-chemokine family, which plays a critical role in local invasion and distant metastasis in chondrosarcoma, promotes VEGF expression and angiogenesis by downregulating miR-200b [
15]. The miR-200c radiosensitized the lung cancer cell line, A549 by targeting the VEGF-VEGFR2 pathway [
16]. From these reports, we speculated that the overexpression of the miR-200 family can regulate the expression and secretion of cytokines and growth factors involving in cell growth and migratory and invasive abilities of TNBC cells.
In the present study, we used MDA-MB-231 cells, a typical human TNBC cell line, which were stably transduced with lentivirus carrying miR-200 family. We found that the overexpression of the miR-141/200c cluster promoted stronger migration and invasion as well as higher VEGF-A secretion in MDA-MB-231 cells. Therefore, we investigated, in detail, the mechanisms by which two miR-200 family members, the miR-200b/200a/429 cluster and the miR-141/200c cluster, regulated MDA-MB-231 cell migration and invasion. We demonstrate that the overexpression of the miR-141/200c cluster in MDA-MB-231 cells increased VEGF-A secretion, which enhanced the migratory ability of the cells through the activation of focal adhesion kinase (FAK) and the phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K)/protein kinase B (AKT) signaling pathway.
Methods
Cell culture
The human breast cancer cell lines MCF-7 (ER-positive subtype), MDA-MB-231 and HCC-38 (TN subtype) were obtained from the Korean Cell Line Bank (Seoul, Korea). Hs578T cells (TN subtype) were obtained from ATCC (Manassas, VA, USA). MCF-7 cells were grown in Dulbecco’s Modified Eagle’s Medium (DMEM) (WelGENE, Daegu, Korea) containing 10 % fetal bovine serum (FBS) and supplemented with a 1 % antibiotic solution containing penicillin and streptomycin (Gibco, Auckland, NZ). The MDA-MB-231, HCC-38, and Hs578T cells were grown in Roswell Park Memorial Institute (RPMI) 1640 medium (WelGENE) containing 10 % FBS and supplemented with a 1 % antibiotic solution containing penicillin and streptomycin (Gibco). The MCF-7, MDA-MB-231, HCC-38, and Hs578T cells used in this study were authenticated and validated by DNA fingerprinting (AmplFLSTR identifiler PCR Amplification kit), which was conducted by the Korean Cell Line Bank.
Lentiviral transduction
Viral vectors containing either the miR-200b/200a/429 cluster (GenBank ID: 406984 406983) or the miR-141/200c cluster (GenBank ID: 406985 406933) constructs and the green fluorescent protein (GFP) construct were kindly supplied by Dr. Gregory J. Goodall of the University of Adelaide (Adelaide, Australia). A viral vector (pLenti M1.41) containing GFP was used as a control vector. Lentiviral transduction was conducted according to the manufacturer’s instructions. Briefly, cells were seeded at a density of approximately 10–25 % confluency (1 × 105 cells) in 6-well plates and were maintained at 37 °C with 5 % CO2. Following an overnight culture, the culture medium was removed. Aliquots of the lentiviral stocks containing the miR-200b/200a/429 cluster or the miR-141/200c cluster construct as well as the control virus were gently mixed with 8 μg/ml polybrene and added to each well. After 6 h of transduction, the medium was replaced with fresh complete medium. Transduced cells with a cell density of greater than 90 % confluency were selected using medium containing 3 μg/ml puromycin for 2 weeks. Then, the GFP-positive cells were sorted from the selected cells using a FACSCalibur flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA). Cancer cells stably expressing the miR-200b/200a/429 cluster or the miR-141/200c cluster and GFP, denoted as miR-200ab cells and miR-200c cells, respectively, and cancer cells containing the pLenti M1.41 vector, denoted as control cells, were generated and expanded for use in all subsequent studies.
Quantitative real-time PCR
TaqMan MicroRNA Assays (Applied Biosystems, South San Francisco, CA, USA) were used to quantify the levels of mature miRNAs, following the manufacturer’s instructions. The miRNAs were isolated from cells using the mirVana miRNA isolation kit (Applied Biosystems), and the specific primers for detecting miR-200a, miR-200b, and, miR-200c were purchased from Applied Biosystems. Reverse transcription was performed using the TaqMan microRNA reverse transcription kit (Applied Biosystems) according to the manufacturer’s instructions. The traditional TaqMan Assay control, 18 s rRNA, was used as the endogenous control. Each TaqMan Assay was conducted in triplicate.
Reverse transcriptase polymerase chain reaction (RT-PCR)
The total RNA was isolated using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) and reverse-transcribed using random hexamers and Superscript III reverse transcriptase. The cDNAs were synthesized using M-MLV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) and random primers. The mRNA levels in the miR-200 family-transduced cells and non-transduced cells, referred to as the control, were evaluated using the conventional RT-PCR method with the following primer sets: E-cadherin (421 bp), F, ATTCTGATTCTGCTGCTCTTG and R, AGTAGTCATAGTCCTGGTCTT; Vimentin (247 bp), F, CCCTCACCTGTGAAGTGGAT and R, TCCAGCAGCTTCCTGTAGGT; ZEB1 (150 bp), F, TTCAAACCCATAGTGGTTGCT and R, TGGGAGATACCAAACCAACTG; ZEB2 (127 bp), F, CAAGAGGCGCAAACAAGC and R, GGTTGGCAATACCGTCATCC; Snail (557 bp), F, CAGACCCACTCAGATGTCAA and R, CATAGTTAGTCACACCTCGT; Fibronectin (171 bp), F, CAGAATCCAAGCGGAGAGAG and R, CATCCTCAGGGCTCGAGTAG; and β-actin (335 bp), F, TTCCTGGGCATGGAGTCCTGTGG, and R, CGCCTAGAAGCATTTGCGGTGG. Each target gene was amplified using a Thermocycler (BioRad, Hercules, CA, USA). The PCR products were subjected to electrophoresis through 1.5 % agarose gels, and the levels of gene expression were normalized to that of β-actin.
Cell viability and proliferation assay
In vitro cell viability and proliferation were assessed using the 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay. Briefly, 5 × 103 cells were allowed to adhere in a high-humidity environment in 5 % CO2 at 37 °C in 96-well culture plates. At 1 d, 3 d, and 5 d after cell seeding, the MTT solution (a final concentration of 1 mg/ml) was added, and the cells were incubated for 1 h. At the end of the incubation period, the MTT solution was carefully removed, and 150 μl of dimethyl sulfoxide was added to each well. The plates were maintained on a rocker shaker for 10 min at 25 °C, and then the amount of MTT formazan crystals formed by the viable cells was determined using a spectrophotometer based on the absorbance at 540 nm (GE Healthcare, Piscataway, NJ, USA). Flow cytometry analysis using 7-AAD was performed to confirm cell viability.
Migration and invasion assay
To assess the cell migratory ability, 2–5 × 104 cells were suspended in 100 μl of medium with or without 10 % FBS and deposited in the upper chambers of a trans-well plate with 8.0-μm pores (BD Biosciences) with a non-coated membrane. For the invasion assays, 5 × 104 cells were plated in 2 % Matrigel™ (BD Biosciences) basement membrane matrix-coated upper chambers in a trans-well plate with 8.0-μm pores. The lower chambers were filled with 600 μl of medium supplemented with 10 % FBS, and the cells were incubated for 48 h at 37 °C in the presence or absence of an FAK inhibitor (5 μM PF573228, Sigma, St. Louis, MO, USA), a PI3K/AKT inhibitor (20 μM LY294002, Cell Signaling Technology, Danvers, MA, USA), 5 μg/ml VEGF-neutralizing antibody (Santa Cruz Biotechnology, Dallas, TX, USA) or 10 ng/ml VEGF-A protein (Sigma). Each inhibitor, VEGF-neutralizing antibody, or VEGF-A were added in both the upper and lower chambers. No chemoattractants were used in the lower chamber for either the migration or invasion assays. The cells that migrated from the upper chamber were stained using a crystal violet solution (0.5 % crystal violet in 20 % methanol) for 5 min. Unbound crystal violet was removed by rinsing using distilled water. The cells were subsequently air-dried, and the crystal violet was eluted from the cells using a solution of 1 % sodium dodecyl sulfate (SDS). The absorbance of crystal violet at 550 nm was measured using a spectrophotometer (GE Healthcare).
Wound-healing assay
Cells were seeded at 5 × 104 cells per well in six-well plates and cultured under permissive conditions until reaching 90 % confluence. After 24 h, each confluent cell monolayer was lightly and quickly scratched using a sterile plastic tip to produce a straight line. The debris was removed, and the edge of the scratch was smoothed by washing with PBS. The cells were cultured for 6 h in complete medium, after which, the lateral migratory activity was evaluated based on the area occupied by the cells that had entered the scratch line at 0 h. Images were acquired using a microscope (Leica, Wetzlar, Germany) equipped with a CCD camera (Leica). The migration rates were calculated according to the equation percentage wound healing = {(wound length at 0 h) - (wound length at 6 h)} / (wound length at 0 h) × 100. The mean results of three straight distances (upper edge, middle, and lower edge) in scratch area were evaluated as wound lengths. Length quantification was performed using ImageJ software (NIH, Bethesda, MD, USA).
Measurement of cytokines and growth factors
Samples of 1–2 × 105 cells were seeded in 6-well plates. After a two-day culture period, when cells were at 90 % confluency, the conditioned medium was harvested. The levels of secreted cytokines and growth factor (IL-2, IL-4, IL-5, IL-10, IL-12, IL-13, GM-CSF, IFN--γ, and VEGF-A) were quantified using the Bio-Plex200 multiplex array system according to the recommended protocol (Bio-Rad). All samples and standardized solutions were analyzed in triplicate.
Western blotting
The cells were lysed in RIPA buffer (Sigma). The proteins were separated using SDS-polyacrylamide gel electrophoresis and were transferred to nitrocellulose membranes. The membranes were blocked using 5 % skim milk in Tris-buffered saline containing Tween and incubated with primary antibodies directed against ERK, phospho-ERK, AKT (anti-rabbit polyclonal antibody, Cell Signaling Technology), phospho-AKT (anti-mouse polyclonal antibody, Cell Signaling Technology), FAK (anti-rabbit polyclonal antibody, Invitrogen), phospho-FAK (anti-rabbit polyclonal antibody, Invitrogen), integrin-αV (anti-rabbit polyclonal antibody, Santa Cruz Biotechnology) or β-actin (anti-mouse polyclonal antibody, Sigma) overnight at 4 °C. The membranes were then incubated with horseradish peroxidase-conjugated secondary antibodies (Santa Cruz Biotechnology). The blotted membranes were visualized using enhanced chemiluminescence reagents (GE Healthcare). Western blot quantification was performed using ImageJ software.
Immunofluorescence staining
The cells were seeded on sterile cover slips in 24-well plates. Then, the cells were fixed using a 4 % paraformaldehyde solution (Affymetrix, Cleveland, OH, USA). Primary antibodies directed against integrin-αV (Santa Cruz Biotechnology) and phospho-FAK (Invitrogen) were applied overnight at 4 °C. The bound integrin-αV and phospho-FAK antibodies were visualized using secondary antibodies conjugated to Alexa 594, and the nuclei were counterstained using 4',6-diamidino-2-phenylindole (DAPI). All multicolor fluorescence images were obtained using a confocal laser-scanning microscopy (LSM5 Meta) (Carl Zeiss, Oberkochen, Germany).
Statistical analyses
For the entire dataset obtained in this study, the mean values ± standard deviations were calculated from the results of at least three independent experiments and were statistically evaluated using a one-way ANOVA followed by the t-test. For all tests, p-values of less than 0.05 were considered significant.
Discussion
The role of miR-200 family in regulating the migration and invasion of different cancer cell types is controversial [
10,
11]. Moreover, only a small number of miR-200 target genes that regulate cell migration and cancer metastasis has been identified [
4,
6], and the mechanisms underlying the functions of miR-200b/200a/429 cluster and miR-141/200c cluster in TNBC cells are not fully understood. It is well-known that the miR-200 family expression levels are significantly lower in highly migratory TNBC cells and metastatic TNBC tumors than other types of breast cancer cells and tumors. In addition, Vrba L et al. reported the repression of miR-200 and miR-141 expression due to aberrant epigenetic gene silencing in aggressive cancer cells, including MDA-MB-231 cells, indicating that the downregulation of miR-200 may contribute to an aggressive TNBC phenotype [
17]. ZEB1 and SIP1 have been found to repress primary transcript and mature miR-200 expression in mesenchymal types of breast cancer cells, suggesting a downregulation of miR-200 in TNBC cells through a potential double-negative feedback loop between ZEB1/SIP1 and the miR-200 family [
18]. Manav K et al. reported the highest expression of miR-200s in the highly metastatic 4T1 cells, a mouse TNBC cell line, which was consistent with acquisition of epithelial traits in 4T1 cells compared with the weakly metastatic 4TO7 cells. In addition, 4T1 tumors exhibit spontaneous metastasis and colonization of distant organs, which is enhanced by miR-200 overexpression in experimental animal models, furthermore, higher expression of miR-200 levels were found in lung-pleural metastasis samples relative to primary tumor samples in breast cancer patients. These data support the potential role of miR-200s in migration, invasion, metastatic colonization, and metastatic dissemination [
6]. Recently, Avery-Kiejda KA et al. found that the miR-200 cluster is upregulated in invasive ductal carcinomas with both lymph node-positive and lymph node-negative TNBC compared with matched normal adjacent tissues [
19]. Their reports of in vivo experimental and clinical evidence may indicate that tumor cell populations with increased aggressiveness may have higher miR-200 cluster levels than their less aggressive counterparts within the same TNBC and in normal tissues, the miR-200 cluster, though being generally reduced in TNBC compared with other subtypes, is upregulated in TNBC cells that may support metastatic dissemination. We showed here that the overexpression of miR-200b/200a/429 cluster or miR-141/200c cluster strongly promoted the migration and invasion of MDA-MB-231, HCC-38, and Hs578T cells, typical claudin-low and mesenchymal subtypes of TNBC cell lines [
20], compared with those of an ER-positive breast cancer cell line, MCF-7 cells. The migratory and invasive ability of MDA-MB-231 cells was substantially more enhanced in those that overexpressed the miR-141/200c cluster than in those with the miR-200b/200a/429 cluster. These data suggest that the different roles of the miR-200 family members, such as miR-200a, miR-200b, miR-200c, miR-141, and miR-429, on the migration and invasion of different subtypes of human breast cancer cell lines classified by molecular characterization should be further investigated [
21].
Dysregulation of the PI3K/AKT signaling pathway has been implicated in mammary carcinogenesis and was suggested to be the mechanism underlying the survival of invasive breast cancer cells [
22]. Furthermore, an activated AKT signaling pathway, a common dysregulation observed in breast cancers, has been shown to promote cancer cell growth, survival, and metastasis [
23]. FAK is a cytoplasmic tyrosine kinase that plays crucial roles in integrin-mediated signal transduction, and FAK localizes to the sites where transmembrane integrin receptors are clustered to mediate various intracellular signal-transduction pathways [
5,
24]. Many recent studies have reported that an increased level of FAK expression highly correlates with the invasiveness and metastasis of human tumors [
25‐
27]. We found that the phosphorylation levels of AKT and FAK in MDA-MB-231 cells were elevated by stable overexpression of the miR-200b/200a/429 cluster and the miR-141/200c cluster. Additionally, increased integrin-αV and phosphorylated FAK co-localized in the transmembrane of miR-200b/200a/429 cluster- and miR-141/200c cluster-transduced MDA-MB-231 cells. These data suggest that the stable overexpression of the 200b/200a/429 cluster and the miR-141/200c cluster in MDA-MB-231 cells may affect the secretion of cytokines or growth factors to activate FAK or the PI3K/AKT signaling pathway. The regulation between the miR-200 family and FAK is not fully understood. A model indicating that a stiffer matrix of breast cancers will activate FAK, which inhibits the miR-200 family and allow for a mesenchymal phenotype has been proposed [
28]. This model is not consistent with our observation that the overexpression of the miR-141/200c cluster or the miR-200b/200a/429 cluster increased clustering and expression of integrins and activated FAK and AKT, which regulate cell migration. Our finding proposes a positive cross-talk between FAK and overexpressed miR-200 in TNBC cells.
Many studies have been aimed at understanding the role of cytokines and growth factors in breast cancer progression. Some cytokines and growth factors (IL-1, IL-6, IL-11, TGF-β, and VEGF) stimulate the proliferation and invasion of breast cancer cells, whereas others (IL-12, IL-18, and IFN) suppress breast cancer progression [
29]. A recent study reported that miR-200 inhibits angiogenesis by targeting IL-8 and CXCL1 secreted by tumor endothelial and cancer cells [
30]. Our study demonstrated that the overexpression of the miR-200b/200a/429 cluster or the miR-141/200c cluster in MDA-MB-231 cells led to a decrease in the secretion of IL-2, IL-4, IL-5, IL-10, IL-13, GM-CSF, INF-γ and TNF-α but a significant increase in the secretion of VEGF-A. VEGF has been reported to activate the PI3K/AKT/forkhead signaling pathway to promote angiogenesis in human endothelial cells [
31]. In addition, VEGF-A, the most potent angiogenic factor in tumor angiogenesis, induces oligodendrocyte precursor cell migration through a ROS- and FAK-dependent mechanism [
32]. VEGF-A is known to be a direct target of miR-200b [
33], but in our results, a significant decrease in VEGF-A levels assessed by western blotting was not observed in miR-200b/200a/429- and miR-141/200c-transduced MDA-MB-231 cells or in miR-141/200c-transduced HCC-38 cells relative to control. Moreover, VEGF-A secretions in MDA-MB-231, HCC-38, and Hs578T cells were increased by the overexpression of the miR-141/200c cluster. The comprehensive interactions between miRNAs and transcription factors (TFs) are expected to comprise “wired” genetic networks to regulate the expression of target genes [
34]. In examples of an incoherent feed-forward loop, the direct regulatory effect of TFs on the target gene (VEGF-A) is opposed to the indirect regulatory effect through miR-200 regulation. Taking the comprehensive interactions between miRNAs and protein-coding genes, we propose that miR-200 overexpression in TNBC cells can affect TFs (HIF-1, CREB) or signals (PI3K/AKT) to regulate VEGF-A secretion through an incoherent feed-forward loop. An autocrine loop for VEGF-A to induce breast cancer cell migration/invasion has been well documented [
35,
36]. From these reports, we assume that the VEGF-A secreted by miR-200 overexpression interacts with its receptors, such as neuropilin-1 (NP-1) and VEGFR, and stimulates the PI3K/AKT signaling pathway, thus promoting TNBC cell migration and invasion. In this study, we demonstrated that treatment with VEGF-A led to an increase in migratory ability and activated FAK and the PI3K/AKT signaling pathway in MDA-MB-231 cells and HCC-38 cells. Our results strongly support that VEGF-A-mediated FAK or PI3K/AKT signaling pathway modulates cancer cell migration and invasion. By down-regulating miR-200b expression through the PI3K/AKT signaling pathway, the chemokine CCL5 (formerly RANTES) promotes VEGF-dependent angiogenesis in human chondrosarcomas [
15]. In addition, synthetic miR-200c downregulates VEGF-A by the direct targeting of the 3’UTR of VEGF-A mRNA in a lung cancer cell line [
16]. Contrary to above studies, in this study, the stable overexpression of the miR-200b/200a/429 cluster and the miR-141/200c cluster in MDA-MB-231 cells resulted in increased VEGF-A secretion and induced AKT and FAK phosphorylation. Blocking the PI3K/AKT or FAK signaling pathways using chemical inhibitors inhibited the enhanced migration and invasion in MDA-MB-231 cells overexpressing the miR-200b/200a/429 cluster or the miR-141/200c cluster. Inhibiting the VEGF-A-mediated pathway using anti-VEGF-A-neutralizing antibodies suppressed the elevated AKT and FAK phosphorylation in MDA-MB-231 cells overexpressing miR-141/200c cluster, reversing the enhanced migratory and invasive abilities. These results suggest that the activation of FAK and the PI3K/AKT signaling pathway are directly mediated by elevated VEGF-A secretion, which is involved in the increased migratory and invasive abilities of miR-141/200c cluster-transduced MDA-MB-231 cells. On the other hand, FAK- and PI3K/AKT-independent signaling pathways activated by VEGF-A may lead to an enhanced migratory ability in miR-200b/200a/429 cluster-transduced MDA-MB-231 cells. The present study implies that aberrant expression of miR-200b/200a/429 cluster or the miR-141/200c cluster may play a pro-metastasis role leading to the promotion of migration and invasion of MDA-MB-231 cells.
Acknowledgments
The authors would like to thank Dr. Gregory J. Goodall at the University of Adelaide for providing two viral vectors containing the miR-200b/200a/429 cluster or the miR-141/200c cluster and green fluorescence protein (GFP). This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korean government (MEST) (2015R1A2A1A05001860).