Background
Hepatocellular carcinoma (HCC) is one of the most common malignant gastrointestinal tumors worldwide and is characterized by high morbidity and mortality rates [
1]. In China, annual HCC mortality rate ranks second in the total tumor mortality rates. It is noteworthy that the onset of the disease is often hidden and the condition progresses rapidly [
2]. Unfortunately, upon diagnosis, the majority of the patients are in advanced stages of the disease. Thus, early diagnosis is key in improving the HCC treatment and prognosis. Liver cancer screening in the clinic is typically based on the detection of serum alpha-fetoprotein and various imaging methods. However, the sensitivity and specificity of the serum alpha-fetoprotein (AFP) detection are limited. Moreover, imaging techniques are costly and the patients’ compliance is poor.
The circRNA is a type of non-coding RNA, which is widely present in many organisms, and exhibits a covalent closed loop structure [
3]. Studies have confirmed that circRNA is abundantly expressed, stable, and conservative, and displays specificity in different species, diseases, tissues, and developmental stages. Considering the unique molecular biological characteristics, circRNA secreted into human circulating blood can be used as a biomarker for disease diagnosis [
4]. In recent years, a number of studies have indicated that circRNA plays vital roles in tumorigenesis and progression of HCC, and could be used as a diagnostic biomarker. For example, hsa_circ_0001445 has been shown to inhibit the proliferation, migration, and invasion of HCC cells. It also promotes apoptosis, and thus, serves as a useful diagnostic biomarker [
5]. Nonetheless, the role of multiple circRNAs in the diagnosis of patients with HCC remains largely unknown.
In the present study, we identified a number of differentially expressed circRNAs (DECs) in blood with HCC. The increased expression levels of hsa_circ_0004001, hsa_circ_0004123, and hsa_circ_0075792 were verified utilizing quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analysis. The expression of the three circRNAs was positively correlated with the TNM stage and tumor size. In addition, the combination of hsa_circ_0004001, hsa_circ_0004123, and hsa_circ_0075792 can be used as a new biomarker for the diagnosis of patients with HCC.
Methods
The circRNA expression data
The circRNA expression profiles, which included 21 HCC and 32 normal blood samples, were obtained from the exoRBase (
http://www.exorbase.org/exoRBase/toIndex) database [
6]. The expression matrix was preprocessed using the following exclusion criteria: (1) circRNA names were not integrated; and (2) circRNAs with an expression level of “0” were more than half, with 53 samples in total. Finally, a total of 857 circRNAs, which had proper expression data, were included for further analysis.
Identification of DECs
The 32 healthy blood samples were tested as the normal group. At the cutoff criteria of P < 0.05 and fold-change (FC) > 2.0, the DECs in 21 HCC blood samples were identified utilizing the limma package in the R software.
Serum samples
The study enrolled 71 patients diagnosed with HCC at Shengjing Hospital of the China Medical University. Forty healthy individuals were enrolled as controls. Fasting venous blood samples were collected, and none of the patients received any treatment prior to collection. Ethylenediamine tetraacetic acid was added for anticoagulation, and all samples were centrifuged at 1600×g for 10 min at 4 °C. Following high-speed centrifugation at 12,000×g for 10 min, the plasma was separated and stored at – 80 °C until needed. The present study was conducted with the approval of the ethics review committee of the Shengjing Hospital of China Medical University (No.: 2018PS362K), and all of the research participants signed informed consent form.
RNA isolation and quantitative reverse transcription-polymerase chain reaction (qRT-PCR)
Eight hundred μL of the TRIzol
® reagent (Invitrogen, Carlsbad, CA, USA) was added to each 200 μL blood sample, and the extraction procedure described in the manufacturer’s instructions was followed. The nucleic acid OD260/OD280 ratio was determined using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The values obtained for the samples were in the range of 1.8–2.0. The synthesis of cDNA and the qRT-PCR reactions were conducted using a reverse transcription kit, as well as the SYBR fluorescence quantitative kit (TaKaRa, Shiga, Japan). The reaction system was 20 μL in volume and consisted of 10 μL of SYBR Premix Ex Taq, 0.5 μL of cDNA, 0.5 μL of upstream and downstream primers, 0.5 μL of ROX, and 8 μL of ddH
2O. The primers for target circRNAs and the internal reference GAPDH are listed in Table
1. All steps were conducted according to the manufacturer’s instructions. The relative gene expression was quantified using the 2
−∆∆ct method.
Table 1The primer sequences for qRT-PCR
hsa_circ_0004001 |
Forward | ACGAACATCACAGTACATTGGT |
Reverse | GGCTTTAAGTCTGTGTGAGTCA |
hsa_circ_0004123 |
Forward | CTGTCTCCCCGCCTGAAG |
Reverse | TGGTGCACATTATCCACGGA |
hsa_circ_0075792 |
Forward | GTGTTCTATGACATGGATCCCC |
Reverse | TCTTCTCTGACAACGGTGGA |
GAPDH |
Forward | AGCCACATCGCTCAGACAC |
Reverse | GCCCAATACGACCAAATCC |
Target miRNAs prediction of circRNA and functional enrichment analysis
To further explore the molecular mechanism of circRNAs, the online Circular RNA Interactome [
7] tool was used to predict the downstream targeted regulatory miRNAs of hsa_circ_0004001, hsa_circ_0004123, and hsa_circ_0075792. FunRich v2.0 (
http://funrich.org) [
8], which is a common gene biological pathways enrichment analysis software, was used for investigating the potential signaling pathways of targeted miRNAs.
Statistical analysis
The paired and unpaired t-tests were conducted for group comparisons. The comparisons of gene expression and patient clinical features were conducted by Chi square test. The receiver operating characteristic (ROC) curve and the corresponding area under the curve (AUC) were determined for individual and combined circRNAs. All statistical analyses were performed using SPSS version 20.0 (SPSS Inc., Chicago, IL, USA), and the data were considered statistically significant when P < 0.05.
Discussion
HCC is the most important pathological type of primary liver cancer. It is characterized by strong invasiveness, high malignancy, and poor prognosis. In China, the mortality rate associated with HCC ranks second among malignant tumors of the digestive system, and is second only to gastric cancer [
9]. At present, the most effective way to treat liver cancer is to perform immediate radical resection. Thus, the key to improving the available liver cancer treatment is to increase the early diagnosis rate.
CircRNA was first found in plant-like viruses in 1976, when it was considered to be a product of miss-splicing and did not receive any significant attention [
10]. With the development of high-throughput sequencing technology in recent years, circRNA has been found to form as a result of human gene transcription. This finding has led to more in-depth studies concerning circRNAs [
11]. An increasing number of studies have shown that circRNAs play important roles in numerous human diseases, particularly in the process of tumor development. CircRNAs can function at the level of gene transcription and translation [
12,
13]. For example, circRNA competitively attenuates the inhibitory effect of miRNA on downstream target genes by acting as a miRNA “sponge” [
14]. Huang et al. found that circRNA-100338 is involved in activating the mTOR signaling pathway through the circRNA-100338/miR-141-3p/RHEB axis to promote HCC cell proliferation [
15]. Moreover, in breast cancer, circRNA_002502 regulates the sensitivity and tumor progression of the antitumor drug, tamoxifen, via the miR-182-5p/FOXO3a axis [
16]. These outcomes confirmed the crucial role of circRNA in tumorigenesis and development. In addition, multiple studies have determined that circRNA can be utilized as a diagnostic marker for tumors. Wei et al. found that circRNA_102958 was significantly upregulated in gastric cancer, and its AUC value was 0.74, making it a useful molecular marker for gastric cancer diagnosis [
17]. Moreover, circRNA hsa_circ_0091579 has previously been established as a biomarker for the diagnosis and prognosis of HCC [
18].
In the present study, we downloaded the RNA-Seq data for circRNA from HCC blood samples in the exoRBase database. The exoRBase database stores RNA-Seq of circRNA, lncRNA, and mRNA in blood exosomes from various human diseases, as well as published experimental data [
19]. The database stores 21 HCC blood samples and 32 normal human blood samples. The sample size and the types of circRNAs sequenced are large, providing strong evidence for the results of our study. Following screening, seven circRNAs with up-regulated expression and five circRNAs with down-regulated expression were found in the HCC blood samples.
To further explore the diagnostic role of up-regulated circRNA in HCC, we conducted ROC curve analysis. The results demonstrated that hsa_circ_0004001, hsa_circ_0004123, and hsa_circ_0075792 exhibited higher diagnostic sensitivity and specificity, and the AUC values of all three were greater than 0.7. The qRT-PCR verification experiments also showed that hsa_circ_0004001, hsa_circ_0004123, and hsa_circ_0075792 were significantly higher in the plasma of liver cancer patients, when compared with those of the healthy group. At present, serum AFP is the preferred diagnostic marker for primary liver cancer. However, various studies have shown that there is a possibility of false negative diagnosis using serum AFP; thus, this technique is characterized by poor diagnostic sensitivity and specificity [
20]. Previous research has found that has_circ_0000745 combined with carcinoembryonic antigen detection is more accurate in the early diagnosis of gastric cancer [
21]. This implies that the combined detection of multiple biomarkers has great advantages in tumor diagnosis. Consequently, the present study further investigated the role of the above three circRNAs in the diagnosis of hepatocellular carcinoma. We found that the combination of the three circRNAs notably improved the diagnostic sensitivity and specificity of a single marker, with an AUC value of 0.885. Although numerous studies have described the importance of circRNA in the diagnosis of HCC, the majority of the approaches involve single-markers [
22,
23]. Conversely, we screened and identified three circRNAs as combined markers with high diagnostic sensitivity and specificity.
Further exploration of the downstream regulatory mechanism of circRNA revealed that hsa_circ_0004001, hsa_circ_0004123, and hsa_circ_0075792 regulated 35 target miRNAs, and participated in key biological signaling pathways, such as VEGF/VEGFR, PI3K/Akt, mTOR, and Wnt. Zhang et al. found that miRNA-146a inhibits distant metastasis of hepatocellular carcinoma by downregulating VEGF expression through multiple pathways [
24]. Furthermore, recent research showed that elongation factor 2 kinase promotes angiogenesis in HCC through the PI3K/Akt signaling pathway [
25]. However, Ma et al. confirmed that silencing lncRNA HEIH inhibited liver cancer cell proliferation and metastasis through the miR-199a-3p/mTOR axis [
26]. The above observations imply that hsa_circ_0004001, hsa_circ_0004123, and hsa_circ_0075792 possibly affect the occurrence and progression of HCC through a variety of tumor-related signaling pathways, providing a theoretical basis and research direction for further exploration of its mechanism of action. However, there are also some limitations in the study design. The present study only comfirmed the expression level of the three circRNAs in HCC and explored their potential molecular function in silico. In the future study, we would investigate the accurate biological roles of circRNAs in vitro and in vivo to obtain more conclusive evidences.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.