Ovarian cancer is a disease with increasing incidence worldwide, and there is an urgent need for chemotherapy and biological targeted therapy. Epithelial-mesenchymal transformation (EMT) is an important initiation stage for tumor cells to acquire the ability to invade and metastasize. A growing number of findings suggest that human Schlafen family member 5(SLFN5) plays a key role in malignancy. However, the role of SLFN5 in ovarian cancer cells has not been fully elucidated. Samples were collected from patients with ovarian cancer diagnosed in Hangzhou First People's Hospital, and the expression of SLFN5 was detected by fluorescence quantitative PCR. The relationship between SLFN5 expression and the progression and malignancy of ovarian cancer was analyzed by using the expression profile data from the Cancer Genome Atlas (TCGA) database. The mRNA expression levels of SLFN5 related upstream and downstream signaling pathways were studied by fluorescence quantitative PCR. Silencing SLFN5 was performed by siRNA transfection. The expression of SLFN5 and transfer-related proteins was examined by Western blot. Transwell and wound healing experiments investigated the migration and invasion ability of ovarian cancer cells. TCGA database analysis results showed that in the population with high SLFN5 expression, compared with the group with low SLFN5 expression, OS was worse (P = 0.011). SLFN5 silencing had a significant inhibitory effect on EMT and invasion movement of ovarian cancer cells. RT-PCR method was used to detect the mRNA changes of SLFN5 in ovarian cancer tissue and adjacent tissue. It was found that the expression of SLFN5 in ovarian cancer tissue was increased, with a significant difference (P < 0.05). Together, these results suggest that SLFN5 may play a synergistic role in tumorigenesis and development of ovarian cancer cells, providing a potential target for future drug development for the treatment of ovarian cancer.
Hinweise
Qiao Ping Xu and Kui Deng contributed equally to this work.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Introduction
Ovarian cancer is one of the leading causes of cancer-related deaths in females and currently ranks fifth in causing cancer-related deaths among women. Based on a recent statistic, there are 22,280 newly diagnosed cases of ovarian cancer in the United States each year, among which 15,500 are estimated to die each year [1]. Most tumour-related deaths in patients suffering from solid tumours are not due to the primary tumour but rather to metastasis or invasion. Most patients with ovarian cancer are diagnosed at terminal stages, and this cancer type features high invasiveness [2].
The major reason for the high death rate is the widely metastatic spread predominantly in the abdomen [3, 4]. Epithelial-mesenchymal transition (EMT) is a major process for the conversion of early-stage ovarian tumours to invasive and metastatic malignancies, promoting the aggressiveness of ovarian cancers, due to the loss of epithelial characteristics and acquisition of mesenchymal characteristics [5]. Therefore, EMT is described as critical event in cancer progression and metastasis [6], and has drawn much attention in ovarian cancer metastasis research [7]. EMT is generally induced by developmental signalling pathways, most notably, the TGF-β pathway is regarded as a primary inducer of EMT [6, 8].
Anzeige
The mouse SLFN family has been implicated in various physiological or pathological processes, including T-cell activation, thymocyte maturation, fifibroblast and tumour cell proliferation [9‐12]. However, the human SLFN family has not been extensively studied, with the exception of SLFN11, which is capable of suppressing HIV replication, and positively correlates with the effect of topoisome rase inhibitors on human cancer cells [13‐15]. There are very few studies on human SLFN5, and the results are inconsistent. For example, human SLFN5 is found at a low level in melanoma and renal cell carcinoma, and plays inhibitory roles in tumour invasion [16, 17]. In contrast, a pro-tumorigenic role for SLFN5 has been suggested in glioblastoma, where it acts as a co-repressor with signal transducer and activator of transcription 1(STAT1) in interferon-mediated responses [18]. SLFN5 is both an IFN-stimulated response gene and a repressor of IFN-gene transcription, suggesting the existence of a negative-feedback regulatory loop that may account for suppression of antitumor immune responses in glioblastoma. Wan et al. [19], firstly report that SLFN5 inhibits cancer migration and invasiveness in several common cancer cell lines by repressing MT1-MMP expression via the AKT/GSK-3β/β-catenin signalling pathway, suggesting that SLFN5 plays wide inhibitory roles in various cancers. Taken together, these results suggest that the role of SLFN5 in cancer progression might be context dependent.
The role of SLFN family in immune regulation and immune cell proliferation and differentiation is closely related to a variety of autoimmune diseases [20]. Given that tumors can be considered a state of immunodeficiency or immune dysregulation, it can be inferred that SLFN family proteins may also play an important role in tumor immunity. For instance, studies have shown that certain SLFN family protein such as SLFN5 which can inhibit the growth and invasion of cancer cells and promote cancer cells sensitivity to chemotherapeutics in some malignant tumors [21, 22]. SLFN5 is widely expressed in normal melanocytes, renal cells, ovary cells, as well as their cancer counterparts [23]. Although the basal expression is low in normal cells, the RNA and protein levels of SLFN5 change dramatically when malignant transformation occurs [24]. However, the role of SLFN5 in ovarian cancer is still not yet completely determined.
The objection of this project was to explore the biological functions of SLFN5 in human ovarian cancer both in vivo and in vitro, to identify the molecular target of SLFN5 in HO-8910 and SKOV3 cell lines and to uncover the potential mechanism of SLFN5 which promotes ovarian cancer development, in an attempt to provide a novel perspective and the oretical basis for clinical early diagnosis and therapy of ovarian cancer.
Materials and methods
Data sources
The RNA-seq data for ovarian cancer patients was obtained from The Cancer Genome Atlas (TCGA), and downloaded from xena hubs https://tcga.xenahubs.net. Epithelial-mesenchymal transition (EMT) status was defined by Da Yang et al. [25]. Among 341 ovarian cancer patients in TCGA, 324 has EMT status, and patient characteristics was shown in Table 1.
Anzeige
Table 1
Clinical characteristics of study patients
All of data
EMT Data
Case Load
341
324
Neoplasm staging
Early phase
29 (8.6)
24 (7.5)
Later phase
310 (91.4)
298 (92.5)
TNM stage
G1&G2
68 (20.4)
67 (21.1)
G3&G4
265 (79.6)
251 (78.9)
Age
58.80 ± 11.13
58.73 ± 11.12
EMT
Epithelium
178 (54.9)
178 (54.9)
Mesenchyme
146 (45.1)
146 (45.1)
Identification of survival-related genes
The difference of SLFN5 expression between EMT status was detected by t test and the analysis of covariance, and the latter was used to adjust for several confounding factors, such as age, stage and grade in this study. The expression of SLFN5 was divided into high-expression and low-expression groups based on the first quartile (25th quantile). The overall survival (OS) curves of two groups were estimated using Kaplan–Meier method and compared by log-rank test [26]. Multivariate Cox proportional hazards model was used to explore the independent effect of SLFN5 expression on OS, which adjusted for confounding effects of age, stage and grade.
The co-expression genes of SLFN5 were identified using Spearman correlation, and false discovery rate (FDR) method was used to adjust for multiple comparisons [27]. Genes with absolute correlation coefficients≧0.4 and FDR q value < 0.001 were identified as co-expression genes of SLFN5. The biological functions of these co-expression genes were explored using Gene Ontology (GO) enrichment analysis [28] and significant GO items were selected based on FDR q value < 0.05.
Immune cells were inferred from the TCGA RNA-seq data using CIBERSORT algorithm [29], and 22 distinct immune cells were obtained. Patients with P value less than 0.05 were excluded from the study. Immune cells with the proportion of zero value larger than 0.5 were also excluded, and 13 immune cells were retained in the following analyses. The distribution differences of immune cells between high-expression and low-expression SLFN5 groups were detected using Wilcoxon rank sum test. All statistical analyses in this study were performed on R platform (Version: 3.6.0).
Tissue samples and ethical considerations. Tissue samples
A total of 27 human ovarian cancer tissues were obtained from patients who had surgery in the Affiliated Hangzhou First People’s Hospital of ZheJiang University School of Medicine from 2019 to 2022, and patients’ clinical data were obtained afterwards. All cases were included post review by pathologist and only where complete clinical and follow-up data was available. None of the 27 included patients underwent pre-operative local or systemic treatment. The study protocol was approved by the Institutional Review Board of the Hangzhou First People’s Hospital in China. Freshly harvested samples were immersed in RNAlater (Life Technologies, Shanghai, China) before snap freezing within 30 min post-surgery. All tissue samples were stored in liquid nitrogen until further use.
No patient had received chemotherapy before surgery. Four histological subtypes were included into the panel (serous (n = 14), endometrioid (n = 7), clear cell (n = 4), and mucinous (n = 2)). TNM classification (T = tumor, N = lymph nodes, M = metastasis) was performed according to the Union for International Cancer Control (UICC). Lymph node involvement (N0 (n = 11), N1 (n = 16) and distant metastasis M0 (n = 9), M1 (n = 18) was evaluated. FIGO stage was determined (I, II (n = 9), III,IV (n = 18)) according to the criteria of the International Federation of Gynecology and Obstetrics (FIGO). Median patients’ age was 62 ± 12 years with a range between 31 and 88 years. During the study 0 deaths have been observed (The data was shown in Table 2).
Table 2
Correlation between SLFN5 expression and pathological parameters in ovarian carcinoma patients
Factors
Cases
Low SLFN5 n(%)
High SLFN5 n(%)
P-value
Age at diagnosis(y)
NS
≦52
13
7 (53.8%)
6 (46.2%)
> 52
14
5 (35.7%)
9 (64.3%)
FIGO stage
< 0.05
I and II
9
2 (22.2%)
7 (78%)
III and IV
18
5 (27.8%)
13 (72.2%)
Lymph node metastasis
NS
pN0/pNX
11
6 (54.5%)
5 (45.5%)
pN1
16
6 (37.5%)
10 (62.5%)
Distant Metastasis
< 0.05
pM0/pMX
9
3 (33.3%)
6 (66.7%)
pM1
18
4 (22.2%)
14 (77.8%)
Histology
NS
Serous
14
5 (45.45%)
9 (56.25%)
Clear cell
4
1 (25%)
3 (75%)
Endometrioid
7
2 (28.56%)
5 (71.5%)
Mucinous
2
1 (50%)
1 (50%)
TNM staging was accomplished according to the Union for International Cancer Control (UICC), pT1 tumor stage 1, pT2 + tumor stage 2 or higher, pN0 lymph node stage 0, pNX lymph node stage not evaluated, pN1 lymph node stage 1, pM0 distant metastasis stage 0, pMX distant metastasis not evaluated, pM1 distant metastasis stage 1, G1 grade 1, G2 + grade 2 or higher, NS Not significant (p > 0.05)
Ethical considerations
A total of 27 human ovarian cancer tissues were obtained from patients who had surgery in the Affiliated Hangzhou First People’s Hospital of ZheJiang University School of Medicine from 2019 to 2021, and patients’ clinical data were obtained afterwards. The classification of clinical staging and histological grading of ovarian cancer were determined according to the FIGO 2014 system. Approval from the research ethics committee was obtained prior to the study. In addition, written informed consent from the patients were obtained before experiment for the use of their samples.
Cell culture and treatment
Four human ovarian cancer cell lines (SKOV3, A2780, OVCAR3, HO8910), normal epithelial ovarian cells (IOSE80) were purchased from the cell bank of China Academic of Science. The SKOV3 cells were cultured in McCoy’s 5A Media (modified with tricine) supplemented with 10% fetal bovine serum (FBS). The OVCAR3 and IOSE80 cell lines were maintained in 90% RPMI 1640 with 10% FBS, and the OVCAR3 cells were cultured in 80% RPMI 1640 with 20% FBS, sodium pyruvate, and 0.01 mg/ml bovine insulin. All the cell lines were cultured in an atmosphere of 5% CO2 and 95% air at 37 °C.
Anzeige
Pathway enrichment analysis and literature search
Text mining was performed for the overlapping genes using Perl code. The published genes that were closely related with ovarian cancer were searched in the PubMed database. In addition, the overlapping genes were subjected to the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis using the Database for Annotation, Visualization and Integrated Discovery (DAVID) online tool. Pathways with p < 0.05 and counts ≥ 2 were considered significant.
RNA extraction and quantitative real time polymerase chain reaction(qRT-PCR)
Total RNA was extracted from cells using the RNA iso Plus (Trizol) reagent (TaKaRa, Japan) and cDNA was synthesized using the PrimeScript™RT Master Mix(Perfect Real Time) kit (TAKARA, Japan) according to the manufacturer’s instructions. Real-time PCR was performed to evaluate the expression levels of SLFN5,SNAIL,SLUG,E-cadherin,N-cadherin,GAPDH in tumor cells. A total of 8 μl of cDNA was used as template in a final 20 μl PCR volume containing 1 μl forward primer,1 μl reverse primer, and 10 μl SYBR Premix EX Taq (2x). PCRs were run as follows: 50.0 °C for 3 min, 95.0 °C for 3 min, followed by 40 cycles of 95.0 °C for 10 s and 60.0 °C for 30 s. Following PCR, a melting curve was obtained at temperatures from 60 °C to 95 °C, at increments of 0.5 °C for 10 s. Primer sequences are listed in Table 3.
Table 3
The primer sequences in PCR analysis
Symbol
Sequences(5’-3)
SLFN5-hF
GAGGATCCCCGGGTACCGGTCGCCACCATGGGCAGCGACCCGAGCG
SLFN5-hR
TCCTTGTAGTCCATACCGACCCACTCCTGCAGCGAGCG
E-cadherin-hF
GCGTCCTGGCAGAGTGAATTTT
E-cadherin-hR
GGCCTTTTGACTGTAATCACAAA
N-cadherin-hF
ATCCTACTGGACGGTTCG
N-cadherin-hR
TTGGCTAATGGCACTTGA
SNAIL-hF
TCGGAAGCCTAACTACAGCGA
SNAIL-hR
AGATGAGCATTGGCAGCGAG
SLUG-hF
AAGCATTTCAACGCCTCCAAA
SLUG-hR
GGATCTCTGGTTGTGGTATGACA
FN(Fibronectin)-hF
CCATCGCAAACCGCTGCCAT
FN(Fibronectin)-hR
CCATCGCAAACCGCTGCCAT
GAPDH-hF
TGACAACTTTGGTATCGTGGAAGG
GAPDH-hR
AGGCAGGGATGATGTTCTGGAGAG
Transfection of siRNA SLFN5 siRNAs (Genechem, Shanghai, China) were used to downregulate SLFN5 expression. The two siRNA sequences were shown below:
SKOV3 cells、OVCAR3 cells、HO8910 cells、A2780 cells were transfected with SLFN5 siRNAs with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). Four to six hours post transfection, the cell culture medium was changed. After 48 h of transfection, SKOV3 cells were used for further examination.
Anzeige
Cell Invasion Assay(transwell)
For invasion assays, before seeding cells, 60 μl of Matrigel (BD Biosciences, San Diego, CA, USA) was placed on the upper surface of the 24-well transwell chamber (Corning, New York, USA). Cells (104) in 100 μl of RPMI 1640 medium were seeded in the upper chamber, and the lower chamber was filled with 600 μl of medium with 20% FBS. Twenty-four hours after incubation, cells were remaining on the upper surface which were removed using a cotton swab, while the invaded cells were fixed, stained and photographed. Five random fields of cells were selected and counted for further calculation.
Wound healing assay
OC cells were transfected with SLFN5-siRNA or treated with TGF-β1 and wound healing assay was performed as described previously [30]. Briefly, highly confluent OC cells were serum starved and the wound was made through the cell monolayer using a 200 µL pipette tip. Following this, the cells were washed twice with 1X PBS to remove the non-adherent cells. The cells were then treated with TGF-β1 or transfected with SLFN5-siRNA (as mentioned) in a fresh serum-free medium. The cells were allowed to migrate for 48 h. Wound closure was monitored by visual examination and imaged every 24 h under microscope (EVOS, Invitrogen). The experiment was repeated twice.
Cell lysis and Western blot
Cells were lysed with RIPA buffer (Beyotime, Shanghai, China) to obtain total protein. Then, 30–50 μg of protein was separated in 10% SDS/PAGE gels and transferred to PVDF membranes, which were blocked with 5% fat-free milk. The membranes were then incubated overnight at 4℃ with a primary antibody and incubated at room temperature for one hour with a secondary antibody conjugated with horseradish peroxidase. In the end, the protein bands were examined with chemiluminescence assay.
Cell colony formation assay
Cells (600 cells/well)were seeded into 6-well plates with DMEM medium supplemented with 10% FBS and cultured for 14 days. Then, colonies were fixed with methanol at room temperature for 15 min and stained with 0.1% crystal violet for 15 min (Invitrogen, Carlsbad, CA), and the total number of visible colonies were counted.
Anzeige
Statistical analyses
SPSS 16.0 (IBM, USA) was used for the statistical analyses. Continuous data was expressed as the mean ± SD, and analysed by independent t-test between two groups. Among multiple groups, one-way ANOVA was applied, and Turkey test was applied as a post hoc test. The categorical data were compared via the Chi-squared or Fisher’s exact tests as appropriate. A p value < 0.05 was regarded as statistically significant.
Results
Identifying candidate genes significantly associated with survival of EOC related with SLFN5
To identify the candidate genes with prognostic value in ovarian cancer, we downloaded the gene expression profiles from the TCGA, which was followed by screening of DEGs and text mining. Overall, we screened 20,530 genes related with prognosis from TCGA dataset respectively. After Venn diagram analysis, 122 overlapping genes were identified as candidate genes related to EOC progression. After text mining, a total of 12 genes were found to be associated with EOC which are coexpression with SLFN5 (Table 4). GO pathway analyses showed that the translational initiation pathway(GO:0,006,413)was the most significant pathway involvedwithFAU,RBM4,POLR2G,NLRP3,TLR1,TLR6,TLR2,MRPL33,MRPS16,MRPL12,MRPL11,MRPL21,CHCHD1 (Table 5). Among the positive regulation of interleukin-6 production: PTAFR,LGALS9,TLR1,TLR6,TLR2 have been reported to be associated with ovarain cancer. Among the Mitochondrial translational pathway-related genes, MRPS16,MRPL12,MRPL11,MRPL21,CHCHD1 have been reported to be associated with ovarian cancer (such as GO0070124、GO0070125、GO0070126、GO:0032543).
Table 4
Text mining analysis for 12 genes in PubMed dataset which was the co-expression genes of SLFN5
GO:0032490:Detection of molecule of acterial origin
3
TLR1,TLR6,TLR2
0.00243
GO:0032635:Interleukin-6 production
6
GSTP1,ASH1L,PTAFR,TLR1,TLR6,TLR2
0.00373
GO:0002674:Negative regulation of acute inflammatory response
3
GSTP1,ASSH1L,NLRP3
0.00393
GO:0032755:Positive regulation of interleukin-6 production
5
PTAFR,LGALS9,TLR1,TLR6,TLR2
0.00417
GO:0032543:Mitochondrial translation
6
MRPL33,MRPS16,MRPL12,MRPL11,MRPL21,CHCHD1
0.00585
The differentially expression of SLFN5 between EMT status in ovarian cancer
The expression of SLFN5 was differentially expressed between EMT status (P = 0.0012; Fig. 1A). After adjusting for the confounding effects of age, stage, and grade, the difference of SLFN5 expression between EMT status was still statistically significant (P = 0.014). Kaplan–Meier analysis indicated that patients in high-expression group of SLFN5 had statistically worse OS than those in low-expression group (P = 0.011; Fig. 1B). Multivariate Cox model showed that the prognostic effect of SLFN5 was still statistically significant after including age, stage, and grade in the model (P = 0.0102; Fig. 1C).
Fig. 1
The differentially expression of SLFN5 between EMT status. A The distribution of SLFN5 expression between EMT status. B Kaplan–Meier analysis of patients with high-expression and low-expression SLFN5. C Multivariate analysis for the effect of SLFN5 on OS
×
Expression and regulation of SLFN5 in primary human monocytes, monocyte-derived dendritic cells and T cells
The co-expression genes of SLFN5 were showed in Table 4. based on absolute correlation coefficients ≥ 0.4 and FDR q value < 0.001. Go enrichment analysis indicated that these co-expression genes were associated with mitochondrial translation and interleukin-6 (IL-6) production (Fig. 2A-B). As IL-6 plays an important role in immune microenvironment, we speculated that the function of SLFN5 in EMT process was mainly determined by immune cells. Therefore, we explored the distribution differences of immune cells between high-expression and low-expression SLFN5 groups. As shown in Fig. 2C, the distributions of T cells follicular helper, T cells regulatory tregs, and M2 macrophages were different between high-expression and low-expression SLFN5 groups (P < 0.05). The proportions of T cells regulatory tregs and M2 macrophages were significantly higher in high-expression SLFN5 group than in low-expression group, while the proportions of T cells follicular helper were significantly lower in high-expression SLFN5 group compared with those in low-expression SLFN5 group.
Fig. 2
Expression and regulation of SLFN5 in primary human monocytes, monocyte-derived dendritic cells and T cells. A The result of GO enrichment analysis (showing pathways); B The result of GO enrichment analysis (showing pathways and genes); C The distribution of immunes cells between high-expression and low-expression SLFN5 groups
×
SLFN5 upregulation is correlated with advanced stages and metastasis in ovarian cancer and predicts the poor prognosis in patients with high-grade serous carcinoma
Since no evidence had been found on the role of SLFN5 in ovarian cancer, we first determined its clinical implication by comparing the expression of SLFN5 in both cancerous and non-cancerous ovarian tissues. SLFN5 was markedly upregulated in ovarian cancer tissues (Fig. 3A, B and C). Consistently, SLFN5 was also found to be significantly increased in the 21 ovarian cancer patients samples (Fig. 3 C). The Kaplan–Meier survival analysis showed that high level of SLFN5 is significantly associated with weak overall survival in ovarian cancer (Fig. 3D, P = 0.0076), which is consistent with the result from the TCGA ovarian cancer cohort. Additionally, high level of SLFN5 was moderately, but not significantly, correlated with bad progress-free survival (PFS) (Fig. 3E), probably due to the limited sample size. Therefore, these observations indicate that SLFN5 is a favorable prognostic marker that may promote ovarian tumorigenesis and progression.
Fig. 3
Frequent upregulation of SLFN5 in human epithelial ovarian cancer. A-B Expression of SLFN5 in cancerous and normal ovarian tissues detected by WB. C. Expression of SLFN5 in cancerous and normal ovarian tissues analyzed by RT-PCR. D SLFN5 upregulation is significantly associated with shorter overall survival in epithelial ovarian cancer patients. E No significant correlation is observed between SLFN5 expression and progression-free survival
×
SLFN5 endorses ovarian cancer development as an oncogenic protein.Although SLFN5 was found to be involved in the development of several cancers [16‐19], it remains largely elusive if the protein is required for ovarian cancer cell survival and growth. We then analyzed SLFN5 expression by immunoblot analysis using an array of human ovarian cancer cell lines. It was found that SLFN5 protein level was elevated in high-grade carcinoma cell lines including OVCAR3, HO8910, and SKOV-3 cells (Fig. 4A). In addition, OVCAR3 cells had the highest SLFN5 expression accompanied with the highest colony formation ability (Fig. 4B). We showed that ablation of SLFN5 significantly prohibits proliferation (Fig. 4C). Next, we detected SLFN5 expression in normal ovarian epithelium cell lines (IOSE80) and ovarian cancer cell lines (OVCAR3, HO-8910, and SKOV3) and noticed that the expression of SLFN5 was significantly higher ovarian cancer cell lines, A2780 cells had the lowest expression of SLFN5 while OVCAR3 cells had the highest expression. Therefore, OVCAR3, HO-8910, and SKOV3 cells were transfected with the SLFN5 siRNA respectively, for further analysis. According to the results shown above, we deduced that SLFN5 might play a vital role in ovarian cancer.
Fig. 4
SLFN5 expression regulates the oncogenic behaviors of ovarian cancer cells in vitro. A Immunoblot analysis of SLFN5 expression in various human ovarian cancer cell lines. B Differntial colony-forming capability among human ovarian cancer cells. The anchorage- independent growth of ovarian cancer cells was determined by flat colonies formation assay. C SLFN5 depletion significantly reduces the proliferation rate of SKOV3、HO8910 and OVCAR3 cells. D. qPCR analysis of SLFN5 expression in ovarian cancer cell lines and normal ovarian epithelium cell lines. Results were presented as mean ± SD of three independent experiments. *P < 0.05 or **P < 0.001 indicates a significant difference between the indicated groups
×
SLFN5 knockdown suppressed proliferation in ovarian cancer cells
To characterize the role of SLFN5 in TGFβ1-induced EMT of ovarian cancer cells, we first determined the expression level of SLFN5 in SKOV3 and OVCAR3 cells when treated with 10 ng/ml TGF-β1 for 48 h. The result showed SLFN5 was upregulated by TGF-β1 (Fig. 5A). To investigate the role of SLFN5 in ovarian cancer cells, MTT assay was performed, and the results showed that cell proliferation was significantly inhibited in the si-SLFN5#1 and si-SLFN5#2 transfected groups compared with that in the si-NC transfected group (Fig. 5B; P < 0.01). Similarly, colony formation assay revealed that cell colonies generated in the si-SLFN5#1 and si-SLFN5#2 transfected groups obviously decreased than that in the si-NC transfected group (Fig. 5C; P < 0.01).
Fig. 5
SLFN5 inhibits ovarian cancer cell proliferation and migration. A qPCR analysis of SLFN5 expression in ovarian cancer cells. B Cell growth viability was assayed in SKOV3, OVCAR3, and HO8910 cells transfected with si-NC, si-SLFN5#1, si-SLFN5#2 using MTT at 0 h, 24 h, 48 h, 72 h and 96 h time point. C Knockdown of SLFN5 suppressed colony formation in SKOV3, OVCAR3 and HO8910 cells
×
SLFN5 knockdown inhibited invasion in ovarian cancer cells
Transwell assays were then performed to monitor the invasion function of ovarian cancer cells in response to SLFN5 knockdown. Results showed that SLFN5 knockdown specifically suppressed the invasion ability of SKOV3, OVCAR3 and HO8910 cells in vitro (Fig. 6A, B, P < 0.01). Similar results were obtained following a wound healing assay. Wound healing in SKOV3, OVCAR3 and HO8910 cells was significantly impaired in response to SLFN5 knockdown compared to the si-NC transfected group (Fig. 6C-F, P < 0.01).
Fig. 6
The role of SLFN5 in regulating ovarian cancer cell invasion and wound healing. A, B Transwell assays were used to measure the effect of SLFN5 knockdown on cell invasion in SKOV3, OVCAR3, and HO8910 cells. C,D,E,F) Wound healing assay was performed in SKOV3, OVCAR3, and HO8910 cells following transfection with si-NC and si- SLFN5. The data were presented as mean ± SD of three independent experiments. The statistical results were shown on the right panel. **P < 0.01
×
Effects Of SLFN5 On The Major EMT-Related Proteins
The EMT promotes tumour cell invasion and metastasis. Therefore, we detected changes in the expression of the EMT-related markers to explore the function of SLFN5 during the EMT. E-Cadherin is the characteristic protein of the epithelial phenotype that mediates cell–cell interactions. N-Cadherin and Vimentin are commonly used as tumour markers to identify mesenchymal phenotypes. Snail is a transcription regulatory factor that bind to E-box motifs to suppress E-cadherin transcription and regulate EMT [31]. Analysis using Western blotting indicated that the decreased expression of SLFN5 in OVCAR3 cells exhibited significantly increased protein levels of E-Cadherin, while the protein levels of N-Cadherin and Vimentin were reduced. Moreover, the protein levels of Snail was also decreased (Fig. 7B). As a result, SLFN5 could affect several vital EMT-related proteins.
Fig. 7
SLFN5 regulates the transition between epithelial and mesenchymal phenotypes in human ovarian cancer cells. A. Relative mRNA expression of E-cadherin、N-cadherin、Vimentine、Snail in SKOV3-ip cells、HO-8910-ip cells and OVCAR3-ip cells. B Silencing of SLFN5 in SKOV3-ip and OVCAR3-ip cells markedly increased E-cadherin expression and decreased vimentin、snail and N-cadherin expression as detected by western blot
×
Discussion
Ovarian cancer is one of the most mortal gynecological cancers; Since its late detection and chemoresistance, it is important to understand the pathogenesis of this malignant tumor [32]. The early symptoms of ovarian malignant tumors are not obviously appeared because malignant ovarian tumor normally grows in secluded places. Despite advances in treatment management for ovarian cancer patients, the prognosis remains poor. The screening of potential biomarkers and a better understanding of the pathogenesis of ovarian cancer could contribute to the development of novel target therapies [33]. Thus, in this study, we attempted to discover prognosis-related biomarkers and explore the related mechanisms underlying the development and progression of ovarian cancer.
In our study, 122 overlapping genes were identified as candidate genes related to EOC progression. After text mining, a total of 12 genes were found to be associated with EOC which are coexpression with SLFN5. GO pathway analyses showed that the translational initiation pathway (GO:0006413) was the most significant pathway involved with FAU,RBM4,POLR2G,NLRP3,TLR1,TLR6,TLR2,MRPL33, MRPS16, MRPL12,MRPL11,MRPL21,CHCHD1,TLR2 and MRPS16 have been reported to be associated with the development of ovarian cancer in previous studies [34]. Among the Mitochondrial translational initiation pathway, the high expression of SLFN5 was closely related with poor survival of patients with ovarian cancer and SLFN5 was prominently overexpressed in the three ovarian cancer cell lines, making it a candidate gene for further analysis. To our knowledge, this is the first study to explore the clinical significance of SLFN5 in ovarian cancer.
It is well known that ovarian cancer cells are prone to metastasis; in this process, epithelial-to-mesenchymal transition (EMT) is a necessary step during detachment of tumor cells from the primary tumor site and attachment to metastatic sites [35]. To ascertain the role of SLFN5 in migration, we observed that knockdown of SLFN5 in OVCAR3、HO-8910 and SKOV3 cells inhibited the migration of ovarian cancer cells, as assessed by scratch-wound assay. Then, we further checked the EMT markers. A switch from E-cadherin to N-cadherin is a key feature of EMT in ovarian cancer [36]. E-cadherin is a transmembrane glycoprotein of the type-I cadherin superfamily. Its cytoplasmic part is linked to the actin cytoskeleton via the catenins.
Ovarian cancer is a significant threat to human health with high incidence and mortality among malignant tumors. Increasing findings have shown that human SLFN5 functions in malignant tumors, such as melanoma, renal cell carcinoma, and glioblastoma, where it seems to play differential roles, either inhibitory or permissive. Growing evidence tells us that human SLFN proteins are important in normal and malignant cells [1, 2]. It has also been found to suppress migration and invasion of various cancer cell lines, including fibrosarcoma and renal clear-cell carcinoma cells, by inhibiting expression of membrane-type 1 matrix metalloproteinase(MT1-MMP), which degrades extracellular matrix, allowing cancer cells to migrate [9].
Accumulating evidence in recent years has raised the possibility of important and unique functions for human SLFN proteins in normal and malignant cells [1, 2]. SLFNs regulated the proliferation, invasion, apoptosis and chemotherapy-resistance in many types of cancer such as breast cancer which come straight to controll the transcription of ZEB1 [37]. SLFN5 has been shown to inhibit invasion of renal clear-cell carcinoma and melanoma cells in response to IFN treatment [21, 23]. In contrast, other studies have shown a correlation between high levels of SLFN5 and the malignant phenotype of several types of cancer [21, 38, 39]. For example, in lung cancer, lentiviral-mediated stable knockdown and overexpression of the SLFN5 gene in a lung adenocarcinoma cell line to determine the role of human SLFN5 in growth, proliferation, and apoptosis. SLFN5 knockdown promoted lung cancer cell proliferation and growth both in vitro and in vivo, whereas overexpression of SLFN5 inhibited these processes. SLFN5 overexpression induces epithelial-mesenchymal transition through activation of the β-catenin/Snail/E-cadherin signaling pathway [39]. In GBM, human SLFN5 promotes tumor cell migration and invasion in glioblastoma (GBM), by acting as a transcriptional repressor of IFN-generated. SLFN5-dependent transcriptional repression of STAT1 activity that may account for defective antitumor immune responses, raising the possibility of SLFN5 involvement in the pathogenesis of other malignancies as well [24]. Importantly, we have also previously established a correlation between SLFN5 expression and glioma grade and overall prognosis of GBM patients [24]. Moreover, intestinal metaplasia patients who overexpress SLFN5 exhibit a higher risk to develop gastric cancer [38]. Taken together, the role of SLFN5 in tumorigenesis appears multifaceted and disease-dependent, necessitating careful characterization of SLFN5 in each individual biological context.
Ovarian cancer is one of the most common tumors of the female reproductive system [40] which is associated with poor prognosis. EMT is a biological process during which epithelial cells acquire a mesenchymal phenotype through specific path ways. Multiple tumor microenvironment cytokines, including epidermal growth factor, endothelin 1 and bone morphogenetic protein, which regulate related signaling pathways to promote cancer development and metastasis [40]. EMT is important in embryonic development which is related to cancer progression and metastasis [41, 42]. EMT is indispensable to new characteristics of tumor cells required for invasiveness and vascular endosmosis during the metastasis. It is a convertible course during which the epithelial cells lose epithelial properties and acquire mesenchymal characteristics by disassembly of cell–cell junctions, loss of cell polarity, and reorganization of the cytoskeleton, thereby promoting cells to acquire increased motility. EMT can be defined according to EMT-associated markers, such as mesenchymal-specific markers, epithelial-specific markers and transcription factors [41]. It was previously showed that unusually E-cadherin expression is closely involved in the pathogenesis and development of ovarian cancer, and research into the regulation of E-cadherin expression in ovarian cancer has become a focus of interest.
In the present study we provide evidence that SLFN5 expression increased with malignancy grade and is highest in ovarian tumors. Further, high levels of SLFN5 expression correlate with worse prognosis in ovarian cancer patients. Importantly, our data show that targeting SLFN5 blocks ovarian tumor growth both in vitro and in vivo. Nevertheless, we provide evidence that the antitumor effects observed after SLFN5 depletion are mediated, at least in part, by interfering with cell cycle progression. This is important, as ovarian tumors are characterized by the presence of cell cycle dysregulation, a hallmark of several types of cancer, [42, 43] and the identification of SLFN5 as a new promoting factor of S phase progression may help expand the currently available armory of cell cycle inhibitors [44, 45].
To conclude, in the present study, we found that SLFN5 is upregulated in ovarian cancer tissues but the level of SLFN5 can vary depending on TNM grade. In addition, cancer histological type may influence the expression of SLFN5. In tissue samples, we found that a higher number of patients had a high expression of SLFN5 in serous ovarian cancer compared with mucinous, clear cell, and endometrioid ovarian cancer. SLFN5 is also upregulated in ovarian cancer cell lines. SLFN5 knockdown decreases cell growth, migration, and invasion. Furthermore, TGF-β1 can increase SLFN5 expression and induce ovarian cell EMT. However, knockdown of SLFN5 inhibits EMT. Thus, SLFN5 levels may be valuable for the prognosis of metastasis and SLFN5 may be a therapeutic target for prevention and intervention of metastasis of ovarian cancer.
Acknowledgements
This study was funded by Key Medical Discipline of Hangzhou City (2021-21); Key Medical Discipline of Zhejiang Province (2018–2–3); Key Laboratory of Clinical Cancer Pharmacology and Toxicology Research of Zhejiang Province (2020E10021);
Declarations
Ethics approval and consent to participate
According to the ministry of health "measures on ethical review of biomedical research involving human beings (trial 2007)"、WMA《Declaration of Helsinki》and the ethical principles of CIOMS《the international moral guide to human biological research》, Subject to review by the ethics committee, Agree to carry out this study according to the research scheme under review. I confirm that all methods were carried out in accordance with relevant guidelines and regulations. I confirm that all experimental protocols were approved by Ethics committee of hangzhou first people’s hospital. I confirm that informed consent was obtained from all subjects.
Consent for publication
Not applicable.
Competing interests
The authors declare that there are no competing interests for any of the authors.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Frauen mit unbehandelter oder neu auftretender Hypertonie haben ein deutlich erhöhtes Risiko für Uterusmyome. Eine Therapie mit Antihypertensiva geht hingegen mit einer verringerten Inzidenz der gutartigen Tumoren einher.
Trastuzumab deruxtecan scheint auch jenseits von Lungenkrebs gut gegen solide Tumoren mit HER2-Mutationen zu wirken. Dafür sprechen die Daten einer offenen Pan-Tumor-Studie.
Frauen mit lokalem oder metastasiertem Brustkrebs, die Statine einnehmen, haben eine niedrigere krebsspezifische Mortalität als Patientinnen, die dies nicht tun, legen neue Daten aus den USA nahe.
Welche Antibiotika darf man bei unkomplizierter Zystitis verwenden und wovon sollte man die Finger lassen? Welche pflanzlichen Präparate können helfen? Was taugt der zugelassene Impfstoff? Antworten vom Koordinator der frisch überarbeiteten S3-Leitlinie, Prof. Florian Wagenlehner.
Update Gynäkologie
Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert – ganz bequem per eMail.
