Skip to main content
Erschienen in: BMC Nephrology 1/2017

Open Access 01.12.2017 | Research article

Protective effect of rutin supplementation against cisplatin-induced Nephrotoxicity in rats

verfasst von: Ali R. Alhoshani, Mohamed M. Hafez, Sufia Husain, Abdel Malek Al-sheikh, Moureq R. Alotaibi, Salim S. Al Rejaie, Musaad A. Alshammari, Mashal M. Almutairi, Othman A. Al-Shabanah

Erschienen in: BMC Nephrology | Ausgabe 1/2017

Abstract

Background

Cisplatin (CP) is commonly used in the treatment of different types of cancer but nephrotoxicity has been a major limiting factor. Therefore, the present study aimed to study the possible protective effect of rutin against nephrotoxicity induced by cisplatin in rats.

Methods

Forty male Wistar albino rats were randomly divided into 4 groups. Rats of group 1 control group intraperitoneal (i.p.) received 2.5 ml/kg, group 2 CP group received single dose 5 mg/kg cisplatin i.p. group 3 rutin group orally received 30 mg/kg rutin group 4 (CP plus rutin) received CP and rutin as in group 2 and 3. Kidneys were harvested for histopathology and for the study the gene expression of c-Jun N-terminal kinases (JNK), Mitogen-activated protein kinase 4 (MKK4), MKK7, P38 mitogen-activated protein kinases (P38), tumor necrosis factors alpha (TNF-α), TNF Receptor-Associated Factor 2 (TRAF2), and interleukin-1 alpha (IL-1-α).

Results

The cisplatin single dose administration to rats induced nephrotoxicity associated with a significant increase in blood urea nitrogen (BUN) and serum creatinine and significantly increase Malondialdehyde (MDA) in kidney tissues by 230 ± 5.5 nmol/g compared to control group. The animal treated with cisplatin showed a significant increase in the expression levels of the IL-1α (260%), TRFA2 (491%), P38 (410%), MKK4 (263%), MKK7 (412%), JNK (680%) and TNF-α (300%) genes compared to control group. Additionally, histopathological examination showed that cisplatin-induced interstitial congestion, focal mononuclear cell inflammatory, cell infiltrate, acute tubular injury with reactive atypia and apoptotic cells. Rutin administration attenuated cisplatin-induced alteration in gene expression and structural and functional changes in the kidney. Additionally, histopathological examination of kidney tissues confirmed gene expression data.

Conclusion

The present study suggested that the anti-oxidant and anti-inflammatory effect of rutin may prevent CP-induced nephrotoxicity via decreasing the oxidative stress, inhibiting the interconnected ROS/JNK/TNF/P38 MAPK signaling pathways, and repairing the histopathological changes against cisplatin administration.
Abkürzungen
AP-1
Activator protein 1
BUN
Blood urea nitrogen
CDNA
Complementary deoxynucleic acid
CP
Cisplatin
GAPDH
Glyceraldehyde-3-phosphate dehydrogenase
GSH
Glutathione
IL-1-α
interleukin-1 alpha
JNK
c-Jun N-terminal kinases
MAPK
Mitogen-activated protein kinase
MCP-1
Monocyte Chemoattractant protein-1
MDA
Malondialdehyde
MIP2
Macrophage inflammatory protein-2
MKK4
Mitogen-activated protein kinase 4
MKK7
Mitogen-activated protein kinase 7
NF k B
Nuclear factor kappa beta
P38
P38 mitogen-activated protein kinases
RANTES
Regulated on Activation Normal T Expressed and Secreted
RNA
Ribonucleic acid
RNS
Reactive Nitrogen Species
ROS
Reactive oxygen species
TBARS
Thiobarbituric acid reactive substance
TGF-β
Transforming growth factor-beta
TNF-α
tumor necrosis factors alpha
TRAF2
TNF Receptor-Associated Factor 2
UV
Ultraviolet

Background

Cisplatin (CP) is a chemotherapy commonly used in cancer treatment including head, neck, ovarian, and testicular cancers [1, 2] but is associated with nephrotoxicity in 28–36% of patients receiving an initial dose (50–100 mg/m2) of cisplatin [3]. The accumulation of high concentrations of cisplatin in the kidneys caused nephrotoxicity [4]. This serious complication is contributed to limiting its clinical use. The intermission of cisplatin remains the only choice in the case of progressive renal failure [5]. Cisplatin-induced nephrotoxicity through apoptosis and necrosis [6], vascular factors [7], and inflammation of the tubules [8]. The development of renal tubule injury is caused by the oxidative stress induced by cisplatin [912]. The reactive oxygen species (ROS) and reactive nitrogen species (RNS) production [13] alter the structure and function of cellular membranes [14]. In addition to their accumulation in kidney and lysosomes [15] explained the mechanisms for CP-induced acute nephropathy [13]. Although numerous mechanisms for CP-induced nephrotoxicity such as mitochondrial dysfunction, inflammation, DNA damage, oxidative stress and apoptosis had been studied, the precise mechanism is not well understood [16, 17]. Therefore, the free radical scavengers and the antioxidants agent can prevent cisplatin-induced nephrotoxicity.
Cisplatin damages the DNA resulting in apoptosis induction [18]. In response to cisplatin, several signaling pathways, which can be activated by lipid peroxidation and oxidative stress, modulate the cell survival or apoptosis [18, 19]. The mitogen-activated protein kinase (MAPK) pathways regulate differentiation, proliferation, apoptosis and are activated by chemical and physical stresses [20]. The three major MAPK pathways terminate in ERK, p38, and JNK/SAPK enzymes. Cisplatin is known to activate these three pathways in various cell lines including renal epithelial cells [21, 22]. p38 MAPK was involved in inflammation, cell cycle regulation, and differentiation [23] but its role in cancer therapy is not clear. Recently, some investigator suggests that p38 MAPK is able to control the p53-mediated response to cisplatin [24].
The interleukin-1 (IL-1) made up of 11 proteins encoded by 11 different genes [25] and its main function, in response to tissue injury or damage, is to control the pro-inflammatory reactions [26]. Activation of IL-1 lead to activation of some genes such as Mitogen-activated protein kinase kinase 4 (MKK4) and (MKK7) which activate JNK [27, 28], and MKK4, MKK3, and MKK6 activate p38 MAPK [29].
Flavonoids are a group of natural poly-phenolic compounds found in plants and have a variety of biological effects and play important role in detoxification of free radicals [30]. Rutin is flavonoid glycosides that are present in herbs and plant foods and possessed different protective effects in vitro as well as in vivo [31, 32] against lipid peroxidation and oxidative stress-mediated diseases [33]. Rutin is an immuno-modulator and has anti-oxidant, anti-diarrheal, anti-tumor, and anti-inflammatory effect, myocardial protection, and has renal protective effects against the ischemia-reperfusion-induced renal injury [34]. Therefore, this study investigated the possible protective effects of rutin against cisplatin-induced nephrotoxicity in rats.

Methods

Animals

The study was approved by the Research Ethics Committee of the College of Pharmacy, King Saud University. Male Wistar rats (230–260 g) were obtained from College of Pharmacy, King Saud University Animal Care Center and were kept under standard conditions of temperature (22 ± 1 °C), humidity (50–55%), and a 12-h light:/dark cycle. Food and water were freely available. All methods were conducted in accordance with the Guide for Care and Use of Laboratory Animals, Institute for Laboratory Animal Research, National Institute of Health (NIH publication No. 80–23; 1996).

Chemicals

Cisplatin (1 mg/ml sterile concentrate) was a gift from King Khalid University Hospital drug store, KSU, KSA. Rutin (CAS Number 207671-50-9) was purchased from Sigma Chemicals (Sigma-Aldrich Louis, MO, USA). Primers were designed using primer express 3 software (Applied Biosystem, Life Technologies, Grand Island, NY, USA) and Syber Green master mix kit (Cat#4309155) were purchased from Applied Biosystems (Life Technologies, Grand Island, NY, USA).

Experimental design

The experimental Design follows Kamel et al., [3]. The rats were randomly divided into four groups (ten rats each) as follows: Group-I: intraperitoneal (i.p.) received saline (2.5 ml/kg) (normal control group). Group-II: i.p. received single dose 5 mg/kg cisplatin, (cisplatin group) [35]. Group-III: orally received 30 mg/kg rutin dissolved in water for 14 days (Rutin group) [36]. Group-IV: orally received 30 mg/kg rutin, dissolved in water for 14 days with a single dose of cisplatin (5 mg/kg, i.p.) on the tenth day.
All animals were weighted and were exposed to ether and were killed by decapitation 24 h after the last treatment. Blood samples were obtained and sera were separated. The kidney was immediately removed then washed with ice-cold saline solution. Parts of both kidneys were cut into small pieces for histopathological study and for the gene expression analysis.

Bioassays

Determination of blood urea nitrogen and serum creatinine

Blood urea nitrogen (BUN) was measured spectrophotometrically according to the methods of Tobacco et al. [37]. In brief, serum was diluted 1:4 in normal saline and 5 μL of diluted serum and standard (in duplicate) were added to the microplate wells; then 150 μL of urease Mix solution was added to each well. The plate was incubated for 15 min under shaking at room temperature. Then 150 μL of Alkaline Hypochlorite was added to each well. After 10 min’ incubation at room temperature. Measure the absorbance of each sample in duplicate at 620 nm using microplate reader. The blood urea nitrogen concentration was calculated from stander curve. Serum creatinine was measured according to the methods of Fabiny and Ertingshausen [38] in brief, 100 μl of serum samples and standard was mixed with picric acid (17.5 mmol/l final concentration)/sodium hydroxide solution (0.16 mol/l final concentration) after 30 s and 2 min later the absorbance of standard and sample were recorded. After that, the creatinine concertation was calculated by dividing the delta absorbance of the sample by delta absorbance of the control multiply by standard concentration.

Histopathology examination

The kidneys harvested from each groups were fixed in 10% neutral buffered formaldehyde. Tissues dehydration, clearing in xylene and paraffin embedding was done according to the standard method. Sections were cut by a rotary microtome at 5–7 μm thick, and were stained by haematoxylin and eosin and periodic acid schief (PAS). Sections were examined under a light microscope and findings documented by two certified histopathologists.

Estimation of Malondialdehyde of lipid peroxidation

Malondialdehyde (MDA) concentration in tissues was measured as it is the major product of membrane lipid peroxidation as a previously described method by Ohkawa et al., [39]. The principle of this method depends on the formation of pink color resulted in reaction between MDA and thiobarbituric acid. This reaction producing a thiobarbituric acid reactive substance (TBARS), pink color, measured spectrophotometrically at 532 nm.

Estimation of (glutathione) GSH levels in kidney tissues

Glutathione concentration in 200 g kidney tissues homogenate was determined as previously described method by Sedlak and Lindsay [40].

RNA extraction and Gene expression studies

Total RNAs were extracted from kidneys tissue by Trizol method according to the manufacturer’s protocol as previously described [41]. The quantity was characterized using a UV spectrophotometer. The isolated RNA has an A 260/280 ratio of 1.9–2.1.

cDNA synthesis and real-time PCR methods

One microgram of total RNA was used to generate cDNA using a SuperScript™ first-strand synthesis system kit (Invitrogen, CA, USA), according to the manufacturer’s instructions. Real-time PCR was done using 2-ΔΔCt method according to our previous study [42] and GAPDH gene was used as internal control. All primers used in this study were synthesized in Jena Bioscience Germany and were listed in Table 1.
Table 1
Primers used in this study
Gene Name
Forward primer
Reverse primer
JNK
5′-AAATAGAGCATCCCAGTCTTCGA-3′
5′-ACTGGGCCGCTGTTTCTG-3′
MKK4
5′- CATCGGGCCTCCAGCTT -3′
5′- AAATTCAACTTCAGGGCTTTGC -3′
MKK7
5′- AAGCTCTGTGACTTTGGCATCA -3′
5′- CAGCCAGCACTCCGTGTTT -3′
P38
5′-GGTTTTGGACTCGGATAAGAGGAT-3’
5′-GGGTCGTGGTACTGAGCAAAG-3’
TRAF2
5′-ACGCTGCCCGCAGAGA-3’
5′-TCTTTCAAGGTCCCCTTCCA-3’
TNF-α
5′-CGGGCTCAGAATTTCCAACA-3’
5′-CGCAATCCAGGCCACTACTT-3’
IL-1-α
5′-CATCCGTGGAGCTCTCTTTACA-3’
5′-TTAAATGAACGAAGTGAACAGTACAGATT-3’
GAPDH
5′-AACTCCCATTCCTCCACCTT-3’
5′-GAGGGCCTCTCTCTTGCTCT-3’

Statistical analysis

The data were analyzed using GraphPad Prism 5 (GraphPad Software, Inc., La Jolla, CA, USA). Statistical significance was evaluated by one-way analysis of variance (ANOVA) followed by the Tukey-Kramer multiple comparison tests. All data were expressed as mean ± SEM, n = 10. The value of P < 0.05 was considered statistically significant.

Results

Effects of CP on renal cells

The effects of CP and rutin on histological changes in kidney tissues are shown in Fig. 1. The harvested kidneys from the control and treated rat kidneys were studied under a light microscope. The four compartment in the kidney, namely, glomeruli, tubules, interstitium and blood vessels were examined for any histopathological findings. The kidney in the control rats (GI) showed no histopathological abnormality in the glomeruli, tubules, interstitium and blood vessels (Fig. 1a and b). Rats treated with rutin dissolved in water (GII) also showed normal histology with no histopathological findings (Fig. 1c). The kidneys treated with Cisplatin showed histopathological abnormality in the interstitium and the tubules infiltrate (Fig. 1d to h). The interstitium showed patchy mild chronic mononuclear lymphoplasmacytic inflammatory cell infiltrate and mild congestion. The tubules showed patchy acute tubular injury with reactive/ reparative atypia of the tubular epithelial cells. Some tubular epithelial cells also showed cytoplasmic vacuolization and apoptosis. The glomeruli and the blood vessels were not affected. Rats treat with Rutin and Cisplatin combination showed only minimal histopathological findings in the form of minimal interstitial congestion and minimal tubular injury in a few tubules. The glomeruli and the blood vessels appeared normal.

Effect of CP on the body weight of rats

Figure 2 showed the effect of Cisplatin, rutin and their combination on the rat body weight. At the end of the experiment, CP-treated animals significantly lost weight compared to control group (P < 0.05). However, administration of rutin alone resulted in an increase in the body weight compared to both control and cisplatin group. Interestingly, administration of rutin in combination with CP resulted in a significant increase the body weight compared to CP group (p < 0.05).

Effects of CP on renal blood urea nitrogen and serum creatinine

Blood urea nitrogen (Fig. 3a) and serum creatinine (Fig. 3b) were used as biochemical markers for the nephrotoxicity. CP significant increased the levels of BUN (128.6 ± 44 mg/dl) and serum creatinine (4.6 ± 0.34 mg/dl), compared to control group 37 ± 2.4 mg/dl and 1.2 ± 0.1 mg/dl respectively (p < 0.001). The rutin group showed no significant changes in BUN and serum creatinine compared to control group. However, administration of rutin in combination with CP resulted in complete reversal of CP-induced increase in BUN and serum creatinine to their normal values as in control group.

Assessment of renal oxidative stress

Oxidative stress-induced free radicals that reacted with membrane phospholipids resulted in lipid peroxidation. To investigate the effect of CP, rutin and their combination on the lipid peroxidation biomarkers the MDA level was measured. Cisplatin significantly increased MDA levels in kidney tissue by 230 ± 5.5 nmol/g compared to 68 ± 2.1 nmol/g in control group (P < 0.001). Interestingly, the administration of rutin before cisplatin resulted in a reversal of MDA level induced by CP to its normal values as in control group. Administration of rutin alone showed non-significant changes in MDA levels (70 ± 1.8 nmol/g) compared to control group. Also, the free radicals depleted the antioxidant defense GSH. Rats treated with CP had a significant decrease in GSH level by 25 ± 6.8 nmol/100 mg tissue compared to 102 ± 3.5 nmol/100 mg tissue in control group. On the other hand, the administration of rutin before CP lead to increase in the GSH levels from 25 ± 6.8 nmol/100 mg tissue in CP group to 120 ± 3.6 nmol/100 mg tissue (p < 0.05). Administration of rutin alone showed non-significant changes in MDA levels 107 ± 2.3 nmol/100 mg tissue compared to the control group.

The effect of CP on the gene expression levels

To investigate the effect of CP on oxidative stress genes expression levels of IL-1α was measured in kidney tissues by using real-time PCR (Fig. 4). CP alone was significantly increased the expression level of IL-1α in kidney tissues by 260% (P < 0.05) and 164% (P < 0.001) compared to control and rutin groups respectively. Interestingly, administration of rutin to CP-treated rats resulted in a complete reversal the reduction of IL-1α expression level induced by CP to control values. This reversal change was resulted in significant decrease in IL-α expression level by 63% (p < 0.007) compared to CP group and by 73% compared to control group.
Figure 5 showed the effect of CP, rutin and their combination on TRAF2 expression level in Rat kidney tissues. Cisplatin alone significantly increased the expression level of TRAF2 in kidney tissues by 491% compared to control group (P < 0.001). However, administration of rutin alone resulted in insignificant increase in TRAF2 expression level by 77% compared to control groups (P > 0.5). Interestingly, administration of rutin in combination with CP resulted in significant decrease in the expression level of TRAF2 compared to CP group (p < 0.002).
Figure 6 showed the effect of CP, Rutin and their combination on the expression levels of P38 in rat kidney tissues. Treatment of CP alone resulted in significant increase in the P38 expression level by 410% (P < 0.001) in kidney tissues compared to control group. Administration of rutin alone resulted in insignificant increase in the P38 expression levels by 38% compared to control group (P < 0.5). Administration of rutin in combination with CP resulted in significant decrease in the P38 expression level compared to both control and CP groups (P < 0.001).
Figure 7 showed the effect of CP, Rutin and their combination on the expression level of MKK4 (A), MKK7 (B) and JNK (C) in kidney tissues. CP alone resulted in significant increase in MKK4 expression level by 236% (P < 0.001) in MKK7 by 412% and in JNK by 680% (P < 0.001) compared to control group. Interestingly, rutin administration in combination with CP resulted in complete reversal of CP-induced increasing in the expression levels of both MKK4 and MKK7 to their normal levels as in control group. On the other hand rutin administration in combination with CP resulted in significant decrease in the expression levels of JNK by 71% compared to CP group. There were no significant changes observed in both MKK4 and MKK7 in rutin group.
Figure 8 showed the effect of CP, Rutin and their combination on the expression level of TNF-α in kidney tissues. CP alone was resulted in significant increase in TNF-α expression level by 300% (P < 0.001) compared to control group. Interestingly, rutin administration in combination with CP was resulted in complete reversal of CP-induced increasing in the TNF-α expression levels to its normal levels as in control group. There were no significant changes observed in TNF-α in rutin group.

Discussion

Cisplatin is an anticancer drug used in the treatment of many types of cancer such as head and neck, lung, testis, ovary, and breast cancers [1, 2]. Nephrotoxicity is the dose-limiting side effect of cisplatin [43] such as acute kidney injury was found in about 20–30% of patients receiving CP [44], Hypo-magnesemia in about 40–100% of patients [45], Fanconi-like syndrome, distal renal tubular acidosis, hypo-calcemia, renal salt wasting and hyper-uricemia [46].
Nephrotoxicity induced by CP is characterized by a reduction in renal function that leads to increasing in serum creatinine and blood urea levels [47]. In the current study, creatinine and BUN serum levels were significantly high in CP-treated rats compared to untreated rats suggesting that CP produced nephrotoxicity as evidenced by the glomerular filtration rate reduction. The elevated serum creatinine and BUN levels induced by CP were significantly restored to their normal levels as in control group by rutin. The rutin protective effect against nephrotoxicity can be attributed to its antioxidant and anti-inflammatory effect on ROS and some cytokines may be involved in the glomerular filtration rate damage [48]. Although the accurate mechanism of CP-induced nephrotoxicity is not well understood, previous study suggested that cisplatin interacts with DNA, through the formation of covalent adducts between certain DNA bases and the platinum compound leading to cell cytotoxicity [49]. Other studies suggest that CP-induced ROS and immune response which are mediators of nephrotoxicity [5052]. In the present study, the MDA and GSH were measured as biomarkers for the oxidative stress. In the kidney tissue, the MDA level was significantly increased and GSH level was decreased by the effect of cisplatin. However, rutin administration caused significant decreases in lipid peroxidation and promoted increases in GSH content in the kidney. Therefore, rutin can protect the kidney from CP-induced injury via improvement in oxidant status. A similar study found that rutin pre-treatment attenuates renal inflammation and apoptosis induced by cisplatin through reducing TNF-α, NFkB and caspase-3 levels [18, 25].
The p38-MAPK stress pathway, stimulated with inflammatory cytokines such as TNF-α or IL-1, act as a key regulator of apoptosis in cells [53]. The expression of the number of inflammatory cytokines and chemokines is increased in the kidney after cisplatin injury [54]. In the present study, CP increased the expression levels of both TNF-α or IL1-α. Similarly, other study found that the single injection of cisplatin in mice induced nephrotoxicity. In the kidneys of cisplatin-treated mice, the nephrotoxicity caused up-regulation in TNF-α, IL-1β, macrophage inflammatory protein-2 (MIP-2), monocyte chemoattractant protein-1 (MCP-1), ICAM-1, and TGF-β [55].
The present study showed that the rutin supplementation improved the CP-induced increased in the expression levels of IL-1 and TNF-α that were in agreement with previous reports. Rutin acts as antioxidant and anti-inflammatory and improves renal abnormality induced by several factors or chemotherapeutic agents like doxorubicin or cisplatin [5658]. TNF-α induced by cisplatin is highly dependent upon the production of ROS, activation of NFκB, and p38 MAPK. However, the activation of TNF-α and IL-1 are involved in several signal transduction mechanisms, including the NF K B and AP-1 pathways. In fact, the stress-activated group of MAPKs (JNK and p38) is strongly activated by TNF-α and IL-1 [54]. This was in agreement with the present study in which single dose of CP increase the expression levels of JNK and P38. The activation of JNK by TNF-α mediated by the TNF receptor-associated factor (TRAF) group of adapter proteins [59].
In the current study, the overexpression of TRAF2 as a result of cisplatin may be the cause of nephrotoxicity and apoptosis. The decrease in the expression level of TRAF2 in kidney tissues after rutin supplementation in CP-treated rats suggests that rutin may protect against CP-induced nephrotoxicity by regulating apoptotic pathways. Activation of TNF receptors leads to recruitment of the TRAF2 adapter protein [60, 61]. The activation of the TRAF2 expression is required for JNK activation by TNF [62]. A study showed that in nephrotoxicity induced by chemotherapy, genes for JNK play an essential role in modulating the pro- and anti-apoptotic proteins located in the mitochondria [63]. JNK with ROS can promote apoptosis by inhibiting anti-apoptotic proteins [64]. Also, JNK can be activated through its phosphorylation by MKK4 and MKK7 at threonine, tyrosine. MAPKKK activate both MKK4 and MKK7 protein kinases by dual phosphorylation at two sites in the T-loop [65]. The MKK7 protein kinase is primarily activated by cytokines (e.g TNF-α and IL-1) and MKK4 is primarily activated by environmental stress [66]. In the current study CP- induced the expression levels of MKK4 and MKK7 and these alterations attenuated by rutin supplementation in CP-treated rats. P38 MAPK is activated by MKK3, MKK4 and MKK6 [67]. In the present study, P38 expression levels were increased after a single dose of cisplatin. Similarly, several studies suggested that the inhibition of p38 MAPK, ERK or JNK with specific pharmacologic or genetic inhibitors reduced inflammation and renal injury [17, 68, 69].
Rutin administration in CP-treated rat restored the expression levels of P38 and reduced the apoptosis. Therefore, cisplatin-induced nephrotoxicity can be ameliorated by free radical scavengers [70], iron chelators [71], superoxide dismutase [48] and Vitamin E [72].

Conclusions

In conclusion, single dose of cisplatin-induced nephrotoxicity through the activation of P38 MAPK pathway. Our data may help in understanding the molecular mechanisms of rutin in CP nephrotoxicity. Rutin attenuates CP nephrotoxicity might be through its antioxidant as well as p38-MAPK inhibitor properties.

Acknowledgments

Authors thank the Deanship of Scientific Research at KSU for funding this work through the research group project no. RGP-142.

Funding

This work was funded by the Deanship of Scientific Research at KSU (research group project no. RGP-142).

Availability of data and materials

The datasets used and/or analyzed during the current study available from the corresponding author on reasonable request.

Authors’ contributions

ARA Participate in the study design, treatment, practical work, collated, analyzed and interpreted the data, and also drafted the manuscript. MMH participated in the study design and treatment, participated in practical work, collated, analyzed and interpreted the data, and also drafted the manuscript. SH shared in the study design and treatment and participated in histopathological work, interpreted the histopathological data, and also drafted the manuscript. AMA shared in the study design and treatment and participated in histopathological work, interpreted the histopathological data, and also drafted the manuscript. MRA shared in the study design and treatment, participated in practical work, collated, analyzed and interpreted the data, and also drafted the manuscript. SSA participated in the study design and treatment, participated in practical work, collated, analyzed and interpreted the data, and also drafted the manuscript. MAA participated in the study design and treatment, participated in practical work, collated, analyzed and interpreted the data, and also drafted the manuscript. MMA participated in the study design and treatment, participated in practical work, collated, analyzed and interpreted the data, and also drafted the manuscript. OAA participated in the study design and treatment, participated in practical work, collated, analyzed and interpreted the data, and also drafted the manuscript. All authors read and approved the final manuscript.

Competing interests

The authors declare that they have no competing of interests.
Not applicable.
The study was approved by the Research Ethics Committee of the College of Pharmacy, King Saud University, and Riyadh, Saudi Arabia.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Literatur
1.
Zurück zum Zitat Badary OA, Abdel-Maksoud S, Ahmed WA, Owieda GH. Naringenin attenuates cisplatin nephrotoxicity in rats. Life Sci. 2005;76(18):2125–35.CrossRefPubMed Badary OA, Abdel-Maksoud S, Ahmed WA, Owieda GH. Naringenin attenuates cisplatin nephrotoxicity in rats. Life Sci. 2005;76(18):2125–35.CrossRefPubMed
2.
Zurück zum Zitat Rabik CA, Dolan ME. Molecular mechanisms of resistance and toxicity associated with platinating agents. Cancer Treat rev. 2007;33(1):9–23.CrossRefPubMed Rabik CA, Dolan ME. Molecular mechanisms of resistance and toxicity associated with platinating agents. Cancer Treat rev. 2007;33(1):9–23.CrossRefPubMed
3.
Zurück zum Zitat Kamel KM, Abd El-Raouf OM, Metwally SA, Abd El-Latif HA, El-sayed ME. Hesperidin and rutin, antioxidant citrus flavonoids, attenuate cisplatin-induced nephrotoxicity in rats. J Biochem Mol Toxicol. 2014;28(7):312–9.CrossRefPubMed Kamel KM, Abd El-Raouf OM, Metwally SA, Abd El-Latif HA, El-sayed ME. Hesperidin and rutin, antioxidant citrus flavonoids, attenuate cisplatin-induced nephrotoxicity in rats. J Biochem Mol Toxicol. 2014;28(7):312–9.CrossRefPubMed
4.
Zurück zum Zitat Li H, Tang Y, Wen L, Kong X, Chen X, Liu P, et al. Neferine reduces cisplatin-induced nephrotoxicity by enhancing autophagy via the AMPK/mTOR signaling pathway. Biochem Biophys res Commun. 2017;484(3):694–701.CrossRefPubMed Li H, Tang Y, Wen L, Kong X, Chen X, Liu P, et al. Neferine reduces cisplatin-induced nephrotoxicity by enhancing autophagy via the AMPK/mTOR signaling pathway. Biochem Biophys res Commun. 2017;484(3):694–701.CrossRefPubMed
5.
Zurück zum Zitat Lebwohl D, Canetta R. Clinical development of platinum complexes in cancer therapy: an historical perspective and an update. Eur J Cancer. 1998;34(10):1522–34.CrossRefPubMed Lebwohl D, Canetta R. Clinical development of platinum complexes in cancer therapy: an historical perspective and an update. Eur J Cancer. 1998;34(10):1522–34.CrossRefPubMed
6.
Zurück zum Zitat Zhu X, Jiang X, Li A, Zhao Z, Li S. S-Allylmercaptocysteine attenuates Cisplatin-induced Nephrotoxicity through suppression of apoptosis, oxidative stress, and inflammation. Nutrients. 2017:9(2). Zhu X, Jiang X, Li A, Zhao Z, Li S. S-Allylmercaptocysteine attenuates Cisplatin-induced Nephrotoxicity through suppression of apoptosis, oxidative stress, and inflammation. Nutrients. 2017:9(2).
7.
Zurück zum Zitat Luke DR, Vadiei K, Lopez-Berestein G. Role of vascular congestion in cisplatin-induced acute renal failure in the rat. Nephrol Dial Transplant. 1992;7(1):1–7.PubMed Luke DR, Vadiei K, Lopez-Berestein G. Role of vascular congestion in cisplatin-induced acute renal failure in the rat. Nephrol Dial Transplant. 1992;7(1):1–7.PubMed
8.
Zurück zum Zitat Kumar P, Sulakhiya K, Barua CC, Mundhe N. TNF-alpha, IL-6 and IL-10 expressions, responsible for disparity in action of curcumin against cisplatin-induced nephrotoxicity in rats. Mol Cell Biochem. 2017; Kumar P, Sulakhiya K, Barua CC, Mundhe N. TNF-alpha, IL-6 and IL-10 expressions, responsible for disparity in action of curcumin against cisplatin-induced nephrotoxicity in rats. Mol Cell Biochem. 2017;
9.
Zurück zum Zitat Chtourou Y, Aouey B, Kebieche M, Fetoui H. Protective role of naringin against cisplatin induced oxidative stress, inflammatory response and apoptosis in rat striatum via suppressing ROS-mediated NF-kappaB and P53 signaling pathways. Chem Biol Interact. 2015;239:76–86.CrossRefPubMed Chtourou Y, Aouey B, Kebieche M, Fetoui H. Protective role of naringin against cisplatin induced oxidative stress, inflammatory response and apoptosis in rat striatum via suppressing ROS-mediated NF-kappaB and P53 signaling pathways. Chem Biol Interact. 2015;239:76–86.CrossRefPubMed
10.
Zurück zum Zitat Lin L, Zheng J, Zhu W, Jia N. Nephroprotective effect of gelsemine against cisplatin-induced toxicity is mediated via attenuation of oxidative stress. Cell Biochem Biophys. 2015;71(2):535–41.CrossRefPubMed Lin L, Zheng J, Zhu W, Jia N. Nephroprotective effect of gelsemine against cisplatin-induced toxicity is mediated via attenuation of oxidative stress. Cell Biochem Biophys. 2015;71(2):535–41.CrossRefPubMed
11.
Zurück zum Zitat Oh CJ, Ha CM, Choi YK, Park S, Choe MS, Jeoung NH, et al. Pyruvate dehydrogenase kinase 4 deficiency attenuates cisplatin-induced acute kidney injury. Kidney Int. 2017;91(4):880–95. Oh CJ, Ha CM, Choi YK, Park S, Choe MS, Jeoung NH, et al. Pyruvate dehydrogenase kinase 4 deficiency attenuates cisplatin-induced acute kidney injury. Kidney Int. 2017;91(4):880–95.
12.
Zurück zum Zitat Saral S, Ozcelik E, Cetin A, Saral O, Basak N, Aydin M, et al. Protective role of Diospyros lotus on cisplatin-induced changes in sperm characteristics, testicular damage and oxidative stress in rats. Andrologia. 2016;48(3):308–17.CrossRefPubMed Saral S, Ozcelik E, Cetin A, Saral O, Basak N, Aydin M, et al. Protective role of Diospyros lotus on cisplatin-induced changes in sperm characteristics, testicular damage and oxidative stress in rats. Andrologia. 2016;48(3):308–17.CrossRefPubMed
13.
Zurück zum Zitat Pedraza-Chaverri J, Barrera D, Maldonado PD, Chirino YI, Macias-Ruvalcaba NA, Medina-Campos ON, et al. S-allylmercaptocysteine scavenges hydroxyl radical and singlet oxygen in vitro and attenuates gentamicin-induced oxidative and nitrosative stress and renal damage in vivo. BMC Clin Pharmacol. 2004;4:5.CrossRefPubMedPubMedCentral Pedraza-Chaverri J, Barrera D, Maldonado PD, Chirino YI, Macias-Ruvalcaba NA, Medina-Campos ON, et al. S-allylmercaptocysteine scavenges hydroxyl radical and singlet oxygen in vitro and attenuates gentamicin-induced oxidative and nitrosative stress and renal damage in vivo. BMC Clin Pharmacol. 2004;4:5.CrossRefPubMedPubMedCentral
14.
Zurück zum Zitat Divya MK, Lincy L, Raghavamenon AC, Babu TD. Ameliorative effect of Apodytes dimidiata on cisplatin-induced nephrotoxicity in Wistar rats. Pharm Biol. 2016;54(10):2149–57.CrossRefPubMed Divya MK, Lincy L, Raghavamenon AC, Babu TD. Ameliorative effect of Apodytes dimidiata on cisplatin-induced nephrotoxicity in Wistar rats. Pharm Biol. 2016;54(10):2149–57.CrossRefPubMed
15.
Zurück zum Zitat Romero F, Perez M, Chavez M, Parra G, Durante P. Effect of uric acid on gentamicin-induced nephrotoxicity in rats - role of matrix metalloproteinases 2 and 9. Basic Clin Pharmacol Toxicol. 2009;105(6):416–24.CrossRefPubMed Romero F, Perez M, Chavez M, Parra G, Durante P. Effect of uric acid on gentamicin-induced nephrotoxicity in rats - role of matrix metalloproteinases 2 and 9. Basic Clin Pharmacol Toxicol. 2009;105(6):416–24.CrossRefPubMed
16.
Zurück zum Zitat Malik S, Suchal K, Bhatia J, Khan SI, Vasisth S, Tomar A, et al. Therapeutic potential and molecular mechanisms of Emblica officinalis Gaertn in countering Nephrotoxicity in rats induced by the chemotherapeutic agent Cisplatin. Front Pharmacol. 2016;7:350.CrossRefPubMedPubMedCentral Malik S, Suchal K, Bhatia J, Khan SI, Vasisth S, Tomar A, et al. Therapeutic potential and molecular mechanisms of Emblica officinalis Gaertn in countering Nephrotoxicity in rats induced by the chemotherapeutic agent Cisplatin. Front Pharmacol. 2016;7:350.CrossRefPubMedPubMedCentral
17.
Zurück zum Zitat Pabla N, Dong Z. Cisplatin nephrotoxicity: mechanisms and renoprotective strategies. Kidney Int. 2008;73(9):994–1007.CrossRefPubMed Pabla N, Dong Z. Cisplatin nephrotoxicity: mechanisms and renoprotective strategies. Kidney Int. 2008;73(9):994–1007.CrossRefPubMed
18.
Zurück zum Zitat Abdel-Daim MM, El-Sayed YS, Eldaim MA, Ibrahim A. Nephroprotective efficacy of ceftriaxone against cisplatin-induced subchronic renal fibrosis in rats. Naunyn Schmiedeberg's Arch Pharmacol. 2017;390(3):301–9.CrossRef Abdel-Daim MM, El-Sayed YS, Eldaim MA, Ibrahim A. Nephroprotective efficacy of ceftriaxone against cisplatin-induced subchronic renal fibrosis in rats. Naunyn Schmiedeberg's Arch Pharmacol. 2017;390(3):301–9.CrossRef
19.
Zurück zum Zitat Yamaguchi K, Ishikawa T, Kondo Y, Fujisawa M. Cisplatin regulates Sertoli cell expression of transferrin and interleukins. Mol Cell Endocrinol. 2008;283(1-2):68–75.CrossRefPubMed Yamaguchi K, Ishikawa T, Kondo Y, Fujisawa M. Cisplatin regulates Sertoli cell expression of transferrin and interleukins. Mol Cell Endocrinol. 2008;283(1-2):68–75.CrossRefPubMed
20.
Zurück zum Zitat Ma X, Dang C, Kang H, Dai Z, Lin S, Guan H, et al. Saikosaponin-D reduces cisplatin-induced nephrotoxicity by repressing ROS-mediated activation of MAPK and NF-kappaB signalling pathways. Int Immunopharmacol. 2015;28(1):399–408.CrossRefPubMed Ma X, Dang C, Kang H, Dai Z, Lin S, Guan H, et al. Saikosaponin-D reduces cisplatin-induced nephrotoxicity by repressing ROS-mediated activation of MAPK and NF-kappaB signalling pathways. Int Immunopharmacol. 2015;28(1):399–408.CrossRefPubMed
21.
Zurück zum Zitat Arany I, Megyesi JK, Kaneto H, Price PM, Safirstein RL. Cisplatin-induced cell death is EGFR/src/ERK signaling dependent in mouse proximal tubule cells. Am J Physiol Renal Physiol. 2004;287(3):F543–9.CrossRefPubMed Arany I, Megyesi JK, Kaneto H, Price PM, Safirstein RL. Cisplatin-induced cell death is EGFR/src/ERK signaling dependent in mouse proximal tubule cells. Am J Physiol Renal Physiol. 2004;287(3):F543–9.CrossRefPubMed
22.
Zurück zum Zitat Nowak G. Protein kinase C-alpha and ERK1/2 mediate mitochondrial dysfunction, decreases in active Na+ transport, and cisplatin-induced apoptosis in renal cells. J Biol Chem. 2002;277(45):43377–88.CrossRefPubMedPubMedCentral Nowak G. Protein kinase C-alpha and ERK1/2 mediate mitochondrial dysfunction, decreases in active Na+ transport, and cisplatin-induced apoptosis in renal cells. J Biol Chem. 2002;277(45):43377–88.CrossRefPubMedPubMedCentral
24.
Zurück zum Zitat Malik S, Suchal K, Gamad N, Dinda AK, Arya DS, Bhatia J. Telmisartan ameliorates cisplatin-induced nephrotoxicity by inhibiting MAPK mediated inflammation and apoptosis. Eur J Pharmacol. 2015;748:54–60.CrossRefPubMed Malik S, Suchal K, Gamad N, Dinda AK, Arya DS, Bhatia J. Telmisartan ameliorates cisplatin-induced nephrotoxicity by inhibiting MAPK mediated inflammation and apoptosis. Eur J Pharmacol. 2015;748:54–60.CrossRefPubMed
25.
Zurück zum Zitat Dunn E, Sims JE, Nicklin MJ, O'Neill LA. Annotating genes with potential roles in the immune system: six new members of the IL-1 family. Trends Immunol. 2001;22(10):533–6.CrossRefPubMed Dunn E, Sims JE, Nicklin MJ, O'Neill LA. Annotating genes with potential roles in the immune system: six new members of the IL-1 family. Trends Immunol. 2001;22(10):533–6.CrossRefPubMed
26.
Zurück zum Zitat Gaestel M, Kotlyarov A, Kracht M. Targeting innate immunity protein kinase signalling in inflammation. Nat rev Drug Discov. 2009;8(6):480–99.CrossRefPubMed Gaestel M, Kotlyarov A, Kracht M. Targeting innate immunity protein kinase signalling in inflammation. Nat rev Drug Discov. 2009;8(6):480–99.CrossRefPubMed
27.
Zurück zum Zitat Krause A, Holtmann H, Eickemeier S, Winzen R, Szamel M, Resch K, et al. Stress-activated protein kinase/Jun N-terminal kinase is required for interleukin (IL)-1-induced IL-6 and IL-8 gene expression in the human epidermal carcinoma cell line KB. J Biol Chem. 1998;273(37):23681–9.CrossRefPubMed Krause A, Holtmann H, Eickemeier S, Winzen R, Szamel M, Resch K, et al. Stress-activated protein kinase/Jun N-terminal kinase is required for interleukin (IL)-1-induced IL-6 and IL-8 gene expression in the human epidermal carcinoma cell line KB. J Biol Chem. 1998;273(37):23681–9.CrossRefPubMed
28.
Zurück zum Zitat Finch A, Holland P, Cooper J, Saklatvala J, Kracht M. Selective activation of JNK/SAPK by interleukin-1 in rabbit liver is mediated by MKK7. FEBS Lett. 1997;418(1-2):144–8.CrossRefPubMed Finch A, Holland P, Cooper J, Saklatvala J, Kracht M. Selective activation of JNK/SAPK by interleukin-1 in rabbit liver is mediated by MKK7. FEBS Lett. 1997;418(1-2):144–8.CrossRefPubMed
29.
Zurück zum Zitat Kracht M, Shiroo M, Marshall CJ, Hsuan JJ, Saklatvala J. Interleukin-1 activates a novel protein kinase that phosphorylates the epidermal-growth-factor receptor peptide T669. Biochem J. 1994;302(Pt 3):897–905.CrossRefPubMedPubMedCentral Kracht M, Shiroo M, Marshall CJ, Hsuan JJ, Saklatvala J. Interleukin-1 activates a novel protein kinase that phosphorylates the epidermal-growth-factor receptor peptide T669. Biochem J. 1994;302(Pt 3):897–905.CrossRefPubMedPubMedCentral
30.
Zurück zum Zitat AlSharari SD, Al-Rejaie SS, Abuohashish HM, Ahmed MM, Hafez MM. Rutin attenuates Hepatotoxicity in high-cholesterol-diet-fed rats. Oxidative med Cell Longev. 2016;2016:5436745.CrossRef AlSharari SD, Al-Rejaie SS, Abuohashish HM, Ahmed MM, Hafez MM. Rutin attenuates Hepatotoxicity in high-cholesterol-diet-fed rats. Oxidative med Cell Longev. 2016;2016:5436745.CrossRef
31.
Zurück zum Zitat Deschner EE, Ruperto J, Wong G, Newmark HL. Quercetin and rutin as inhibitors of azoxymethanol-induced colonic neoplasia. Carcinogenesis. 1991;12(7):1193–6.CrossRefPubMed Deschner EE, Ruperto J, Wong G, Newmark HL. Quercetin and rutin as inhibitors of azoxymethanol-induced colonic neoplasia. Carcinogenesis. 1991;12(7):1193–6.CrossRefPubMed
32.
Zurück zum Zitat Imam F, Al-Harbi NO, Al-Harbia MM, Korashy HM, Ansari MA, Sayed-Ahmed MM, et al. Rutin attenuates Carfilzomib-induced Cardiotoxicity through inhibition of NF-kappaB, hypertrophic Gene expression and oxidative stress. Cardiovasc Toxicol. 2017;17(1):58–66.CrossRefPubMed Imam F, Al-Harbi NO, Al-Harbia MM, Korashy HM, Ansari MA, Sayed-Ahmed MM, et al. Rutin attenuates Carfilzomib-induced Cardiotoxicity through inhibition of NF-kappaB, hypertrophic Gene expression and oxidative stress. Cardiovasc Toxicol. 2017;17(1):58–66.CrossRefPubMed
33.
Zurück zum Zitat Lopez-Revuelta A, Sanchez-Gallego JI, Hernandez-Hernandez A, Sanchez-Yague J, Llanillo M. Membrane cholesterol contents influence the protective effects of quercetin and rutin in erythrocytes damaged by oxidative stress. Chem Biol Interact. 2006;161(1):79–91.CrossRefPubMed Lopez-Revuelta A, Sanchez-Gallego JI, Hernandez-Hernandez A, Sanchez-Yague J, Llanillo M. Membrane cholesterol contents influence the protective effects of quercetin and rutin in erythrocytes damaged by oxidative stress. Chem Biol Interact. 2006;161(1):79–91.CrossRefPubMed
34.
Zurück zum Zitat Herrmann AP, Janke HD. Cofermentation of rutin and hesperidin during two-stage anaerobic pre-treatment of high-loaded brewery wastewater. Water res. 2001;35(11):2583–8.CrossRefPubMed Herrmann AP, Janke HD. Cofermentation of rutin and hesperidin during two-stage anaerobic pre-treatment of high-loaded brewery wastewater. Water res. 2001;35(11):2583–8.CrossRefPubMed
35.
Zurück zum Zitat Naghizadeh B, Boroushaki MT, Vahdati Mashhadian N, Mansouri MT. Protective effects of crocin against cisplatin-induced acute renal failure and oxidative stress in rats. Iran Biomed J. 2008;12(2):93–100.PubMed Naghizadeh B, Boroushaki MT, Vahdati Mashhadian N, Mansouri MT. Protective effects of crocin against cisplatin-induced acute renal failure and oxidative stress in rats. Iran Biomed J. 2008;12(2):93–100.PubMed
36.
Zurück zum Zitat Shimoi K, Shen B, Toyokuni S, Mochizuki R, Furugori M, Kinae N. Protection by alpha G-rutin, a water-soluble antioxidant flavonoid, against renal damage in mice treated with ferric nitrilotriacetate. Jpn J Cancer Res Gann. 1997;88(5):453–60.CrossRefPubMed Shimoi K, Shen B, Toyokuni S, Mochizuki R, Furugori M, Kinae N. Protection by alpha G-rutin, a water-soluble antioxidant flavonoid, against renal damage in mice treated with ferric nitrilotriacetate. Jpn J Cancer Res Gann. 1997;88(5):453–60.CrossRefPubMed
37.
Zurück zum Zitat Tabacco A, Meiattini F, Moda E, Tarli P. Simplified enzymic/colorimetric serum urea nitrogen determination. Clin Chem. 1979;25(2):336–7.PubMed Tabacco A, Meiattini F, Moda E, Tarli P. Simplified enzymic/colorimetric serum urea nitrogen determination. Clin Chem. 1979;25(2):336–7.PubMed
38.
Zurück zum Zitat Fabiny DL, Ertingshausen G. Automated reaction-rate method for determination of serum creatinine with the CentrifiChem. Clin Chem. 1971;17(8):696–700.PubMed Fabiny DL, Ertingshausen G. Automated reaction-rate method for determination of serum creatinine with the CentrifiChem. Clin Chem. 1971;17(8):696–700.PubMed
39.
Zurück zum Zitat Ohkawa H, Ohishi N, Yagi K. Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal Biochem. 1979;95(2):351–8.CrossRefPubMed Ohkawa H, Ohishi N, Yagi K. Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal Biochem. 1979;95(2):351–8.CrossRefPubMed
40.
Zurück zum Zitat Sedlak J, Lindsay RH. Estimation of total, protein-bound, and nonprotein sulfhydryl groups in tissue with Ellman's reagent. Anal Biochem. 1968;25(1):192–205.CrossRefPubMed Sedlak J, Lindsay RH. Estimation of total, protein-bound, and nonprotein sulfhydryl groups in tissue with Ellman's reagent. Anal Biochem. 1968;25(1):192–205.CrossRefPubMed
41.
Zurück zum Zitat Chomczynski P. A reagent for the single-step simultaneous isolation of RNA, DNA and proteins from cell and tissue samples. BioTechniques. 1993;15(3):532–4. 536-537PubMed Chomczynski P. A reagent for the single-step simultaneous isolation of RNA, DNA and proteins from cell and tissue samples. BioTechniques. 1993;15(3):532–4. 536-537PubMed
42.
Zurück zum Zitat Sayed-Ahmed MM, Al-Shabanah OA, Hafez MM, Aleisa AM, Al-Rejaie SS. Inhibition of gene expression of heart fatty acid binding protein and organic cation/carnitine transporter in doxorubicin cardiomyopathic rat model. Eur J Pharmacol. 2010;640(1-3):143–9.CrossRefPubMed Sayed-Ahmed MM, Al-Shabanah OA, Hafez MM, Aleisa AM, Al-Rejaie SS. Inhibition of gene expression of heart fatty acid binding protein and organic cation/carnitine transporter in doxorubicin cardiomyopathic rat model. Eur J Pharmacol. 2010;640(1-3):143–9.CrossRefPubMed
43.
Zurück zum Zitat Sastry J, Kellie SJ. Severe neurotoxicity, ototoxicity and nephrotoxicity following high-dose cisplatin and amifostine. Pediatr Hematol Oncol. 2005;22(5):441–5.CrossRefPubMed Sastry J, Kellie SJ. Severe neurotoxicity, ototoxicity and nephrotoxicity following high-dose cisplatin and amifostine. Pediatr Hematol Oncol. 2005;22(5):441–5.CrossRefPubMed
44.
45.
Zurück zum Zitat Schilsky RL, Anderson T. Hypomagnesemia and renal magnesium wasting in patients receiving cisplatin. Ann Intern med. 1979;90(6):929–31.CrossRefPubMed Schilsky RL, Anderson T. Hypomagnesemia and renal magnesium wasting in patients receiving cisplatin. Ann Intern med. 1979;90(6):929–31.CrossRefPubMed
46.
Zurück zum Zitat Peres LA, da Cunha AD, Jr. Acute nephrotoxicity of cisplatin: molecular mechanisms. J Bras Nefrol. 2013;35(4):332–40.CrossRefPubMed Peres LA, da Cunha AD, Jr. Acute nephrotoxicity of cisplatin: molecular mechanisms. J Bras Nefrol. 2013;35(4):332–40.CrossRefPubMed
47.
Zurück zum Zitat Farooqui Z, Ahmed F, Rizwan S, Shahid F, Khan AA, Khan F. Protective effect of Nigella sativa oil on cisplatin induced nephrotoxicity and oxidative damage in rat kidney. Biomed Pharmacother. 2017;85:7–15.CrossRefPubMed Farooqui Z, Ahmed F, Rizwan S, Shahid F, Khan AA, Khan F. Protective effect of Nigella sativa oil on cisplatin induced nephrotoxicity and oxidative damage in rat kidney. Biomed Pharmacother. 2017;85:7–15.CrossRefPubMed
48.
Zurück zum Zitat Cuzzocrea S, Mazzon E, Dugo L, Serraino I, Di Paola R, Britti D, et al. A role for superoxide in gentamicin-mediated nephropathy in rats. Eur J Pharmacol. 2002;450(1):67–76.CrossRefPubMed Cuzzocrea S, Mazzon E, Dugo L, Serraino I, Di Paola R, Britti D, et al. A role for superoxide in gentamicin-mediated nephropathy in rats. Eur J Pharmacol. 2002;450(1):67–76.CrossRefPubMed
49.
Zurück zum Zitat Ibrahim A, Eldaim MA, Abdel-Daim MM. Nephroprotective effect of bee honey and royal jelly against subchronic cisplatin toxicity in rats. Cytotechnology. 2016;68(4):1039–48.CrossRefPubMed Ibrahim A, Eldaim MA, Abdel-Daim MM. Nephroprotective effect of bee honey and royal jelly against subchronic cisplatin toxicity in rats. Cytotechnology. 2016;68(4):1039–48.CrossRefPubMed
50.
Zurück zum Zitat Pan H, Mukhopadhyay P, Rajesh M, Patel V, Mukhopadhyay B, Gao B, et al. Cannabidiol attenuates cisplatin-induced nephrotoxicity by decreasing oxidative/nitrosative stress, inflammation, and cell death. J Pharmacol exp Ther. 2009;328(3):708–14.CrossRefPubMed Pan H, Mukhopadhyay P, Rajesh M, Patel V, Mukhopadhyay B, Gao B, et al. Cannabidiol attenuates cisplatin-induced nephrotoxicity by decreasing oxidative/nitrosative stress, inflammation, and cell death. J Pharmacol exp Ther. 2009;328(3):708–14.CrossRefPubMed
51.
Zurück zum Zitat Rashed LA, Hashem RM, Soliman HM. Oxytocin inhibits NADPH oxidase and P38 MAPK in cisplatin-induced nephrotoxicity. Biomed Pharmacother. 2011;65(7):474–80.CrossRefPubMed Rashed LA, Hashem RM, Soliman HM. Oxytocin inhibits NADPH oxidase and P38 MAPK in cisplatin-induced nephrotoxicity. Biomed Pharmacother. 2011;65(7):474–80.CrossRefPubMed
52.
Zurück zum Zitat Abdellatief SA, Galal AA, Farouk SM, Abdel-Daim MM. Ameliorative effect of parsley oil on cisplatin-induced hepato-cardiotoxicity: a biochemical, histopathological, and immunohistochemical study. Biomed Pharmacother. 2017;86:482–91.CrossRefPubMed Abdellatief SA, Galal AA, Farouk SM, Abdel-Daim MM. Ameliorative effect of parsley oil on cisplatin-induced hepato-cardiotoxicity: a biochemical, histopathological, and immunohistochemical study. Biomed Pharmacother. 2017;86:482–91.CrossRefPubMed
53.
Zurück zum Zitat Suchal K, Malik S, Khan SI, Malhotra RK, Goyal SN, Bhatia J, et al. Protective effect of mangiferin on myocardial ischemia-reperfusion injury in streptozotocin-induced diabetic rats: role of AGE-RAGE/MAPK pathways. Scientific Reports. 2017;7:42027.CrossRefPubMedPubMedCentral Suchal K, Malik S, Khan SI, Malhotra RK, Goyal SN, Bhatia J, et al. Protective effect of mangiferin on myocardial ischemia-reperfusion injury in streptozotocin-induced diabetic rats: role of AGE-RAGE/MAPK pathways. Scientific Reports. 2017;7:42027.CrossRefPubMedPubMedCentral
54.
Zurück zum Zitat Chowdhury S, Sinha K, Banerjee S, Sil PC. Taurine protects cisplatin induced cardiotoxicity by modulating inflammatory and endoplasmic reticulum stress responses. Biofactors. 2016;42(6):647–64.CrossRefPubMed Chowdhury S, Sinha K, Banerjee S, Sil PC. Taurine protects cisplatin induced cardiotoxicity by modulating inflammatory and endoplasmic reticulum stress responses. Biofactors. 2016;42(6):647–64.CrossRefPubMed
55.
Zurück zum Zitat Ramesh G, Reeves WB. Inflammatory cytokines in acute renal failure. Kidney Int Suppl. 2004;91:S56–61.CrossRef Ramesh G, Reeves WB. Inflammatory cytokines in acute renal failure. Kidney Int Suppl. 2004;91:S56–61.CrossRef
56.
Zurück zum Zitat Korkmaz A, Kolankaya D. Protective effect of rutin on the ischemia/reperfusion induced damage in rat kidney. J Surg res. 2010;164(2):309–15.CrossRefPubMed Korkmaz A, Kolankaya D. Protective effect of rutin on the ischemia/reperfusion induced damage in rat kidney. J Surg res. 2010;164(2):309–15.CrossRefPubMed
57.
Zurück zum Zitat Al-Rejaie SS, Abuohashish HM, Alkhamees OA, Aleisa AM, Alroujayee AS. Gender difference following high cholesterol diet induced renal injury and the protective role of rutin and ascorbic acid combination in Wistar albino rats. Lipids Health Dis. 2012;11:41.CrossRefPubMedPubMedCentral Al-Rejaie SS, Abuohashish HM, Alkhamees OA, Aleisa AM, Alroujayee AS. Gender difference following high cholesterol diet induced renal injury and the protective role of rutin and ascorbic acid combination in Wistar albino rats. Lipids Health Dis. 2012;11:41.CrossRefPubMedPubMedCentral
58.
Zurück zum Zitat Peng CC, Hsieh CL, Ker YB, Wang HY, Chen KC, Peng RY. Selected nutraceutic screening by therapeutic effects on doxorubicin-induced chronic kidney disease. Mol Nutr Food res. 2012;56(10):1541–58.CrossRefPubMed Peng CC, Hsieh CL, Ker YB, Wang HY, Chen KC, Peng RY. Selected nutraceutic screening by therapeutic effects on doxorubicin-induced chronic kidney disease. Mol Nutr Food res. 2012;56(10):1541–58.CrossRefPubMed
59.
60.
Zurück zum Zitat Rothe M, Wong SC, Henzel WJ, Goeddel DV. A novel family of putative signal transducers associated with the cytoplasmic domain of the 75 kDa tumor necrosis factor receptor. Cell. 1994;78(4):681–92.CrossRefPubMed Rothe M, Wong SC, Henzel WJ, Goeddel DV. A novel family of putative signal transducers associated with the cytoplasmic domain of the 75 kDa tumor necrosis factor receptor. Cell. 1994;78(4):681–92.CrossRefPubMed
61.
Zurück zum Zitat Hashem RM, Mohamed RH, Abo-El-matty DM. Effect of curcumin on TNFR2 and TRAF2 in unilateral ureteral obstruction in rats. Nutrition. 2016;32(4):478–85.CrossRefPubMed Hashem RM, Mohamed RH, Abo-El-matty DM. Effect of curcumin on TNFR2 and TRAF2 in unilateral ureteral obstruction in rats. Nutrition. 2016;32(4):478–85.CrossRefPubMed
62.
Zurück zum Zitat Yeh WC, Shahinian A, Speiser D, Kraunus J, Billia F, Wakeham A, et al. Early lethality, functional NF-kappaB activation, and increased sensitivity to TNF-induced cell death in TRAF2-deficient mice. Immunity. 1997;7(5):715–25.CrossRefPubMed Yeh WC, Shahinian A, Speiser D, Kraunus J, Billia F, Wakeham A, et al. Early lethality, functional NF-kappaB activation, and increased sensitivity to TNF-induced cell death in TRAF2-deficient mice. Immunity. 1997;7(5):715–25.CrossRefPubMed
63.
Zurück zum Zitat Uehara T, Yamate J, Torii M, Maruyama T. Comparative nephrotoxicity of Cisplatin and nedaplatin: mechanisms and histopathological characteristics. J Toxicol Pathol. 2011;24(2):87–94.CrossRefPubMedPubMedCentral Uehara T, Yamate J, Torii M, Maruyama T. Comparative nephrotoxicity of Cisplatin and nedaplatin: mechanisms and histopathological characteristics. J Toxicol Pathol. 2011;24(2):87–94.CrossRefPubMedPubMedCentral
64.
Zurück zum Zitat Weijun Wang HS, Che Y, Jiang X. Rasfonin promotes autophagy and apoptosis via upregulation of reactive oxygen species (ROS)/JNK pathway. An Int J Fungal Biol. 2016;7(2):64–73.CrossRef Weijun Wang HS, Che Y, Jiang X. Rasfonin promotes autophagy and apoptosis via upregulation of reactive oxygen species (ROS)/JNK pathway. An Int J Fungal Biol. 2016;7(2):64–73.CrossRef
65.
Zurück zum Zitat Tournier C, Dong C, Turner TK, Jones SN, Flavell RA, Davis RJ. MKK7 is an essential component of the JNK signal transduction pathway activated by proinflammatory cytokines. Genes dev. 2001;15(11):1419–26.CrossRefPubMedPubMedCentral Tournier C, Dong C, Turner TK, Jones SN, Flavell RA, Davis RJ. MKK7 is an essential component of the JNK signal transduction pathway activated by proinflammatory cytokines. Genes dev. 2001;15(11):1419–26.CrossRefPubMedPubMedCentral
66.
Zurück zum Zitat Hommes DW, Peppelenbosch MP, van Deventer SJ. Mitogen activated protein (MAP) kinase signal transduction pathways and novel anti-inflammatory targets. Gut. 2003;52(1):144–51.CrossRefPubMedPubMedCentral Hommes DW, Peppelenbosch MP, van Deventer SJ. Mitogen activated protein (MAP) kinase signal transduction pathways and novel anti-inflammatory targets. Gut. 2003;52(1):144–51.CrossRefPubMedPubMedCentral
67.
Zurück zum Zitat Cederbaum AI, Lu Y, Wang X, Wu D. Synergistic toxic interactions between CYP2E1, LPS/TNFalpha, and JNK/p38 MAP kinase and their implications in alcohol-induced liver injury. Adv exp med Biol. 2015;815:145–72.CrossRefPubMed Cederbaum AI, Lu Y, Wang X, Wu D. Synergistic toxic interactions between CYP2E1, LPS/TNFalpha, and JNK/p38 MAP kinase and their implications in alcohol-induced liver injury. Adv exp med Biol. 2015;815:145–72.CrossRefPubMed
68.
Zurück zum Zitat Mahran YF, Khalifa AE, El-Demerdash E. A comparative study of protective mechanisms of glycine and L-arginine against cisplatin-induced nephrotoxicity in rat renal cortical slices. Drug Discoveries Therapeutics. 2011;5(1):32–40.CrossRefPubMed Mahran YF, Khalifa AE, El-Demerdash E. A comparative study of protective mechanisms of glycine and L-arginine against cisplatin-induced nephrotoxicity in rat renal cortical slices. Drug Discoveries Therapeutics. 2011;5(1):32–40.CrossRefPubMed
69.
70.
Zurück zum Zitat Alam J, Subhan F, Ullah I, Shahid M, Ali G, Sewell RD. Synthetic and natural antioxidants attenuate cisplatin-induced vomiting. BMC Pharmacol Toxicol. 2017;18(1):4.CrossRefPubMedPubMedCentral Alam J, Subhan F, Ullah I, Shahid M, Ali G, Sewell RD. Synthetic and natural antioxidants attenuate cisplatin-induced vomiting. BMC Pharmacol Toxicol. 2017;18(1):4.CrossRefPubMedPubMedCentral
71.
Zurück zum Zitat Mundhe NA, Kumar P, Ahmed S, Jamdade V, Mundhe S, Lahkar M. Nordihydroguaiaretic acid ameliorates cisplatin induced nephrotoxicity and potentiates its anti-tumor activity in DMBA induced breast cancer in female Sprague-Dawley rats. Int Immunopharmacol. 2015;28(1):634–42.CrossRefPubMed Mundhe NA, Kumar P, Ahmed S, Jamdade V, Mundhe S, Lahkar M. Nordihydroguaiaretic acid ameliorates cisplatin induced nephrotoxicity and potentiates its anti-tumor activity in DMBA induced breast cancer in female Sprague-Dawley rats. Int Immunopharmacol. 2015;28(1):634–42.CrossRefPubMed
72.
Zurück zum Zitat Villani V, Zucchella C, Cristalli G, Galie E, Bianco F, Giannarelli D, et al. Vitamin E neuroprotection against cisplatin ototoxicity: preliminary results from a randomized, placebo-controlled trial. Head Neck. 2016;38(Suppl 1):E2118–21.CrossRefPubMed Villani V, Zucchella C, Cristalli G, Galie E, Bianco F, Giannarelli D, et al. Vitamin E neuroprotection against cisplatin ototoxicity: preliminary results from a randomized, placebo-controlled trial. Head Neck. 2016;38(Suppl 1):E2118–21.CrossRefPubMed
Metadaten
Titel
Protective effect of rutin supplementation against cisplatin-induced Nephrotoxicity in rats
verfasst von
Ali R. Alhoshani
Mohamed M. Hafez
Sufia Husain
Abdel Malek Al-sheikh
Moureq R. Alotaibi
Salim S. Al Rejaie
Musaad A. Alshammari
Mashal M. Almutairi
Othman A. Al-Shabanah
Publikationsdatum
01.12.2017
Verlag
BioMed Central
Erschienen in
BMC Nephrology / Ausgabe 1/2017
Elektronische ISSN: 1471-2369
DOI
https://doi.org/10.1186/s12882-017-0601-y

Weitere Artikel der Ausgabe 1/2017

BMC Nephrology 1/2017 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Notfall-TEP der Hüfte ist auch bei 90-Jährigen machbar

26.04.2024 Hüft-TEP Nachrichten

Ob bei einer Notfalloperation nach Schenkelhalsfraktur eine Hemiarthroplastik oder eine totale Endoprothese (TEP) eingebaut wird, sollte nicht allein vom Alter der Patientinnen und Patienten abhängen. Auch über 90-Jährige können von der TEP profitieren.

Niedriger diastolischer Blutdruck erhöht Risiko für schwere kardiovaskuläre Komplikationen

25.04.2024 Hypotonie Nachrichten

Wenn unter einer medikamentösen Hochdrucktherapie der diastolische Blutdruck in den Keller geht, steigt das Risiko für schwere kardiovaskuläre Ereignisse: Darauf deutet eine Sekundäranalyse der SPRINT-Studie hin.

Bei schweren Reaktionen auf Insektenstiche empfiehlt sich eine spezifische Immuntherapie

Insektenstiche sind bei Erwachsenen die häufigsten Auslöser einer Anaphylaxie. Einen wirksamen Schutz vor schweren anaphylaktischen Reaktionen bietet die allergenspezifische Immuntherapie. Jedoch kommt sie noch viel zu selten zum Einsatz.

Therapiestart mit Blutdrucksenkern erhöht Frakturrisiko

25.04.2024 Hypertonie Nachrichten

Beginnen ältere Männer im Pflegeheim eine Antihypertensiva-Therapie, dann ist die Frakturrate in den folgenden 30 Tagen mehr als verdoppelt. Besonders häufig stürzen Demenzkranke und Männer, die erstmals Blutdrucksenker nehmen. Dafür spricht eine Analyse unter US-Veteranen.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.