Skip to main content
Erschienen in: Malaria Journal 1/2013

Open Access 01.12.2013 | Research

Performance of two rapid diagnostic tests for malaria diagnosis at the China-Myanmar border area

verfasst von: Juan Yan, Nana Li, Xu Wei, Peipei Li, Zhenjun Zhao, Lili Wang, Siying Li, Xiaomei Li, Ying Wang, Shuying Li, Zhaoqing Yang, Bin Zheng, Guofa Zhou, Guiyun Yan, Liwang Cui, Yaming Cao, Qi Fan

Erschienen in: Malaria Journal | Ausgabe 1/2013

Abstract

Background

Rapid diagnostic tests (RDTs) have become an essential tool in the contemporary malaria control and management programmes in the world. This study aims to evaluate the performance of two commonly used RDTs for malaria diagnosis in the China-Myanmar border area.

Methods

A total 606 febrile patients in the China-Myanmar border were recruited to this study and were diagnosed for malaria infections by microscopy, two RDTs tests (Pf/Pan device, and Pv/Pf device) and nested PCR.

Results

Malaria parasites were found in 143 patients by microscopy, of which 51, 73, and 19 were Plasmodium falciparum, Plasmodium vivax and P. falciparum/P. vivax mixed infections, respectively. Compared to microscopy, the sensitivity of the Pf/Pan device was 88.6% for P. falciparum and 69.9% for P. vivax with the specificity of 90.4%. For a subset of 350 patients, the sensitivity of the Pf/Pan device and Pv/Pf device for detection of P. falciparum was 87.5% and 91.7%, respectively; and for detection of P. vivax was 72.0% and 73.8%, respectively. The specificity of the Pf/Pan device and Pv/Pf device was 94.3% and 96.5%, respectively. Nested PCR detected malaria parasites in 174 of 606 samples, of which 67, 79, two and 26 were P. falciparum, P. vivax, P. ovale and P. falciparum/P. vivax mixed infections, respectively. Compared to nested PCR, all other methods had sensitivity below 80%, suggesting that a significant number of cases were missed.

Conclusions

Compared to PCR, both microscopy and RDTs had lower sensitivities. RDTs had similar performance to microscopy for P. falciparum diagnosis, but performed worse for P. vivax diagnosis. Other RDT products should be selected with higher sensitivity (and good specificity) for both P. falciparum and P. vivax diagnosis.
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​1475-2875-12-73) contains supplementary material, which is available to authorized users.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

YJ, LN, WX, LP and ZZ carried out the experimental work and data analysis.WL, LS and ZG participated in data analysis. YJ performed manuscript writing. YC, QF and LC conceived the study and participated in the design of the study. All authors read and approved the final manuscript.

Background

Malaria is a highly prevalent disease in tropical and subtropical regions, affecting half of the world’s population in 108 countries, resulting in almost one million deaths annually[1]. Malaria in human can be caused by one of five malaria parasites (Plasmodium falciparum, Plasmodium vivax, Plasmodium malariae, Plasmodium ovale and Plasmodium knowlesi), which have different geographical distributions. Plasmodium falciparum causes the most severe form of the disease and tends to predominate in tropical areas. Plasmodium vivax is the predominant species outside Africa. In recent years, it has been increasingly recognized that P. vivax is also associated with severe symptoms[2], which changed the traditional view of this malaria as “benign tertian”. The great impact of the 130–435 million P. vivax infections each year and the significant lag in research and prevention justifies considering P. vivax malaria as a neglected tropical disease[3, 4]. In many parts of the world, such as Southeast Asia, P. vivax occurs sympatrically with P. falciparum. Since these two parasites require different drug treatments, accurate diagnosis is required to differentiate these two species in areas of co-existence.
Microscopic examination of Giemsa-stained blood smears under a light microscope remains the gold standard method for malaria diagnosis. However, this technique requires a relatively long observation time and well-trained microscopists. Misdiagnosis often happens in samples with low parasitaemia, especially when drugs are taken inappropriately[5, 6]. Furthermore, microscopic diagnosis of P. vivax is more challenging, because parasite density during P. vivax infections is often low. Recently, the use of molecular methods such as PCR, for the diagnosis of malaria has proved to be highly sensitive and specific[7, 8], but drawbacks such as a requirement for equipment, higher cost, and a lengthy procedure limit their routine[911]. Malaria rapid diagnostic tests (RDTs) have become very popular in various endemic settings[12], especially in areas where microscopic expertise is lacking. They are now an essential tool in malaria management during the malaria elimination/eradication campaign[13]. However, the wide variety of RDTs and their different performance under different endemic settings suggest that careful comparison of RDTs is needed before mass deployment for diagnosis.
RDTs are designed using antibodies against parasite species-specific or genus-specific antigens, such as P. falciparum-specific histidine-rich protein-2 (PfHRP2) and parasite lactate dehydrogenase (pLDH). However, the performance of RDTs is easily affected by humidity and extreme temperatures. In addition, persistence of antigens that may remain in the circulation of a patient after treatment may give false positive results[14]. In malaria endemic areas of the Greater Mekong Subregion (GMS), the four human malaria species often co-exist, but with P. falciparum and P. vivax being the predominant species. In this region, cases of human infected by the monkey malaria parasite P. knowlesi were also reported[15, 16]. Several types of RDTs have been evaluated in these areas, and most of them had poor performance for low levels of parasitaemia (e.g., <500 parasites/μL), which is especially true for vivax malaria[17, 18]. In recent years, with extensive supports from the Global Fund to fight AIDS, Tuberculosis and Malaria, the malaria control programme at the China-Myanmar border area has been substantially strengthened. Among the control measures is the mass use of RDTs for malaria diagnosis. Specifically, two types of RDTs have been extensively used based on co-existence of P. falciparum and P. vivax in this area: a Pf/Pan test device and a Pv/Pf test device. However, their performance for malaria diagnosis under this specific endemic setting has not been evaluated. In this study, the performance of the two RDTs was compared with that of microscopy and PCR for the diagnosis of P. falciparum and P. vivax malaria.

Methods

Study site and patients

The study was conducted in 2011 in Laiza township area along the China-Myanmar border. Malaria in this region, caused mainly by P. falciparum and P. vivax infections, is perennial with distinct seasonality, which occurs mostly in the rainy season from April to November. A total of 606 patients attending local malaria clinics and hospital were recruited into the study based on the following criteria: suspected of uncomplicated malaria, having fever with axillary temperature above 37.5°C at the time of examination and willing to participate in the study. The study population has a sex ratio of ~1. Their ages ranged from six months to 88 years with a median of 20.3 years. The relative proportions of patients under 15 years, between 16 and 50 years, and >50 years were 52.9, 39.3, and 7.8%, respectively. The study protocol was reviewed and approved by the Institutional Review Board of Kunming Medical University. All participants or legal guardians gave written informed consent before entering the study. Finger-prick blood was obtained for blood films, RDTs and PCR.

Microscopic examinations

Thick and thin blood films were prepared from peripheral blood. The slides were stained with Giemsa and screened for the presence of parasites and identification of parasite species. Stained blood films were examined with (a 100×) oil immersion lens. Parasite density was determined by counting the parasites and leucocytes, assuming 8,000 leucocytes/μL of blood[19]. Blood films were examined by an experienced microscopist who was ‘blinded’ to the results of additional diagnostic tests. Smears were considered negative if no parasite was seen in 100 oil immersion fields on a thick blood film. All the slides were double checked blindly by a second, independent microscopist and the results were combined. Parasite density was calculated by determining the number of parasites per 200 white blood cells in a thick blood film.

RDTs for malaria

The RDTs used in this study are One Step Malaria Pf/Pan test (Wondfo, China) and Malaria Pv/Pf test device (Cat. No. 200317, Tycolpharm Co., Limited, UK). The major target antigens of the Pf/Pan test device are PfHRP2 and pan-pLDH, which are specific for P. falciparum and all human Plasmodium species, respectively. The Pv/Pf test device is based on PfHRP2 antigen and Pv- pLDH antigen, which are specific for P. falciparum and P. vivax, respectively. Five microlitres of fresh whole blood was added to the card pad, and three drops of specific lying agent were added. The RDT result was read in 15–20 min according to the manufacturer’s instructions and immediately recorded. The test was considered valid when the control line on the immune-chromatographic test strip was shown. For the Pf/Pan test device, it was counted as P. falciparum- positive if the line detecting P. falciparum-specific PfHRP2 was positive or if the lines detecting both PfHRP2 and pan-pLDH were positive; as non-falciparum if only the pan-pLDH line was positive. For the Pv/Pf test device, it was counted as P. falciparum- or P. vivax-positive if one of both specific test lines were positive. The readers of RDTs were blinded to the results of microscopy and PCR. All 606 cases in this study were diagnosed by the Malaria Pf/Pan test device. Later, the Malaria Pv/Pf test device was added as a comparison and 350 cases were diagnosed by both RDTs.

Diagnosis by PCR

Fresh blood samples were spotted on Whatman 3 paper, air-dried at room temperature, and stored individually in a zipper plastic bag at −20°C until use to prevent DNA degradation. Genomic DNA was extracted from dried blood spots using QIAamp DNA Micro Kit (Qiagen) according to the manufacturer’s instruction. Nested PCR for Plasmodium species was slightly modified based on previously published work using the small subunit (SSU ) rRNA gene[20, 21]. Plasmodium genus-specific primers were shown in Table 1. For the primary PCR reactions, 2 μL of genomic DNA were used in a 25 μL reaction with outer primers rPLU5 and rPLU6, and 30 cycles (94°C for 1 min, 55°C for 2 min and 72°C for 2 min) were performed. For nested PCR, 2 μL of the primary PCR product were used as the template with species-specific primers for the four human malaria species and P. knowlesi in separate reaction tubes. After another 30 cycles of amplification (94°C for 40 s, 58°C for 1 min and 72°C for 2 min), the PCR products were separated in 1% and 2% agarose gels for primary and nested PCR, respectively. DNA bands were stained with ethidium bromide and visualized under a UV light. The primers and expected sizes of the PCR fragments of the SSU rRNA genes are shown in Table 1.
Table 1
Primers based on the 18S rRNA gene in malaria parasites for nested PCR diagnosis of malaria infections
Species
Primer
Sequence (5’-3’)
Size of PCR product (bp)
Plasmodium sp.
rPLU5
CCTGTTGTTGCCTTAAACTTC
1100
 
rPLU6
TTAAAATTGTTGCAGTTAAAACG
 
P. falciparum
rFAL1
TTAAACTGGTTTGGGAAAACCAAATATATT
205
 
rFAL2
ACACAATGAACTCAATCATGACTACCCGTC
 
P. vivax
PV18SF
GAATTTTCTCTTCGGAGTTTATTC
419
 
PV18SR
GTAGAAAAGGGAAAGGGAAACTGTTA
 
P. malariae
PM18SF
GAGACATTCATATATATGAGTGTTTCT
423
 
PM18SR
GGGAAAAGAACGTTTTTATTAAAAAAAAC
 
P. ovale
PO18SF
GAAAATTCCTTTTGGAAATTTCTTAG
410
 
PO18SR
GGGAAAAGGACACTATAATGTATC
 
P. knowlesi
PK18SF
GAGTTTTTCTTTTCTCTCCGGAG
424
 
PK18SR
GGGAAAGGAATCACATTTAACGT
 

Statistical analysis

The RDT results were compared with those from microscopy and nested PCR. Sensitivity and specificity were calculated with 95% confidence intervals (C.I.) in two separate analyses: (1) diagnostic performance of RDTs in comparison with the microscopic method, and (2) comparative diagnostic performances of RDTs in comparison with the microscopy and PCR as the references. Based on the microscopic results, the RDT results were considered true positive (TP), true negative (TN), false positive (FP), and false negative (FN) using the interpretation criteria presented in Table 2. Sensitivity and specificity were calculated as TP/(TP+FN) and TN/(TN+FP), respectively. Statistical analysis was performed by the Chi-square test using the SPSS version 15.0 and the significance level was set as < 0.05.
Table 2
Interpretation of the results for the Pf/Pan RDT
For P. falciparum
Test Line(s) visible
Species identification by microscopy (or corrected by PCR)
P. falciparum or as a mixed infection with P. falciparum
P. vivax, P. ovale, P. malariae, P. knowlesi /no parasites detected
Only Pf or both Pf and Pan line visible
True positive (TP)
Species mismatch**/false positive (FP)
No test line or only Pan line visible
False negative/species mismatch* (FN)
True Negative (TN)
For the non- falciparum species
Test Line(s) visible
Species identification by microscopy (or corrected by PCR)
P. vivax, P. ovale, or P. malariae
P. falciparum/no parasites detected
only Pan line visible
True positive (TP)
Species mismatch*/false positive (FP)
No test line or Only Pf or both Pf and Pan line visible
False negative/species mismatch**(FN)
True Negative(TN)
* P. falciparum or as a mixed infection with P. falciparum diagnosed as non-falciparum species.
** Non-falciparum species diagnosed as P. falciparum or as a mixed infection with P. falciparum.

Results

Blood samples were collected from a total of 606 patients. All samples were evaluated by the Pf/Pan test device, while a subset of 350 were also evaluated by the Pv/Pf test device. Of the 606 samples, malaria parasites were found in 143 by microscopy; 51, 73, and 19 were P. falciparum, P. vivax and P. falciparum/P. vivax mixed infections, respectively (Table 3). No other malaria parasite species were detected by microscopy. The parasite density ranges of P. falciparum were 40–105,920 parasites/μL. For P. vivax, the majority of cases had parasite density ranging from 80 to 17,800 parasites/μL. One P. vivax case had a deviant parasite density of >200,000 parasites/μL based on leucocyte number probably due to a low leucocyte count in this patient. Because P. falciparum single infections and mixed species infections containing P. falciparum cannot be differentiated by the Pf/Pan device, the microscopy results were grouped into “P. falciparum and mixed infections with P. falciparum” and “Non-falciparum”. Based on this interpretation, the Pf/Pan device detected 33 single P. falciparum infections (only the PfHRP2 line visible), 56 non-falciparum cases (only the pan-pLDH line visible) and 70 P. falciparum infections/potentially mixed infections (both lines visible) (Table 3). Compared with the results by microscopy, the Pf/Pan device detected 62 and 51 samples as true positives for P. falciparum and non-falciparum, respectively. From this result, the sensitivity of Pf/Pan device was 88.6% for P. falciparum and 69.9% for P. vivax with the specificity of 90.4% (Table 4).
Table 3
Detection results of malaria infections by the Malaria Pf/Pan test in comparison with microscopy (N=606)
Method
Species
Species identified by microscopy
Total
P. falciparum
P. vivax
P. falciparum + P. vivax
Negative
Pf/Pan Test
P. falciparum
18
3
2
10
33
Pan (non-falciparum)
1
51
1
3
56
P. falciparum + Pan
27
13
15
15
70*
Negative
5
6
1
435
447
 
Total
51
73
19
463
606
* For the Pf/Pan device, these cases had both test lines visible, suggesting they were either P. falciparum single infections or P. falciparum/non-falciparum mixed infections.
Table 4
Performance of two RDTs for detection of P. falciparum and P. vivax with microscopy as the gold standard
 
Pf/Pan (N=606)
Pf/Pan (N=350)
Pv/Pf (N=350)
Sensitivity for P. falciparum
88.6 (85.9-91.3)
87.5 (83.8-91.2)
91.7 (88.5-94.8)
Sensitivity for P. vivax (non-falciparum for Pf/Pan)
69.9 (66.0-73.8)
72.0 (66.9-77.1)
73.8 (68.7-78.8)
Specificity
90.4 (87.8-93.1)
94.3 (91.4-97.1)
96.5 (94.3-98.7)
Data are presented as percentage (95% confidence interval; CI).
For the subset of 350 samples, microscopy detected 37 samples containing P. falciparum, 50 samples containing P. vivax and 11 were diagnosed as mixed species infections (Table 5). Since the Pv/Pf device is able to differentiate P. falciparum and P. vivax infections, the microscopy results were grouped into “infections containing P. falciparum” and “infections containing P. vivax”. The Pv/Pf device detected 40 single P. falciparum infections, 42 P. vivax infections, and 8 mixed species infections (Table 5). Compared to microscopy, the Pv/Pf device detected 44 and 45 samples as true positives for P. falciparum and P. vivax, respectively, whereas the Pf/Pan device detected 42 and 36 samples as true positives for P. falciparum and P. vivax, respectively. The sensitivity of Pf/Pan device and Pv/Pf device for detection of P. falciparum was 87.5% and 91.7%, respectively; and for detection of P. vivax was 72.0% and 73.8%, respectively (Table 4). The specificity of Pf/Pan device and Pv/Pf device was 94.3% and 96.5%, respectively (Table 4).
Table 5
Detection results of malaria infections by Malaria Pv/Pf test and Malaria Pf/Pan test in comparison with the microscopic method (N=350)
Method
Species
Species identified by microscopy
Total
P. falciparum
P. vivax
P. falciparum + P. vivax
P. ovale
Negative
Pv/Pf Test
P. falciparum
32
1
6
0
1
40
P. vivax
0
39
0
0
3
42
P. falciparum + P. vivax
2
2
4
0
0
8
Negative
3
8
1
0
248
260
Pf/Pan Test
P. falciparum
17
1
2
0
2
22
Pan(non-falciparum)
0
36
0
0
2
38
P. falciparum + Pan
15
8
8
0
2
33*
Negative
5
5
1
0
246
257
 
Total
37
50
11
0
252
350
* For the Pf/Pan device, these cases had both test lines visible, suggesting they were either P. falciparum single infections or P. falciparum/non-falciparum mixed infections.
It has been observed that some RDTs do not perform well when the parasite density is below 500 parasites/μL. For P. falciparum, both RDTs had significantly higher sensitivity for cases with a parasite density above 500 parasites/μL (>92%) than those with a density below 500 parasites/μL (<75.0%) (Table 6). However, for P. vivax malaria, regardless of the parasite density, both RDTs displayed sensitivity of below 79%. Both RDTs had similar detection limits; they were >240 and >320 parasites/μL for P. falciparum and P. vivax, respectively.
Table 6
Comparative sensitivity of the two RDTs for detection of P. falciparum and P. vivax in comparison with the microscopic method, categorized according to parasite density
 
Density (Parasites/μL)
Pf/Pan (N=606)
Pf/Pan (N=350)
Pv/Pf (N=350)
TP (N)
Sensitivity (%)
TP (N)
Sensitivity (%)
TP (N)
Sensitivity (%)
P. falciparum
>500
51
92.7 (86.0-99.4)
34
94.4 (87.3-100)
35
97.2 (92.1-100)
<500
11
73.3 (69.4-77.3)
8
66.7 (61.0-72.4)
9
75.0 (70.1-80.2)
P. vivax (or non-falciparum)
>500
40
69.0 (56.7-81.2)
28
71.8 (57.1-86.5)
36
78.3 (63.2-93.2)
 
<500
11
73.3 (69.4-77.3)
8
72.7 (67.4-78.1)
9
60.0 (54.0-66.0)
Sensitivity is presented as percentage (95% confidence interval; CI). TP true positive.
To further evaluate the performance of these two RDTs, all 606 samples were examined by nested PCR. Nested PCR detected malaria parasites in 174 samples, of which 67, 79, two and 26 were P. falciparum, P. vivax, P. ovale and P. falciparum/P. vivax mixed infections, respectively. No P. knowlesi infections were detected by PCR (Table 7). For the subset of 350 samples, 113 samples were identified by nested PCR as infection with malaria parasites. Of which, 40, 52, and 21 were P. falciparum, P. vivax, and P. falciparum/P. vivax mixed infections, respectively (Table 8). Among all detection methods, PCR was the most sensitive one. If PCR was used as the gold standard, the sensitivity of microscopy for P. falciparum and P. vivax was 71.0% and 73.3% in 606 detected samples, and 75.4% and 74.0% in the 350 subset samples, respectively (Table 9). The sensitivity of Pf/Pan test for P. falciparum and P. vivax was 81.7% and 64.6% in 606 detected samples, and 77.1% and 63.5% in the 350 subset samples, respectively (Table 9). For the subset of 350 samples analyzed by Pv/Pf devices, the sensitivity was 72.1% for P. falciparum and 58.9% for P. vivax, respectively (Table 9). Microscopy and the two RDTs had similar levels of specificity ranging from 94.7% to 96.3% (Table 9). It is noteworthy that although the Pf/Pan device is designed to identify all human malaria parasite species, the two P. ovale infections identified by PCR were missed by this device and by microscopy, possibly due to the low parasitaemia in the P. ovale infections (containing 120 parasites/μL and 320 parasites/μL, respectively). Re-examination of the P. ovale slides by microscopy did detect P. ovale-parasitized erythrocytes (Figure 1).
Table 7
Detection results of malaria infections by microscopy and Malaria Pf/Pan test in comparison with the Nested PCR (N=606)
Method
Species
Species identified by nested PCR
Total
P. falciparum
P. vivax
P. falciparum + P. vivax
P. ovale
Negative
Microscopy
P. falciparum
39
2
9
0
1
51
P. vivax
1
61
9
0
2
73
P. falciparum + P. vivax
12
1
6
0
0
19
P. ovale
0
0
0
0
0
0
Negative
15
15
2
2
429
463
Pf/Pan Test
P. falciparum
16
1
7
1
8
33
Pan(non-falciparum)
0
51
5
0
0
56
P. falciparum + Pan
40
10
13
0
7
70*
Negative
11
17
1
1
417
447
 
Total
67
79
26
2
432
606
* For the Pf/Pan device, these cases had both test lines visible, suggesting they were either P. falciparum single infections or P. falciparum/non-falciparum mixed infections.
Table 8
Detection results of malaria infections by microscopy, Malaria Pf/Pan test and Malaria Pv/Pf test in comparison with the Nested PCR (N=350)
Method
Species
Species identified by Nested PCR
Total
P. falciparum
P. vivax
P. falciparum + P. vivax
P. ovale
Negative
Microscopy
P. falciparum
29
1
6
0
1
37
P. vivax
0
40
9
0
1
50
P. falciparum + P. vivax
6
0
5
0
0
11
P. ovale
0
0
0
0
0
0
Negative
5
11
1
0
235
252
Pv/Pf Test
P. falciparum
26
0
12
0
2
40
P. vivax
1
33
8
0
0
42
P. falciparum + P. vivax
6
2
0
0
0
8
Negative
7
17
1
0
235
260
Pf/Pan Test
P. falciparum
14
0
6
0
2
22
Pan(non-falciparum)
0
33
5
0
0
38
P. falciparum + Pan
18
5
9
0
1
33*
Negative
8
14
1
0
234
257
 
Total
40
52
21
0
237
350
* For the Pf/Pan device, these cases had both test lines visible, suggesting they either P. falciparum single infections or P. falciparum/non-falciparum mixed infections.
Table 9
Performance of different diagnosis methods with the nested PCR method as the gold standard
 
Microscopy (N=606)
Pf/Pan (N=606)
Microscopy (N=350)
Pv/Pf (N=350)
Pf/Pan (N=350)
Sensitivity for P. falciparum
71.0 (67.0-74.9)
81.7 (78.4-85.1)
75.4 (70.4-80.4)
72.1 (66.9-77.3)
77.1 (72.2-81.9)
Sensitivity for P. vivax
73.3 (69.5-77.2)
64.6 (60.5-68.6)
74.0 (68.8-79.1)
58.9 (53.1-64.7)
63.5 (58.0-68.9)
Specificity
95.8 (93.9-97.6)
92.9 (90.5-95.3)
96.3 (93.9-98.7)
95.5 (92.9-98.1)
94.7 (92.0-97.5)
Data are presented as percentage (95% confidence interval; CI).
According to the microscopy results corrected by PCR, four and eight cases were false negative in 606 samples examined by the Pf/Pan test device for P. falciparum and P. vivax, respectively (Table 3). When mixed infections were excluded, three out of four P. falciparum cases had lower parasite density (<480 parasites/μL). Only one P. falciparum case with higher parasite density (8,800 parasites/μL) was not detected by the Pf/Pan test device, but was positive by the Pv/Pf test device. Five out of eight P. vivax cases were lower parasite density (<560 parasites/μL). The remaining three P. vivax cases with higher parasite density (1,880/μL, 2,760/μL and 15,840/μL) were not detected by the Pf/Pan test device. In the subset of 350 samples examined by the Pv/Pf test device (mixed infection not included, Table 5), two P. falciparum cases with lower parasite density (<480 parasites/μL) were false negative. Nine P. vivax cases were the false negative, of which three had lower parasite density (<320 parasites/μL), and three cases (parasite density of 1,320/μL, 2080/μL, 7,280/μL) were positive by the Pf/Pan test device. The other three cases with higher parasite density (1,880/μL, 2,760/μL and 15,840/μL) were not detected by both RDTs.
False positive and wrong species identification were observed with both RDTs. In all 606 samples (identified by microscopy and corrected by PCR, mixed infection not included) examined by the Pf/Pan test device, one P. vivax case, one P. ovale case, and eight negative cases showed the PfHRP2 line. Ten P. vivax cases showed not only the pan-pLDH line, but the PfHRP2 line. Seven negative cases showed both PfHRP2 and pan-pLDH lines (Table 7). In the subset of 350 samples analysed by the Pv/Pf test, two negative cases showed the PfHRP2 line. One P. falciparum case showed the Pv- pLDH line only. Two P. vivax cases showed not only the Pv-pLDH line, but the PfHRP2-line. Six P. falciparum cases (parasite density ranging from 240 to 34,400 parasites/μL) showed not only the PfHRP2 line, but also the Pv- pLDH line (Table 8). It has been reported that P. falciparum infections with high parasite densities may generate a false positive Pv-pLDH line[2225]. For the Pv/Pf test devices, six out of 40 P. falciparum (corrected by PCR) with the Pv-pLDH line visible showed that cross reactions between different species occurred although parasite densities of some P. falciparum infections were not high. From these comparisons, the specificities of these devices need further improvement for areas with both P. falciparum and P. vivax malaria.
Since P. falciparum and P. vivax infections are treated with different drugs, it would be important to compare the different methods for detecting mixed species infections. PCR, microscopy and Pv/Pf test device detected 21, 11, and eight mixed-species infections in the 350 subset samples (Table 8), corresponding to 18.6%, 11.2% and 8.9% of positive cases detected by the respective methods.

Discussion

RDTs are playing an essential role in the current malaria control/elimination campaign worldwide. In this study, the performance of two RDT devices commonly used at the China-Myanmar border area was evaluated. Compared to diagnosis by microscopy, both the Pf/Pan and Pv/Pf devices showed higher sensitivity (>87%) for detecting P. falciparum infections, whereas the sensitivity for detecting P. vivax infections was much lower (<74%). Both RDTs had similar levels of detection limits, and their performance was poor for infections with parasite densities below 500 parasites/μL for P. falciparum infections. Besides, since both devices rely on the PfHRP2 antigen for the detection of P. falciparum, pfhrp2 gene deletions will lead to false-negative results[26]. A recent report showing up to 40% of P. falciparum parasites with pfhrp2 deletions in South America[27] indicate that such RDTs would not perform well in these regions. It certainly warrants more detailed investigations in other malaria endemic regions.
When PCR was used as the gold standard, the detection sensitivity of both RDTs was reduced especially for the detection of P. vivax infections (<64%), although the specificity of the all detection methods remained above 92%. In addition, the sensitivity of conventional microscopy was also low, ranging from 71.0% to 77.4% for detecting both parasite species. This result is worrisome; since nearly 30% of the malaria cases was not correctly diagnosed by microscopy or RDTs and subsequently treated, these patients may constitute an important reservoir for transmission. Whereas low parasite density might be the most important limiting factor for microscopic diagnosis[6, 28], the varying skills and experience of microscopists may also be responsible for the lower sensitivity of diagnosis[29]. In the past, the Pf/Pan test (Wondfo) has been evaluated for diagnosis of P. falciparum only and showed highly satisfactory result[30]. Recently, a CareStart™ kit (Pf/Pan) was evaluated in the nearby Yunnan province of China, which showed comparable results to microscopy for diagnosing P. falciparum and P. vivax infections[31]. Therefore, further evaluations of RDTs are needed to select better diagnostic tests with improved accuracy in this region.
Overall, both RDTs have good sensitivity for detecting P. falciparum infections, but the sensitivity for detecting P. vivax was much lower. This could be due to lower parasite density for P. vivax since this parasite selectively invades reticulocytes. However, comparison of the two RDTs showed that the sensitivities for P. vivax detection were not different between the high and low parasite densities (Table 6). This observation is difficult to explain and could be due to the lower number of infections analyzed in the <500 parasites/μL group. Furthermore, the arbitrary selection of 500 parasites/μL as the border line between high and low parasite densities may not be appropriate for P. vivax. In addition, the sensitivity to P. vivax may be affected by other factors. Therefore, better RDTs with significantly improved sensitivity for P. vivax are needed.
One important criterion for the selection of RDTs in the GMS is the ability to detect other human malaria species in addition to P. falciparum. The advantage of the Pf/Pan test is that it is designed to detect four human parasite species, which co-exist in the GMS. However, this device failed to detect the two P. ovale infections, suggesting that further improvement in sensitivity for detecting other malaria species is needed. It is also worth to note that the PCR method failed to identify any P. knowlesi infections, which is in stark contrast to the eaerlier report of some 30% of malaria cases in this region as mixed infections with P. knowlesi[16]. Therefore, the significantly lower prevalence of other malaria parasite species in this region and the generally low sensitivity of the Pf/Pan test for diagnosis of P. ovale and P. malariae suggest that such an advantage is hardly of any importance in this region. In comparison, the Pv/Pf test is specific for P. falciparum and P. vivax, which make up the majority of malaria infections in the GMS, although it would certainly miss detecting P. malariae and P. ovale infections. Because P. falciparum and P. vivax require different antimalarial treatments, correct diagnosis of mixed infections should be an important criterion for the selection of an RDT. Even though the Pv/Pf device is able to detect P. falciparum and P. vivax mixed infection, the detection rate was low and the eight mix infections detected by this device were all misdiagnosed when compared to the PCR result. This result may be due to reduced density of one parasite species in the presence of another due to competition in the same host. Consequently, with the current anti-malarial drug policy of this region, misdiagnosis of mixed species infections as single species infections would lead to improper drug treatments.

Conclusions

The aim of this study was to evaluate the performance of two RDTs for malaria diagnosis at the China-Myanmar border area. PCR method was much more sensitive than microscopy and RDTs. Compared to microscopy, both RDTs demonstrated similar sensitivities for detecting P. falciparum infections but reduced sensitivity for detecting P. vivax infections. Neither of them had satisfactory results in detecting mixed species infections. Therefore, methods with improved sensitivity for diagnosing P. vivax malaria are needed. False negative results for the diagnosis of P. falciparum malaria call for further investigations on potential deletion of pfhrp2 gene in this malaria-endemic region.

Acknowledgements

This work was supported by grant from the National Institute of Allergy and Infectious Diseases, National Institutes of Health (U19 AI089672).
Open Access This article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License ( https://​creativecommons.​org/​licenses/​by/​2.​0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

YJ, LN, WX, LP and ZZ carried out the experimental work and data analysis.WL, LS and ZG participated in data analysis. YJ performed manuscript writing. YC, QF and LC conceived the study and participated in the design of the study. All authors read and approved the final manuscript.
Anhänge

Authors’ original submitted files for images

Below are the links to the authors’ original submitted files for images.
Literatur
1.
Zurück zum Zitat World Health Organization: World malaria report 2011. 2011, Geneva: World Health Organization World Health Organization: World malaria report 2011. 2011, Geneva: World Health Organization
3.
Zurück zum Zitat Price RN, Tjitra E, Guerra CA, Yeung S, White NJ, Anstey NM: Vivax malaria: neglected and not benign. Am J Trop Med Hyg. 2007, 77: 79-87.PubMedCentralPubMed Price RN, Tjitra E, Guerra CA, Yeung S, White NJ, Anstey NM: Vivax malaria: neglected and not benign. Am J Trop Med Hyg. 2007, 77: 79-87.PubMedCentralPubMed
4.
Zurück zum Zitat Baird JK: Neglect of Plasmodium vivax malaria. Trends Parasitol. 2007, 23: 533-539. 10.1016/j.pt.2007.08.011.CrossRefPubMed Baird JK: Neglect of Plasmodium vivax malaria. Trends Parasitol. 2007, 23: 533-539. 10.1016/j.pt.2007.08.011.CrossRefPubMed
5.
Zurück zum Zitat Amexo M, Tolhurst R, Barnish G, Bates I: Malaria misdiagnosis: effects on the poor and vulnerable. Lancet. 2004, 364: 1896-1898. 10.1016/S0140-6736(04)17446-1.CrossRefPubMed Amexo M, Tolhurst R, Barnish G, Bates I: Malaria misdiagnosis: effects on the poor and vulnerable. Lancet. 2004, 364: 1896-1898. 10.1016/S0140-6736(04)17446-1.CrossRefPubMed
6.
Zurück zum Zitat Snounou G, Viriyakosol S, Jarra W, Thaithong S, Brown KN: Identification of the four human malaria parasite species in field samples by the polymerase chain reaction and detection of a high prevalence of mixed infections. Mol Biochem Parasitol. 1993, 58: 283-292. 10.1016/0166-6851(93)90050-8.CrossRefPubMed Snounou G, Viriyakosol S, Jarra W, Thaithong S, Brown KN: Identification of the four human malaria parasite species in field samples by the polymerase chain reaction and detection of a high prevalence of mixed infections. Mol Biochem Parasitol. 1993, 58: 283-292. 10.1016/0166-6851(93)90050-8.CrossRefPubMed
7.
Zurück zum Zitat Snounou G, Viriyakosol S, Zhu XP, Jarra W, Pinheiro L, do Rosario VE, Thaithong S, Brown KN: High sensitivity of detection of human malaria parasites by the use of nested polymerase chain reaction. Mol Biochem Parasitol. 1993, 61: 315-320. 10.1016/0166-6851(93)90077-B.CrossRefPubMed Snounou G, Viriyakosol S, Zhu XP, Jarra W, Pinheiro L, do Rosario VE, Thaithong S, Brown KN: High sensitivity of detection of human malaria parasites by the use of nested polymerase chain reaction. Mol Biochem Parasitol. 1993, 61: 315-320. 10.1016/0166-6851(93)90077-B.CrossRefPubMed
8.
Zurück zum Zitat Kho WG, Chung JY, Sim EJ, Kim MY, Kim DW, Jongwutiwes S, Tanabe K: A multiplex polymerase chain reaction for a differential diagnosis of Plasmodium falciparum and Plasmodium vivax. Parasitol Int. 2003, 52: 229-236. 10.1016/S1383-5769(03)00028-X.CrossRefPubMed Kho WG, Chung JY, Sim EJ, Kim MY, Kim DW, Jongwutiwes S, Tanabe K: A multiplex polymerase chain reaction for a differential diagnosis of Plasmodium falciparum and Plasmodium vivax. Parasitol Int. 2003, 52: 229-236. 10.1016/S1383-5769(03)00028-X.CrossRefPubMed
9.
Zurück zum Zitat Makler MT, Palmer CJ, Ager AL: A review of practical techniques for the diagnosis of malaria. Ann Trop Med Parasitol. 1998, 92: 419-433. 10.1080/00034989859401.CrossRefPubMed Makler MT, Palmer CJ, Ager AL: A review of practical techniques for the diagnosis of malaria. Ann Trop Med Parasitol. 1998, 92: 419-433. 10.1080/00034989859401.CrossRefPubMed
10.
Zurück zum Zitat Farnert A, Arez AP, Correia AT, Bjorkman A, Snounou G, do Rosario V: Sampling and storage of blood and the detection of malaria parasites by polymerase chain reaction. Trans R Soc Trop Med Hyg. 1999, 93: 50-53. 10.1016/S0035-9203(99)90177-3.CrossRefPubMed Farnert A, Arez AP, Correia AT, Bjorkman A, Snounou G, do Rosario V: Sampling and storage of blood and the detection of malaria parasites by polymerase chain reaction. Trans R Soc Trop Med Hyg. 1999, 93: 50-53. 10.1016/S0035-9203(99)90177-3.CrossRefPubMed
11.
Zurück zum Zitat Hwang SY, Kim SH, Lee GY, Hang VT, Moon CS, Shin JH, Koo WL, Kim SY, Park HJ, Park HO, Kho WG: A novel real-time PCR assay for the detection of Plasmodium falciparum and Plasmodium vivax malaria in low parasitized individuals. Acta Trop. 2011, 120: 40-45. 10.1016/j.actatropica.2011.05.006.CrossRefPubMed Hwang SY, Kim SH, Lee GY, Hang VT, Moon CS, Shin JH, Koo WL, Kim SY, Park HJ, Park HO, Kho WG: A novel real-time PCR assay for the detection of Plasmodium falciparum and Plasmodium vivax malaria in low parasitized individuals. Acta Trop. 2011, 120: 40-45. 10.1016/j.actatropica.2011.05.006.CrossRefPubMed
12.
Zurück zum Zitat Lubell Y, Reyburn H, Mbakilwa H, Mwangi R, Chonya K, Whitty CJ, Mills A: The cost-effectiveness of parasitologic diagnosis for malaria-suspected patients in an era of combination therapy. Am J Trop Med Hyg. 2007, 77: 128-132.PubMed Lubell Y, Reyburn H, Mbakilwa H, Mwangi R, Chonya K, Whitty CJ, Mills A: The cost-effectiveness of parasitologic diagnosis for malaria-suspected patients in an era of combination therapy. Am J Trop Med Hyg. 2007, 77: 128-132.PubMed
13.
Zurück zum Zitat Bisoffi Z, Gobbi F, Angheben A, Van den Ende J: The role of rapid diagnostic tests in managing malaria. PLoS Med. 2009, 6: e1000063-10.1371/journal.pmed.1000063.PubMedCentralCrossRefPubMed Bisoffi Z, Gobbi F, Angheben A, Van den Ende J: The role of rapid diagnostic tests in managing malaria. PLoS Med. 2009, 6: e1000063-10.1371/journal.pmed.1000063.PubMedCentralCrossRefPubMed
14.
Zurück zum Zitat Wongsrichanalai C, Barcus MJ, Muth S, Sutamihardja A, Wernsdorfer WH: A review of malaria diagnostic tools: microscopy and rapid diagnostic test (RDT). Am J Trop Med Hyg. 2007, 77: 119-127.PubMed Wongsrichanalai C, Barcus MJ, Muth S, Sutamihardja A, Wernsdorfer WH: A review of malaria diagnostic tools: microscopy and rapid diagnostic test (RDT). Am J Trop Med Hyg. 2007, 77: 119-127.PubMed
15.
Zurück zum Zitat Putaporntip C, Hongsrimuang T, Seethamchai S, Kobasa T, Limkittikul K, Cui L, Jongwutiwes S: Differential prevalence of Plasmodium infections and cryptic Plasmodium knowlesi malaria in humans in Thailand. J Infect Dis. 2009, 199: 1143-1150. 10.1086/597414.CrossRefPubMed Putaporntip C, Hongsrimuang T, Seethamchai S, Kobasa T, Limkittikul K, Cui L, Jongwutiwes S: Differential prevalence of Plasmodium infections and cryptic Plasmodium knowlesi malaria in humans in Thailand. J Infect Dis. 2009, 199: 1143-1150. 10.1086/597414.CrossRefPubMed
16.
Zurück zum Zitat Jiang N, Chang Q, Sun X, Lu H, Yin J, Zhang Z, Wahlgren M, Chen Q: Co-infections with Plasmodium knowlesi and other malaria parasites, Myanmar. Emerg Infect Dis. 2010, 16: 1476-1478. 10.3201/eid1609.100339.PubMedCentralCrossRefPubMed Jiang N, Chang Q, Sun X, Lu H, Yin J, Zhang Z, Wahlgren M, Chen Q: Co-infections with Plasmodium knowlesi and other malaria parasites, Myanmar. Emerg Infect Dis. 2010, 16: 1476-1478. 10.3201/eid1609.100339.PubMedCentralCrossRefPubMed
17.
Zurück zum Zitat Coleman RE, Maneechai N, Ponlawat A, Kumpitak C, Rachapaew N, Miller RS, Sattabongkot J: Failure of the OptiMAL rapid malaria test as a tool for the detection of asymptomatic malaria in an area of Thailand endemic for Plasmodium falciparum and P. vivax. Am J Trop Med Hyg. 2002, 67: 563-565.PubMed Coleman RE, Maneechai N, Ponlawat A, Kumpitak C, Rachapaew N, Miller RS, Sattabongkot J: Failure of the OptiMAL rapid malaria test as a tool for the detection of asymptomatic malaria in an area of Thailand endemic for Plasmodium falciparum and P. vivax. Am J Trop Med Hyg. 2002, 67: 563-565.PubMed
18.
Zurück zum Zitat Coleman RE, Maneechai N, Rachapaew N, Kumpitak C, Soyseng V, Miller RS, Thimasarn K, Sattabongkot J: Field evaluation of the ICT Malaria Pf/Pv immunochromatographic test for the detection of asymptomatic malaria in a Plasmodium falciparum/vivax endemic area in Thailand. Am J Trop Med Hyg. 2002, 66: 379-383.PubMed Coleman RE, Maneechai N, Rachapaew N, Kumpitak C, Soyseng V, Miller RS, Thimasarn K, Sattabongkot J: Field evaluation of the ICT Malaria Pf/Pv immunochromatographic test for the detection of asymptomatic malaria in a Plasmodium falciparum/vivax endemic area in Thailand. Am J Trop Med Hyg. 2002, 66: 379-383.PubMed
20.
Zurück zum Zitat Buppan P, Putaporntip C, Pattanawong U, Seethamchai S, Jongwutiwes S: Comparative detection of Plasmodium vivax and Plasmodium falciparum DNA in saliva and urine samples from symptomatic malaria patients in a low endemic area. Malar J. 2010, 9: 72-10.1186/1475-2875-9-72.PubMedCentralCrossRefPubMed Buppan P, Putaporntip C, Pattanawong U, Seethamchai S, Jongwutiwes S: Comparative detection of Plasmodium vivax and Plasmodium falciparum DNA in saliva and urine samples from symptomatic malaria patients in a low endemic area. Malar J. 2010, 9: 72-10.1186/1475-2875-9-72.PubMedCentralCrossRefPubMed
21.
Zurück zum Zitat Johnston SP, Pieniazek NJ, Xayavong MV, Slemenda SB, Wilkins PP, da Silva AJ: PCR as a confirmatory technique for laboratory diagnosis of malaria. J Clin Microbiol. 2006, 44: 1087-1089. 10.1128/JCM.44.3.1087-1089.2006.PubMedCentralCrossRefPubMed Johnston SP, Pieniazek NJ, Xayavong MV, Slemenda SB, Wilkins PP, da Silva AJ: PCR as a confirmatory technique for laboratory diagnosis of malaria. J Clin Microbiol. 2006, 44: 1087-1089. 10.1128/JCM.44.3.1087-1089.2006.PubMedCentralCrossRefPubMed
22.
Zurück zum Zitat Gillet P, Bosselaers K, Cnops L, Bottieau E, Van Esbroeck M, Jacobs J: Evaluation of the SD FK70 malaria Ag Plasmodium vivax rapiddiagnostic test in a non-endemic setting. Malar J. 2009, 8: 129-10.1186/1475-2875-8-129.PubMedCentralCrossRefPubMed Gillet P, Bosselaers K, Cnops L, Bottieau E, Van Esbroeck M, Jacobs J: Evaluation of the SD FK70 malaria Ag Plasmodium vivax rapiddiagnostic test in a non-endemic setting. Malar J. 2009, 8: 129-10.1186/1475-2875-8-129.PubMedCentralCrossRefPubMed
23.
Zurück zum Zitat Gillet P, van Dijk DP, Bottieau E, Cnops L, Van Esbroeck M, Jacobs J: Test characteristics of the SD FK80 Plasmodium falciparum/Plasmodium vivax malaria rapid diagnostic test in a non-endemic setting. Malar J. 2009, 8: 262-10.1186/1475-2875-8-262.PubMedCentralCrossRefPubMed Gillet P, van Dijk DP, Bottieau E, Cnops L, Van Esbroeck M, Jacobs J: Test characteristics of the SD FK80 Plasmodium falciparum/Plasmodium vivax malaria rapid diagnostic test in a non-endemic setting. Malar J. 2009, 8: 262-10.1186/1475-2875-8-262.PubMedCentralCrossRefPubMed
24.
Zurück zum Zitat van Dijk DP, Gillet P, Vlieghe E, Cnops L, van Esbroeck M, Jacobs J: Evaluation of the Palutop+4 malaria rapid diagnostic test in a nonendemic setting. Malar J. 2009, 8: 293-10.1186/1475-2875-8-293.PubMedCentralCrossRefPubMed van Dijk DP, Gillet P, Vlieghe E, Cnops L, van Esbroeck M, Jacobs J: Evaluation of the Palutop+4 malaria rapid diagnostic test in a nonendemic setting. Malar J. 2009, 8: 293-10.1186/1475-2875-8-293.PubMedCentralCrossRefPubMed
25.
Zurück zum Zitat Maltha J, Gillet P, Cnops L, van den Ende J, van Esbroeck M, Jacobs J: Malaria rapid diagnostic tests: Plasmodium falciparum infections with high parasite densities may generate false positive Plasmodium vivax pLDH lines. Malar J. 2010, 9: 198-10.1186/1475-2875-9-198.PubMedCentralCrossRefPubMed Maltha J, Gillet P, Cnops L, van den Ende J, van Esbroeck M, Jacobs J: Malaria rapid diagnostic tests: Plasmodium falciparum infections with high parasite densities may generate false positive Plasmodium vivax pLDH lines. Malar J. 2010, 9: 198-10.1186/1475-2875-9-198.PubMedCentralCrossRefPubMed
26.
Zurück zum Zitat Maltha J, Gamboa D, Bendezu J, Sanchez L, Cnops L, Gillet P, Jacobs J: Rapid diagnostic tests for malaria diagnosis in the Peruvian Amazon: impact of pfhrp2 gene deletions and cross-reactions. PLoS ONE. 2012, 7: e43094-10.1371/journal.pone.0043094.PubMedCentralCrossRefPubMed Maltha J, Gamboa D, Bendezu J, Sanchez L, Cnops L, Gillet P, Jacobs J: Rapid diagnostic tests for malaria diagnosis in the Peruvian Amazon: impact of pfhrp2 gene deletions and cross-reactions. PLoS ONE. 2012, 7: e43094-10.1371/journal.pone.0043094.PubMedCentralCrossRefPubMed
27.
Zurück zum Zitat Gamboa D, Ho M-F, Bendezu J, Torres K, Chiodini PL, Barnwell JW, Incardona S, Perkins M, Bell D, McCarthy J, Cheng Q: A large proportion of P. falciparum isolates in the Amazon Region of Peru lack pfhrp2 and pfhrp3: implications for malaria rapid diagnostic tests. PLoS ONE. 2010, 5: e8091-10.1371/journal.pone.0008091.PubMedCentralCrossRefPubMed Gamboa D, Ho M-F, Bendezu J, Torres K, Chiodini PL, Barnwell JW, Incardona S, Perkins M, Bell D, McCarthy J, Cheng Q: A large proportion of P. falciparum isolates in the Amazon Region of Peru lack pfhrp2 and pfhrp3: implications for malaria rapid diagnostic tests. PLoS ONE. 2010, 5: e8091-10.1371/journal.pone.0008091.PubMedCentralCrossRefPubMed
28.
Zurück zum Zitat McManus DP, Bowles J: Molecular genetic approaches to parasite identification: their value in diagnostic parasitology and systematics. Int J Parasitol. 1996, 26: 687-704. 10.1016/0020-7519(96)82612-9.CrossRefPubMed McManus DP, Bowles J: Molecular genetic approaches to parasite identification: their value in diagnostic parasitology and systematics. Int J Parasitol. 1996, 26: 687-704. 10.1016/0020-7519(96)82612-9.CrossRefPubMed
29.
Zurück zum Zitat Kahama-Maro J, D'Acremont V, Mtasiwa D, Genton B, Lengeler C: Low quality of routine microscopy for malaria at different levels of the health system in Dar es Salaam. Malar J. 2011, 10: 332-10.1186/1475-2875-10-332.PubMedCentralCrossRefPubMed Kahama-Maro J, D'Acremont V, Mtasiwa D, Genton B, Lengeler C: Low quality of routine microscopy for malaria at different levels of the health system in Dar es Salaam. Malar J. 2011, 10: 332-10.1186/1475-2875-10-332.PubMedCentralCrossRefPubMed
30.
Zurück zum Zitat Peng Y, Wu J, Wang J, Li W, Yu S: Study and evaluation of Wondfo rapid diagnostic kit based on nano-gold immunochromatography assay for diagnosis of Plasmodium falciparum. Parasitol Res. 2012, 110: 1421-1425. 10.1007/s00436-011-2643-6.CrossRefPubMed Peng Y, Wu J, Wang J, Li W, Yu S: Study and evaluation of Wondfo rapid diagnostic kit based on nano-gold immunochromatography assay for diagnosis of Plasmodium falciparum. Parasitol Res. 2012, 110: 1421-1425. 10.1007/s00436-011-2643-6.CrossRefPubMed
31.
Zurück zum Zitat Xiaodong S, Tambo E, Chun W, Zhibin C, Yan D, Jian W, Jiazhi W, Xiaonong Z: Diagnostic performance of CareStart™ malaria HRP2/pLDH (Pf/pan) combo test versus standard microscopy on falciparum and vivax malaria between China-Myanmar endemic borders. Malar J. 2013, 12: 6-10.1186/1475-2875-12-6.PubMedCentralCrossRefPubMed Xiaodong S, Tambo E, Chun W, Zhibin C, Yan D, Jian W, Jiazhi W, Xiaonong Z: Diagnostic performance of CareStart™ malaria HRP2/pLDH (Pf/pan) combo test versus standard microscopy on falciparum and vivax malaria between China-Myanmar endemic borders. Malar J. 2013, 12: 6-10.1186/1475-2875-12-6.PubMedCentralCrossRefPubMed
Metadaten
Titel
Performance of two rapid diagnostic tests for malaria diagnosis at the China-Myanmar border area
verfasst von
Juan Yan
Nana Li
Xu Wei
Peipei Li
Zhenjun Zhao
Lili Wang
Siying Li
Xiaomei Li
Ying Wang
Shuying Li
Zhaoqing Yang
Bin Zheng
Guofa Zhou
Guiyun Yan
Liwang Cui
Yaming Cao
Qi Fan
Publikationsdatum
01.12.2013
Verlag
BioMed Central
Erschienen in
Malaria Journal / Ausgabe 1/2013
Elektronische ISSN: 1475-2875
DOI
https://doi.org/10.1186/1475-2875-12-73

Weitere Artikel der Ausgabe 1/2013

Malaria Journal 1/2013 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Reizdarmsyndrom: Diäten wirksamer als Medikamente

29.04.2024 Reizdarmsyndrom Nachrichten

Bei Reizdarmsyndrom scheinen Diäten, wie etwa die FODMAP-arme oder die kohlenhydratreduzierte Ernährung, effektiver als eine medikamentöse Therapie zu sein. Das hat eine Studie aus Schweden ergeben, die die drei Therapieoptionen im direkten Vergleich analysierte.

Notfall-TEP der Hüfte ist auch bei 90-Jährigen machbar

26.04.2024 Hüft-TEP Nachrichten

Ob bei einer Notfalloperation nach Schenkelhalsfraktur eine Hemiarthroplastik oder eine totale Endoprothese (TEP) eingebaut wird, sollte nicht allein vom Alter der Patientinnen und Patienten abhängen. Auch über 90-Jährige können von der TEP profitieren.

Niedriger diastolischer Blutdruck erhöht Risiko für schwere kardiovaskuläre Komplikationen

25.04.2024 Hypotonie Nachrichten

Wenn unter einer medikamentösen Hochdrucktherapie der diastolische Blutdruck in den Keller geht, steigt das Risiko für schwere kardiovaskuläre Ereignisse: Darauf deutet eine Sekundäranalyse der SPRINT-Studie hin.

Bei schweren Reaktionen auf Insektenstiche empfiehlt sich eine spezifische Immuntherapie

Insektenstiche sind bei Erwachsenen die häufigsten Auslöser einer Anaphylaxie. Einen wirksamen Schutz vor schweren anaphylaktischen Reaktionen bietet die allergenspezifische Immuntherapie. Jedoch kommt sie noch viel zu selten zum Einsatz.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.