Background
Cisplatin (CP) is a chemotherapy commonly used in cancer treatment including head, neck, ovarian, and testicular cancers [
1,
2] but is associated with nephrotoxicity in 28–36% of patients receiving an initial dose (50–100 mg/m
2) of cisplatin [
3]. The accumulation of high concentrations of cisplatin in the kidneys caused nephrotoxicity [
4]. This serious complication is contributed to limiting its clinical use. The intermission of cisplatin remains the only choice in the case of progressive renal failure [
5]. Cisplatin-induced nephrotoxicity through apoptosis and necrosis [
6], vascular factors [
7], and inflammation of the tubules [
8]. The development of renal tubule injury is caused by the oxidative stress induced by cisplatin [
9‐
12]. The reactive oxygen species (ROS) and reactive nitrogen species (RNS) production [
13] alter the structure and function of cellular membranes [
14]. In addition to their accumulation in kidney and lysosomes [
15] explained the mechanisms for CP-induced acute nephropathy [
13]. Although numerous mechanisms for CP-induced nephrotoxicity such as mitochondrial dysfunction, inflammation, DNA damage, oxidative stress and apoptosis had been studied, the precise mechanism is not well understood [
16,
17]. Therefore, the free radical scavengers and the antioxidants agent can prevent cisplatin-induced nephrotoxicity.
Cisplatin damages the DNA resulting in apoptosis induction [
18]. In response to cisplatin, several signaling pathways, which can be activated by lipid peroxidation and oxidative stress, modulate the cell survival or apoptosis [
18,
19]. The mitogen-activated protein kinase (
MAPK) pathways regulate differentiation, proliferation, apoptosis and are activated by chemical and physical stresses [
20]. The three major
MAPK pathways terminate in
ERK,
p38, and
JNK/SAPK enzymes. Cisplatin is known to activate these three pathways in various cell lines including renal epithelial cells [
21,
22].
p38 MAPK was involved in inflammation, cell cycle regulation, and differentiation [
23] but its role in cancer therapy is not clear. Recently, some investigator suggests that
p38 MAPK is able to control the p53-mediated response to cisplatin [
24].
The interleukin-1
(IL-1) made up of 11 proteins encoded by 11 different genes [
25] and its main function, in response to tissue injury or damage, is to control the pro-inflammatory reactions [
26]. Activation of
IL-1 lead to activation of some genes such as Mitogen-activated protein kinase kinase 4 (
MKK4) and (
MKK7) which activate
JNK [
27,
28], and
MKK4,
MKK3, and
MKK6 activate
p38 MAPK [
29].
Flavonoids are a group of natural poly-phenolic compounds found in plants and have a variety of biological effects and play important role in detoxification of free radicals [
30]. Rutin is flavonoid glycosides that are present in herbs and plant foods and possessed different protective effects in vitro as well as in vivo [
31,
32] against lipid peroxidation and oxidative stress-mediated diseases [
33]. Rutin is an immuno-modulator and has anti-oxidant, anti-diarrheal, anti-tumor, and anti-inflammatory effect, myocardial protection, and has renal protective effects against the ischemia-reperfusion-induced renal injury [
34]. Therefore, this study investigated the possible protective effects of rutin against cisplatin-induced nephrotoxicity in rats.
Methods
Animals
The study was approved by the Research Ethics Committee of the College of Pharmacy, King Saud University. Male Wistar rats (230–260 g) were obtained from College of Pharmacy, King Saud University Animal Care Center and were kept under standard conditions of temperature (22 ± 1 °C), humidity (50–55%), and a 12-h light:/dark cycle. Food and water were freely available. All methods were conducted in accordance with the Guide for Care and Use of Laboratory Animals, Institute for Laboratory Animal Research, National Institute of Health (NIH publication No. 80–23; 1996).
Chemicals
Cisplatin (1 mg/ml sterile concentrate) was a gift from King Khalid University Hospital drug store, KSU, KSA. Rutin (CAS Number 207671-50-9) was purchased from Sigma Chemicals (Sigma-Aldrich Louis, MO, USA). Primers were designed using primer express 3 software (Applied Biosystem, Life Technologies, Grand Island, NY, USA) and Syber Green master mix kit (Cat#4309155) were purchased from Applied Biosystems (Life Technologies, Grand Island, NY, USA).
Experimental design
The experimental Design follows Kamel et al., [
3]. The rats were randomly divided into four groups (ten rats each) as follows: Group-I: intraperitoneal (i.p.) received saline (2.5 ml/kg) (normal control group). Group-II: i.p. received single dose 5 mg/kg cisplatin, (cisplatin group) [
35]. Group-III: orally received 30 mg/kg rutin dissolved in water for 14 days (Rutin group) [
36]. Group-IV: orally received 30 mg/kg rutin, dissolved in water for 14 days with a single dose of cisplatin (5 mg/kg, i.p.) on the tenth day.
All animals were weighted and were exposed to ether and were killed by decapitation 24 h after the last treatment. Blood samples were obtained and sera were separated. The kidney was immediately removed then washed with ice-cold saline solution. Parts of both kidneys were cut into small pieces for histopathological study and for the gene expression analysis.
Bioassays
Determination of blood urea nitrogen and serum creatinine
Blood urea nitrogen (BUN) was measured spectrophotometrically according to the methods of Tobacco et al. [
37]. In brief, serum was diluted 1:4 in normal saline and 5 μL of diluted serum and standard (in duplicate) were added to the microplate wells; then 150 μL of urease Mix solution was added to each well. The plate was incubated for 15 min under shaking at room temperature. Then 150 μL of Alkaline Hypochlorite was added to each well. After 10 min’ incubation at room temperature. Measure the absorbance of each sample in duplicate at 620 nm using microplate reader. The blood urea nitrogen concentration was calculated from stander curve. Serum creatinine was measured according to the methods of Fabiny and Ertingshausen [
38] in brief, 100 μl of serum samples and standard was mixed with picric acid (17.5 mmol/l final concentration)/sodium hydroxide solution (0.16 mol/l final concentration) after 30 s and 2 min later the absorbance of standard and sample were recorded. After that, the creatinine concertation was calculated by dividing the delta absorbance of the sample by delta absorbance of the control multiply by standard concentration.
Histopathology examination
The kidneys harvested from each groups were fixed in 10% neutral buffered formaldehyde. Tissues dehydration, clearing in xylene and paraffin embedding was done according to the standard method. Sections were cut by a rotary microtome at 5–7 μm thick, and were stained by haematoxylin and eosin and periodic acid schief (PAS). Sections were examined under a light microscope and findings documented by two certified histopathologists.
Estimation of Malondialdehyde of lipid peroxidation
Malondialdehyde (MDA) concentration in tissues was measured as it is the major product of membrane lipid peroxidation as a previously described method by Ohkawa et al., [
39]. The principle of this method depends on the formation of pink color resulted in reaction between MDA and thiobarbituric acid. This reaction producing a thiobarbituric acid reactive substance (TBARS), pink color, measured spectrophotometrically at 532 nm.
Estimation of (glutathione) GSH levels in kidney tissues
Glutathione concentration in 200 g kidney tissues homogenate was determined as previously described method by Sedlak and Lindsay [
40].
RNA extraction and Gene expression studies
Total RNAs were extracted from kidneys tissue by Trizol method according to the manufacturer’s protocol as previously described [
41]. The quantity was characterized using a UV spectrophotometer. The isolated RNA has an A 260/280 ratio of 1.9–2.1.
cDNA synthesis and real-time PCR methods
One microgram of total RNA was used to generate cDNA using a SuperScript™ first-strand synthesis system kit (Invitrogen, CA, USA), according to the manufacturer’s instructions. Real-time PCR was done using 2
-ΔΔCt
method according to our previous study [
42] and
GAPDH gene was used as internal control. All primers used in this study were synthesized in Jena Bioscience Germany and were listed in Table
1.
Table 1
Primers used in this study
JNK
| 5′-AAATAGAGCATCCCAGTCTTCGA-3′ | 5′-ACTGGGCCGCTGTTTCTG-3′ |
MKK4
| 5′- CATCGGGCCTCCAGCTT -3′ | 5′- AAATTCAACTTCAGGGCTTTGC -3′ |
MKK7
| 5′- AAGCTCTGTGACTTTGGCATCA -3′ | 5′- CAGCCAGCACTCCGTGTTT -3′ |
P38
| 5′-GGTTTTGGACTCGGATAAGAGGAT-3’ | 5′-GGGTCGTGGTACTGAGCAAAG-3’ |
TRAF2
| 5′-ACGCTGCCCGCAGAGA-3’ | 5′-TCTTTCAAGGTCCCCTTCCA-3’ |
TNF-α
| 5′-CGGGCTCAGAATTTCCAACA-3’ | 5′-CGCAATCCAGGCCACTACTT-3’ |
IL-1-α
| 5′-CATCCGTGGAGCTCTCTTTACA-3’ | 5′-TTAAATGAACGAAGTGAACAGTACAGATT-3’ |
GAPDH
| 5′-AACTCCCATTCCTCCACCTT-3’ | 5′-GAGGGCCTCTCTCTTGCTCT-3’ |
Statistical analysis
The data were analyzed using GraphPad Prism 5 (GraphPad Software, Inc., La Jolla, CA, USA). Statistical significance was evaluated by one-way analysis of variance (ANOVA) followed by the Tukey-Kramer multiple comparison tests. All data were expressed as mean ± SEM, n = 10. The value of P < 0.05 was considered statistically significant.
Discussion
Cisplatin is an anticancer drug used in the treatment of many types of cancer such as head and neck, lung, testis, ovary, and breast cancers [
1,
2]. Nephrotoxicity is the dose-limiting side effect of cisplatin [
43] such as acute kidney injury was found in about 20–30% of patients receiving CP [
44], Hypo-magnesemia in about 40–100% of patients [
45], Fanconi-like syndrome, distal renal tubular acidosis, hypo-calcemia, renal salt wasting and hyper-uricemia [
46].
Nephrotoxicity induced by CP is characterized by a reduction in renal function that leads to increasing in serum creatinine and blood urea levels [
47]. In the current study, creatinine and BUN serum levels were significantly high in CP-treated rats compared to untreated rats suggesting that CP produced nephrotoxicity as evidenced by the glomerular filtration rate reduction. The elevated serum creatinine and BUN levels induced by CP were significantly restored to their normal levels as in control group by rutin. The rutin protective effect against nephrotoxicity can be attributed to its antioxidant and anti-inflammatory effect on ROS and some cytokines may be involved in the glomerular filtration rate damage [
48]. Although the accurate mechanism of CP-induced nephrotoxicity is not well understood, previous study suggested that cisplatin interacts with DNA, through the formation of covalent adducts between certain DNA bases and the platinum compound leading to cell cytotoxicity [
49]. Other studies suggest that CP-induced ROS and immune response which are mediators of nephrotoxicity [
50‐
52]. In the present study, the MDA and GSH were measured as biomarkers for the oxidative stress. In the kidney tissue, the MDA level was significantly increased and GSH level was decreased by the effect of cisplatin. However, rutin administration caused significant decreases in lipid peroxidation and promoted increases in GSH content in the kidney. Therefore, rutin can protect the kidney from CP-induced injury via improvement in oxidant status. A similar study found that rutin pre-treatment attenuates renal inflammation and apoptosis induced by cisplatin through reducing TNF-α, NF
kB and caspase-3 levels [
18,
25].
The p38-MAPK stress pathway, stimulated with inflammatory cytokines such as TNF-α or IL-1, act as a key regulator of apoptosis in cells [
53]. The expression of the number of inflammatory cytokines and chemokines is increased in the kidney after cisplatin injury [
54]. In the present study, CP increased the expression levels of both
TNF-α or
IL1-α. Similarly, other study found that the single injection of cisplatin in mice induced nephrotoxicity. In the kidneys of cisplatin-treated mice, the nephrotoxicity caused up-regulation in
TNF-α, IL-1β, macrophage inflammatory protein-2 (
MIP-2), monocyte chemoattractant protein-1 (
MCP-1),
ICAM-1, and
TGF-β [
55].
The present study showed that the rutin supplementation improved the CP-induced increased in the expression levels of
IL-1 and
TNF-α that were in agreement with previous reports. Rutin acts as antioxidant and anti-inflammatory and improves renal abnormality induced by several factors or chemotherapeutic agents like doxorubicin or cisplatin [
56‐
58].
TNF-α induced by cisplatin is highly dependent upon the production of ROS, activation of
NFκB, and
p38 MAPK. However, the activation of
TNF-α and
IL-1 are involved in several signal transduction mechanisms, including the
NF
K
B and AP-1 pathways. In fact, the stress-activated group of MAPKs (
JNK and
p38) is strongly activated by
TNF-α and
IL-1 [
54]. This was in agreement with the present study in which single dose of CP increase the expression levels of
JNK and
P38. The activation of
JNK by
TNF-α mediated by the TNF receptor-associated factor (
TRAF) group of adapter proteins [
59].
In the current study, the overexpression of
TRAF2 as a result of cisplatin may be the cause of nephrotoxicity and apoptosis. The decrease in the expression level of
TRAF2 in kidney tissues after rutin supplementation in CP-treated rats suggests that rutin may protect against CP-induced nephrotoxicity by regulating apoptotic pathways. Activation of TNF receptors leads to recruitment of the
TRAF2 adapter protein [
60,
61]. The activation of the
TRAF2 expression is required for
JNK activation by
TNF [
62]. A study showed that in nephrotoxicity induced by chemotherapy, genes for
JNK play an essential role in modulating the pro- and anti-apoptotic proteins located in the mitochondria [
63].
JNK with ROS can promote apoptosis by inhibiting anti-apoptotic proteins [
64]. Also,
JNK can be activated through its phosphorylation by
MKK4 and
MKK7 at threonine, tyrosine.
MAPKKK activate both
MKK4 and
MKK7 protein kinases by dual phosphorylation at two sites in the T-loop [
65]. The
MKK7 protein kinase is primarily activated by cytokines (e.g
TNF-α and
IL-1) and
MKK4 is primarily activated by environmental stress [
66]. In the current study CP- induced the expression levels of
MKK4 and
MKK7 and these alterations attenuated by rutin supplementation in CP-treated rats. P38 MAPK is activated by
MKK3, MKK4 and
MKK6 [
67]. In the present study,
P38 expression levels were increased after a single dose of cisplatin. Similarly, several studies suggested that the inhibition of
p38 MAPK,
ERK or
JNK with specific pharmacologic or genetic inhibitors reduced inflammation and renal injury [
17,
68,
69].
Rutin administration in CP-treated rat restored the expression levels of
P38 and reduced the apoptosis. Therefore, cisplatin-induced nephrotoxicity can be ameliorated by free radical scavengers [
70], iron chelators [
71], superoxide dismutase [
48] and Vitamin E [
72].
Acknowledgments
Authors thank the Deanship of Scientific Research at KSU for funding this work through the research group project no. RGP-142.