Background
The cell and molecular mechanisms by which injury to the brain leads to the later emergence of chronic, spontaneous seizures, a process termed epileptogenesis, remains incompletely understood [
1]. Epileptogenesis is associated with large-scale changes to gene expression which is thought to impact on neuronal survival and to drive remodelling of neuronal networks, aberrant neurotransmitter receptor expression and function, gliosis, neuroinflammation and other characteristic changes [
2]. It is increasingly recognized that targeting single genes is unlikely to be sufficient to disrupt epileptogenesis and ways to target larger signalling networks are required [
1]. This has driven a strong focus on transcription factors and epigenetic mediators [
3], systems genetics approaches [
4] and post-transcriptional gene silencing by non-coding microRNAs [
5]. This is apt because it is mRNA transcription that provides the greatest contribution to the abundance of proteins during stress [
6,
7]. In contrast, protein turnover has been reported to contribute less than 10% to overall protein abundance [
7]. Nevertheless, protein aggregates and dysfunction of the molecular machinery responsible for regulating protein turnover is evident in numerous neurodegenerative and neurologic disorders [
8‐
10]. Thus, protein turnover may be especially important for the pathogenesis of diseases associated with the brain. Whether altered protein turnover is important in epileptogenesis is unknown.
The ubiquitin proteasome system (UPS) is the major intracellular pathway leading to the degradation of aberrant and/or misfolded soluble proteins [
11]. The UPS is a highly conserved and tightly controlled ATP-consuming proteolytic system. Ubiquitin (Ub) is first activated by an E1 enzyme, and then transferred to an ubiquitin-conjugating E2 enzyme [
11]. Substrates to be degraded are selectively recognized by E3 Ub ligases [
12]. E3 ligases mediate the subsequent transfer of activated Ubs from E2 to the substrate leading to an increasing polyubiquitination chain [
11]. Once Ub moieties reach four or more per substrate chain, the substrate is usually recognized by the 26S proteasome [
13]. The 26S proteasome is composed of two 19S regulatory protein complexes important for substrate recognition and deubiquitination and a barrel-like shaped 20S protein complex with a catalytic core in charge of substrate cleavage into smaller peptides and amino acids [
14].
The UPS is present and functions in multiple sub-cellular compartments including cytoplasm, nucleus, mitochondria, cell membranes and pre- and post-synaptic compartments in neurons [
15‐
17]. In the nervous system, the UPS has been shown to regulate turnover of proteins critical for neuronal survival and neurotransmission [
16,
17] by controlling the presence of functional glutamate [
18] and γ-amino butyric acid (GABA) receptor levels [
19], spinogenesis [
20], dendrite growth and arborisation [
21] and the formation of new synapses [
22]. Proteasome inhibition has been proposed to play a causative role in numerous acute and chronic diseases of the brain including ischemia [
10] and neurodegenerative diseases such as Alzheimer’s, Huntington’s and Parkinson’s [
9,
23]. Consequently, UPS-targeting drugs have been proposed as potential therapeutic treatment strategies for various brain diseases [
9].
Emerging evidence suggests the function and dysregulation of the UPS is important in epilepsy. Glutamate-induced excitotoxicity leads to an inhibition of the proteasome [
24]. Genes linked to ubiquitin metabolism are prominent among transcripts regulated by seizures in animal models [
25]. The deubiquitinating enzyme USP9X regulates excitability and seizures in animals and humans [
26]. Genetic or pharmacologic targeting of the E3 ubiquitin ligase CRL4A (CRBN) increases seizure susceptibility [
27]. The immunoproteasome, a particular form of the proteasome believed to play a key role during inflammation, is upregulated in brain tissue from patients with temporal lobe epilepsy (TLE) [
28] and in the hippocampus of rats with chronic epilepsy [
29]. Lafora disease, a progressive myoclonic epilepsy characterized by the presence of glycogen-like intracellular inclusions named Lafora bodies, results from mutations in the ubiquitin E3 ligase malin [
30]. In addition, 20S proteasome subunits have been shown to be sequestered in Lafora bodies [
31]. Mutations in the E3 ligase Ube3a have been shown to cause Angelman syndrome, a rare neurological disorder commonly associated with intractable seizures [
32] and the E3 ligase MDM2 controls levels of the transcription factor p53 which regulates cell death and seizure thresholds in experimental and human epilepsy [
33,
34].
However, up to date there have been no studies carried out to characterize where exactly UPS inhibition occurs after seizures in vivo, which cell-types are involved and whether proteasome inhibition impacts on seizure-induced brain damage. Here we used a UPS inhibition green fluorescent protein (GFP)-reporter mouse [
35] to map UPS inhibition in vivo following
status epilepticus. We also tested a proteasome inhibitor for effects on seizure-induced neuronal death.
Discussion
In the present study we show an increased accumulation of polyubiquitinated proteins in the hippocampus after prolonged seizures and during epilepsy suggesting a seizure-induced inhibition of the UPS. Most strikingly and unexpectedly, seizure-induced UPS impairment was mainly evident in brain areas resistant to seizure-induced cell death including neurons and astrocytes. In line with a neuroprotective role of proteasome inhibition during seizures, mice treated with the specific proteasome inhibitor epoxomicin displayed less neurodegeneration. These findings support proteasome inhibition as an endogenous protective mechanism against seizure-induced cell death.
Despite differences in disease etiology (e.g. β-amyloid, polyglutamine expansion, neurodevelopmental abnormalities and other) several chronic brain disorders share common clinical symptoms (e.g. cognitive deficits, seizures and psychological problems such as depression and anxiety) implying the emerging concept of existing shared pathological pathway activation among different brain diseases [
48‐
50]. Proteasome inhibition and the accumulation of polyubiquitinated aggregates are a common characteristic of chronic neurodegenerative diseases such as Alzheimer’s and Huntington’s [
9,
51] and an impairment of the UPS has also been reported after acute insults to the brain such as stroke and traumatic brain injury [
10,
52]. Likewise, emerging evidence suggests a dysfunction of the UPS in neurological diseases such as epilepsy [
29]. However, previous studies lacked evidence showing a direct link between seizures and proteasome inhibition and whether seizures lead to an inhibition of the proteasome in vivo has not been fully established. Studies were limited to determining the expression levels of specific subunits of the immunoproteasome [
28,
29] or to identify the impact certain mutations of genes involved in UPS functions have on pathology (e.g. different E3 ligases, deubiquitinating proteins) [
26,
31]. Recent in vitro experiments have suggested that glutamate-induced excitotoxicity may lead to UPS inhibition mediated by NMDA receptor activation [
24]. We extend these studies here by showing that prolonged seizures lead to an impairment of the UPS with the subsequent accumulation of polyubiquitinated substrates in the brain. We do not know what causes an inhibition of the proteasome after seizures. In line with in vitro results [
24], we have observed a down-regulation of chymotrypsin-like activity in the hippocampal subfield CA1 after KA-induced seizures. This may contribute to the accumulation of polyubiquitinated proteins in the hippocampus after seizures. However, the hippocampal subfield showing the strongest increase of Ub
G76V-GFP reporter protein levels and polyubiquitinated conjugates after
status epilepticus in our model was the DG subfield which showed only a marginal inhibition of the catalytic activity of the 20S proteasome. Previous studies have shown a dose-dependent increase in Ub
G76V-GFP reporter in hippocampal neurons treated with epoxomicin [
35], therefore, our results suggest that other mechanisms may contribute to proteasome inhibition. Moreover, no differences in 20S proteasome activity was observed at the time of lorazepam administration, further suggesting only a small contribution of the catalytic down-regulation of the 20S proteasome to UPS impairment. Other factors may contribute to the accumulation of polyubiquitinated proteins after prolonged seizures.
Status epilepticus leads to a depletion of intracellular ATP [
53], possibly impeding E1-mediated Ub activation and compromising a correct functioning of the ATP-consuming 20S proteasome [
11]. Increased intracellular Ca
2+ during excitotoxicity might also lead to a dysfunction of the proteasome [
24]; however, other reports have suggested that increased intracellular Ca
2+ levels lead to increased proteasome activity [
54]. Furthermore, s
tatus epilepticus leads to an increase in ER-stress [
55] and an impairment of autophagy [
56], a second major intracellular protein-degrading mechanism, thereby potentially leading to an overload of substrates which exceeds the capacity of the proteasome. Regardless of the mechanism, our results show that seizures lead to an impairment of the UPS with the subsequent accumulation of poly-ubiquitinated substrates in the hippocampus. Interestingly, seizures are a common co-morbidity of many neurodegenerative diseases such as Alzheimer’s and Huntington’s [
57,
58] possibly contributing to the accumulation of polyubiquitinated aggregates during these diseases.
Our second major finding was that proteasome inhibition was most evident in hippocampal subfields resistant to seizure-induced cell death. This was unexpected since proteasome inhibition is typically associated with a failure of homeostasis and a driver of neurodegeneration [
8]. We do not know why UPS impairment was most evident in these brain regions. However, comparing GFP increases between both brain hemispheres and the different hippocampal subfields, it is tempting to speculate that the level of proteasome inhibition reflects seizure progression throughout the ipsilateral and contralateral hippocampus [
40] with the DG being the major site of excitatory input into the hippocampus [
59]. While proteasome inhibition was most apparent in neurons at early stages after
status epilepticus, astrocytes were the main cell population affected later by UPS impairment. This might be due to the fact that neurons are most likely the cell population activated during the early stages of seizure-induced pathology, while glial responses occur at later stages [
60]. Interestingly, proteasome inhibition has been shown to decrease astrogliosis in vitro and in vivo [
61]. Furthermore, recent studies demonstrated that astrogliosis alone, in the absence of any other pathology, is sufficient to cause epilepsy in mice [
62,
63]. This may suggest a potential anti-epileptic effect provided by proteasome inhibition in glia. UPS impairment in astrocytes is not unique to our seizure model and has been described for other diseases including Huntington’s disease [
64]; amyotrophic lateral sclerosis [
65] and prion disease [
39]. Moreover, astrocytes seem to be well adapted to support long-lasting UPS impairment probably due to the efficient induction of heat shock responses [
66].
Why does the ipsilateral CA3 subfield of the hippocampus display a delayed inhibition of the UPS? The CA3 subfield is particularly vulnerable in our model [
36] possibly due to the high density of kainate receptors [
67]. Although a NMDA-mediated down-regulation of the UPS has been observed after excitotoxicity [
24], this has been restricted to the nuclear compartment [
24]. On the other hand, increased intracellular Ca
2+ concentrations have been shown to activate the proteasome [
54] which may delay the accumulation of polyubiquitinated conjugates at early time-points after
status epilepticus. Another possible explanation for the delayed accumulation of polyubiquitinated proteins in CA3 may be increased inhibition of translation after seizures [
68] leading to fewer substrates to be degraded by the proteasome.
Although the spatio-temporal profile of UPS inhibition has not been reported previously after
status epilepticus, there have been numerous reports of UPS inhibition after ischemic brain injury [
27,
69,
70]. Here, proteasome inhibition was most evident in the hippocampal subfield CA1, a brain region vulnerable to ischemia-induced cell death, whereas only a transient polyubiquitination could be observed in the remaining cell-death resistant hippocampal subfields CA3 and DG [
27]. This is different to
status epilepticus, where, in contrast to ischemia, cell death-resistant brain regions showed the highest increase in polyubiquitination levels, suggesting a unique pathology according to brain insult. Interestingly, during ischemia the hippocampal subfield CA1 showed the strongest reduction in the catalytic activity of the proteasome [
71], similar to findings in our mouse model of
status epilepticus, suggesting that some similarities may exist between different conditions. We do not know why the hippocampal subfield CA1 is more prone to a reduction in proteasome activity after seizures and why this downregulation is not accompanied by a bigger increase in polyubiquitinated proteins after
status epilepticus when compared to the other hippocampal subfields. Differences in glutamate receptor recruitment during
status epilepticus (e.g. NMDA subtype vs. kainic acid or AMPA receptor) with the resulting differences in intracellular calcium levels, may affect proteasome activity [
24,
54]. Differences in the subfield-specific clearance of damaged proteins and/or ER-stress during
status epilepticus might also contribute to differences in the accumulation of polyubiquitinated proteins.
Why does UPS impairment protect against seizure-induced cell death? The protection is presumably a result of an accumulation of proteins that would otherwise be degraded. However, we do not know their identity. The most likely candidates probably include proteins involved in inflammatory processes such as NFκB which has been shown to mediate proteasome inhibitor-mediated neuroprotection after ischemia [
72,
73]. Other proteins such as heat shock proteins [
74] or synaptic proteins may also be involved. This could be assessed in the future using Tandem mass spectrometry (MS-MS)-type approaches. Another option may be that accumulated proteins interrupt signalling pathways that would normally be able to progress through to kill neurons or, alternatively, the inhibition of the ATP-consuming UPS may help protect against excessive depletion of energy reserves during seizures.
Emerging evidence suggests that the UPS controls neurotransmission by regulating crucial processes such as synaptic plasticity, spinogenesis and levels of functional neurotransmitter receptors [
17]. We have not observed any changes in seizure severity during
status epilepticus after epoxomicin treatment. However, a potential impact of the proteasome on seizure generation or seizure severity might be more important under chronic conditions. Epileptic mice in our study showed increased polyubiquitination levels in the hippocampus suggesting a chronic impairment of the UPS which may contribute to hyperexcitability. In line with this, recent data has shown a more severe epileptic phenotype in rats treated with the proteasome inhibitor MG-132 [
75], which, in contrast to epoxomicin, also inhibits calpain activity [
76]. While acute/transient UPS inhibition may be protective, long-lasting inhibition may be neurotoxic. Indeed, inhibition of the UPS has been reported to elicit neurodegeneration directly [
8,
45]. Therefore, it is unlikely proteasome inhibitors will be used as neuroprotective or anti-epileptic drugs. However, they provide important insight into molecular pathogenesis and, if we can identify the affected pathways/proteins involved, this may lead to novel approaches for the treatment of
status epilepticus and epilepsy.
Methods
Mouse seizure models
For our studies we used adult male mice (20–25 g) (C57Bl/6 (Harlan laboratories, Bicester, UK)) and mice ubiquitously expressing the ubiquitin fusion degradation substrate ubiquitin
G76V-green fluorescent protein (Ub
G76V-GFP) [
38]. The main experiments used the intra-amygdala KA-induced
status epilepticus [
36]. Briefly, mice were anesthetized using isoflurane (3–5%) and maintained normothermic by means of a feedback-controlled heat blanket (Harvard Apparatus Ltd, Kent, England). Then, mice were placed in a stereotaxic frame and following a midline scalp incision, three partial craniotomies were performed. Surface EEG was recorded from three scull-mounted recording electrodes (Bilaney Consultants Ltd, Sevenoaks, UK) placed above the dorsal hippocampus and frontal cortex. EEG was recorded using a Grass Comet digital EEG (Medivent Ltd, Lucan, Ireland). A guide cannula was affixed over the dura (coordinates from Bregma: AP = −0.94; L = −2.85 mm) and the entire skull assembly fixed in place with dental cement. Anaesthesia was discontinued, EEG recordings were commenced, and then a 31-gauge internal cannula (Bilaney Consultants Ltd, Sevenoaks, UK) was inserted into the lumen of the guide to inject KA (Sigma-Aldrich, Dublin, Ireland) (0.3 μg in 0.2 μl of vehicle or 1.0 μg in 0.2 μl of vehicle; phosphate-buffered saline (PBS), pH adjusted to 7.4) into the amygdala. Non-seizure control animals received the same volume of intra-amygdala vehicle. EEG was recorded until intra-peritoneal lorazepam (6 mg/kg) administration at 40 min post-KA injection. In a subgroup of mice,
status epilepticus was induced by a subcutaneous injection of pilocarpine (Sigma-Aldrich, Dublin, Ireland) at 340 mg/kg body weight, 20 min after injection of methyl-scopolamine (1 mg/kg) (Sigma-Aldrich, Dublin, Ireland) [
40].
Mice were euthanized at different time-points post lorazepam administration (0, 1, 4, 8, 24 and 72 h and 7 and 14 days) by transcardial perfusion with PBS or 4% paraformaldehyde (PFA) or brains were microdissected on ice and processed for protein analysis.
Quantification of EEG and behaviour assessment of seizure severity
Cortical EEG recordings were analyzed off-line using manual assessment as described [
77]. The duration of high-frequency (>5 Hz) and high-amplitude (>2X baseline) polyspike discharges of ≥5 s duration (HAHFDs) which are synonymous with injury-causing electrographic activity [
47] was counted by a reviewer blind to treatment. Changes in seizure-induced behaviour were scored according to a modified Racine Scale as reported previously [
78]. Score 1, immobility and freezing; Score 2, forelimb and or tail extension, rigid posture; 3, repetitive movements, head bobbing; Score 4, rearing and falling; Score 5, continuous rearing and falling; Score 6, severe tonic–clonic seizures. Mice were scored every 5 min for 40 min after KA injection. The highest score attained during each 5 min period was recorded by an observer blinded to treatment.
In vivo drug treatments
Drugs were delivered via intracerebroventricular (i.c.v.) injections as described before [
77] (coordinates for i.c.v. injections were Bregma: AP = −0.3 mm, L = −1.0 mm, V = −2.0 mm). Mice received a 2 μl infusion of the specific proteasome inhibitor epoxomicin (Sigma-Aldrich, Dublin, Ireland) at 30 μM, 100 μM or 300 μM (diluted in 100% dimethyl sulphoxide, (Sigma-Aldrich, Dublin, Ireland) or vehicle 30 min before the induction of
status epilepticus and 60 min after KA injection.
Proteasome activity assay
To measure chymotrypsin-like proteasome activity, we used the fluorigenic peptide N-succinyl-Leu-Leu-Val-Tyr-7-amino-4-methyl-coumarin (suc-LLVYAMC) (Calbiochem, Nottingham, UK). Tissue or cells were homogenised in lysis buffer (10 mM HEPES, 42 mM KCl, 5 mM MgCl2, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, 0.5% (w/v) CHAPS). Then, lysates were incubated with reaction buffer (25 mM HEPES, pH 7.4, 0.5 mM EDTA, pH 8) containing suc-LLVY-AMC. Using 360 nm excitation, fluorescence was measured at 465 nm and 37 °C using a plate reader with the appropriate filters (GENios, Tecan, Weymouth, UK). Fluorescence signals were normalized to the protein concentrations, which were determined by Bradford assay (Thermo Fisher Scientific, Dublin, Ireland).
Western blotting
Western blotting was performed as previously described [
40]. Whole hippocampi or hippocampal subfields (dentate gyrus (DG), CA1 and CA3) were homogenized in lysis buffer and protein concentration was determined. 30 μg protein samples were boiled in gel-loading buffer and separated on 10% to 12% SDS-PAGE gels. Proteins were transferred onto nitrocellulose membranes (BioRad, Hercules, USA) and then incubated with antibodies against the following: GFP (1/500, Cell Biolabs, CA, USA, AKR/020), FK-2 (polyubiquitin) (1/1000, Merck Millipore, Billerica, MA, U.S.A), C-Fos (1/400, Santa Cruz Biotechnology, CA, U.S.A), Proteasome 20S (1/1000, Enzo Life Science, Exeter, UK), β-Actin (1/1000, Sigma-Aldrich, Dublin, Ireland) and α-Tubulin (1/1000, Santa Cruz Biotechnology, Heidelberg, Germany). Membranes were then incubated with horseradish peroxidase-conjugated secondary antibodies (Jackson Immuno Research, Plymouth, PA) and bands visualized using Supersignal West Pico Chemiluminescent Substrate (Pierce, Rockford, IL). Images were captured using a Fuji-film LAS-300, densitometry performed using AlphaEaseFC4.0 software and data expressed as change relative to control.
RNA extraction and real time PCR
Total mRNA was extracted as previously described using the Trizol protocol [
40]. Quantity of mRNA was measured using a Nanodrop Spectrophotometer (Thermo Fisher Scientific, Rockford, IL, USA) and RNA dilutions were made up in nuclease-free water. For analysis of mRNA expression, 1 μg of total RNA was used to generate cDNA by reverse transcription using a Superscript II Reverse Transcriptase enzyme (Thermo-Fisher, MA, USA). Quantitative real-time PCR was performed using a LightCycler 1.5 (Roche Diagnostics GmbH, Mannheim, Germany) in combination with QuantiTech SYBR Green PCR kit (Qiagen, Hilden, Germany) as per the manufacturer’s protocol and 1.25 μM of primer pair used. Data were represented as 2
−ΔΔCT and normalized to the expression of β-actin. Primers used:
GFP (F: acgtaaacggccacaacttc, R: aagtcgtgctgcttcatgtg);
β-actin (F: gggtgtgatggtgggaatgg, R: ggttggccttagggttcagg).
Histopathology
Neuronal damage was assessed by FjB (Merck Millipore, CA, USA) as described before [
77]. Briefly, fresh-frozen coronal brain sections at the level of the dorsal hippocampus were post-fixed in formalin for 30 min, then incubated in 0.0006% potassium permanganate, washed and incubated for 20 min with a 0.001% FJB solution (Chemicon Europe Ltd., Chandlers Ford, UK). Once washed and dried, slides were coverslipped with DPX mounting solution (Sigma-Aldrich, Dublin, Ireland). Counts were the average of two adjacent sections assessed by an observer blinded to treatment.
Immunofluorescence staining and confocal microcopy
For confocal microscopy, animals were transcardially perfused with 4% PFA, post-fixed and embedded in 2% agarose before sectioning on a vibratome (Leica Biosystems, Wetzlar, Germany). Sections were rinsed and treated with PBS containing 0.1% Triton™ X-100 and 1% foetal calf serum followed by incubation with the primary antibodies; GFP (1/500, Life Technologies, Thermo Fisher Scientific, Rockford, USA, A11122), NeuN (1/400; Merck Millipore, Billerica, MA, U.S.A), GFAP (1/500, Santa Cruz Biotechnology, CA, U.S.A), Cd11b (1/400, Abcam, Cambridge, UK) and PV (1/5000, Swant Inc, Marly, Switzerland). Sections were washed again and incubated with secondary antibodies coupled to Alexa Fluor® 488 or Alexa Fluor® 568 (BioSciences Ltd, Dublin, Ireland). Sections were then coverslipped with Fluorosave™ (Merck Millipore, Billerica, MA, U.S.A). Confocal images were acquired with a Leica TCR 6500 microscope equipped with four laser lines (405, 488, 561 and 653 nm) using a × 40 immersion oil objective.
To determine the percentage of GFP-positive astrocytes, sections were double-stained with antibodies detecting GFP and the astrocyte marker GFAP. 6 pictures were taken from each hippocampus (2 from each hippocampal subfield) at 20x magnification and astrocytes positive for GFAP alone or colocalized with GFP were counted in sections from control mice and at different timepoints post status epilepticus (1 h, 4 h, 8 h, 24 h and 72 h after KA injection). Images were analyzed using ImageJ.
Diaminobenzidine (DAB) immunohistochemistry
DAB staining was performed as described before [
77]. Briefly, mice were anesthetized and transcardially perfused with 4% PFA. Brains were post-fixed in 4% PFA and prepared for sectioning on vibratome as described. Next, 30 μm sagital brain sections were pretreated for 1 h with 1% BSA, 5% FBS, and 0.2% Triton X-100, and then incubated with the primary antibody GFP (1/500, Life Technologies, Thermo Fisher Scientific, Rockford, USA, A11122). Finally, brain sections were incubated in avidin–biotin complex using the Elite Vectastain kit (Vector Laboratories, Burlingame, CA, U.S.A). Chromogen reactions were performed with diaminobenzidine (Sigma-Aldrich, Dublin, Ireland) and 0.003% H
2O
2 for 10 min and, once dried, sections were coverslipped with Fluorosave.
Primary hippocampal cell culture
Primary cultures of hippocampal neurons were prepared from E18.5 embryonic C57/Bl6 wild-type mice as described previously [
40]. Briefly, neurons were plated onto poly-L-lysine and laminin bed and maintained in Neurobasal medium supplemented with B-27 and N2 (Biosciences, Belgium), at 37 °C in a humidified atmosphere with 5% (v/v) CO
2 for 8 days. On in vitro day 8, cells were pre-treated with different doses of epoxomicin (1, 5 and 10 nM) or MG132 (Sigma-Aldrich, Dublin, Ireland) (1 and 5 μM) for 12 h. Cells were then treated with 0.3 μM KA or 25 mM KCl for 6 h. Cell death was determined using Propidium iodide (PI) (Sigma-Aldrich, MO, USA) staining. Cells were stained with PI and Hoechst and a minimum of three pictures were taken per experiment (20 x lens) blinded to treatment. Cell death was calculated as percentage of PI uptake in relation to Hoechst-positive cells. Each experiment was obtained from an independent dam (
n = 3).
Simulated post-mortem delay
To determine possible changes in UPS activity due to post-mortem delay differences, hippocampi were extracted from mice (adult C57Bl/6) after deep anesthesia with pentobarbital and decapitation. Hippocampi were either frozen immediately (‘surgical’ control) or frozen 4 h or 8 h after being left at room temperature (simulated post-mortem interval). Samples were then processed for Western blotting as described before [
77].
Data analysis
All data are presented as mean ± standard error of the mean. Two group comparisons were made using unpaired Student’s two-tailed t-test, while multi-group comparisons were made using one-way or two-way analysis of variance (ANOVA) followed by post hoc testing using Fisher’s exact test (StatView). Significance was accepted at P <0.05.