Background
The oviduct of oviparous animals such as chicken and quail is an amazing organ. It produces each structural component of the laid egg, including the egg-white and eggshell. The mechanisms underlying the egg-laying process are sensitively regulated by steroid hormones, which orchestrate the proliferation and growth of oviductal epithelial cells. For example, diethylstilbestrol (DES) administration leads to massive growth of the juvenile oviduct [
1] and induces cytodifferentiation of epithelial cells into tubular gland cells, goblet cells, and ciliated cells [
2]. The oviductal magnum is regarded as an important target tissue [
3,
4] for transgenic research and the production of glycosylated pharmaceutical proteins in chickens because most egg-white proteins are synthesized and secreted in the magnum segment to the oviductal lumen during the 24-h egg production cycle, and this process is mediated by a series of hormones.
The egg-laying hen oviduct is divided into several parts: the infundibulum (place of fertilization), magnum (place of egg-white protein production), isthmus (formation of the shell membrane), shell gland (formation of the egg shell), and vagina (oviposition). While the oviduct mucosa of 10-week-old juvenile chickens is simply lined by a thin layer of pseudostratified columnar epithelial cells upon compact stroma cells [
2], the oviductal magnum mucosa from egg-laying hens consists of surface oviductal epithelium lined by ciliated non-secretory cells, non-ciliated secretory granular cells (also referred to as goblet cells), and three different types of tubular gland cells under the epithelium [
5]. The ciliated cells rarely show secretory activity and consist of cilia in the luminal mucosa [
6] but non-ciliated cells are mainly involved in the release of secretory granules that are synthesized by tubular gland cells.
On the other hand, granular cells have a unique intracellular structure of highly conserved glycoprotein and actively release the egg-white protein mass into the lumen when an egg is proceeding through the magnum segment [
6]. Glycoprotein, carbohydrates, and lectin have been commonly shown to have different distributions and binding patterns depending on the species, age, sexual maturity, and hormonal effects [
7‐
12]. In addition, these materials are involved in sperm binding to the oviductal epithelium [
13,
14], sperm trapping in the oviductal mucosa [
15,
16], and secretory activity of oviductal ampulla during the estrous cycle [
10]. Despite the importance of lectin and carbohydrates in reproductive biology, little is known about chicken oviduct. Traditionally, the characterization of the chicken oviduct has been limited to immunohistochemical staining against egg-white proteins, including ovalbumin, ovomucoid, lysozyme [
17] and steroid hormone receptors [
18,
19].
Although chicken is regarded as a useful tool for transgenesis as a bioreactor [
3,
20‐
22], the production mechanism of recombinant humanized proteins are not well understood because of difficulties of transgenic chicken production, lack of
in vitro verification system of transgene and fundamental researches of chicken oviduct, and highly sensitive hormone reaction in oviduct. In this study, we conducted a series of experiments using electron microscopy, quantitative RT-PCR, immunohistochemical analysis, and lectin histochemistry in juvenile oviductal magnum and that of egg-laying hens. The results obtained in this study should aid in our understanding of bird reproduction, mechanism of egg-white protein production, glycosylation, and the
in vitro culture of chicken oviductal cells.
Methods
Experimental animals and animal care
The care and experimental use of chickens was approved by the Institute of Laboratory Animal Resources, Seoul National University (SNU-070823-5). Chickens were maintained according to a standard management program at the University Animal Farm, Seoul National University, Korea. The procedures for animal management, reproduction, and embryo manipulation adhered to the standard operating protocols of our laboratory.
Scanning electron microscopy (SEM) and transmission electron microscopy (TEM)
The magnum segment of chicken oviducts from juvenile (10-week-old) and actively egg-laying (30-week-old) hens were obtained, fixed primarily at 4°C for 2-4 h with modified Karnovsky's fixative (2% glutaraldehyde and 2% formaldehyde in 0.05 M sodium cacodylate buffer, pH 7.2), washed three times with cacodylate buffer, fixed secondarily for 2 h with 1% osmium tetroxide in cacodylate buffer, and stained overnight with 0.5% uranyl acetate at 4°C. To observe specimens for scanning electron microscopy (SEM), samples were dried twice with 100% isoamyl acetate for 15 min in a critical point dryer, mounted on metal stubs, coated with gold, and observed under field emission (FE)-SEM (SUPRA 55VP; Carl Zeiss). To prepare specimens for transmission electron microscopy (TEM), samples were dehydrated through a graded ethanol series, embedded in Spurr's resin, and cut on an ultramicrotome (MT-X; RMC, Tucson, AZ, USA). Samples were then stained with 2% uranyl acetate and Reynold's lead citrate for 7 min each and observed under TEM (LIBRA 120; Carl Zeiss).
Total RNA extraction and real-time PCR analysis
Total RNA was extracted from the oviduct and muscle samples from juvenile (10-week-old) and egg-laying adult (30-week-old) chickens using TRIzol according to the manufacturer's instructions (Invitrogen, Carlsbad, CA, USA). Extracted RNA was quantified using a spectrophotometer and 1 ug of each RNA sample was reverse-transcribed into 20 μl of single-stranded cDNA using the Superscript III First-Strand Synthesis System (Invitrogen). Primer sets were synthesized to amplify specific fragments of chicken oviductal transcripts as described in Table
1. To analyze the expression patterns of oviduct-specific genes, the iCycler iQ Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) and EvaGreen (Biotium, Hayward, CA, USA) were used for quantitative RT-PCR. Non-template wells without cDNA were included as negative controls and each test sample was run in triplicate. The PCR amplification was performed at 94°C for 3 min, followed by 35 cycles at 94°C for 30 s, 60°C for 30 s, and 72°C for 30 s, using a melting curve program (increase in temperature from 55°C to 95°C at a rate of 0.5°C per 10 s) and continuous fluorescence measurement. Relative quantification of gene expression was calculated after normalization of the transcript to
GAPDH (endogenous control) and the nonspecific control using the 2
-ΔΔCt method. The PCR products were also loaded on a 1% agarose gel with ethidium bromide.
Table 1
Primer sequences for RT-PCR
ovalbumin | tgagcatgttggtgctgttg ttttcctccatcttcatgcg | NM_205152.1 | 154 |
ovomucoid | agcgaggacggaaaagtgat cctgctctactttgtgggca | NM_001112662.1 | 118 |
lysozyme | gctctggggaaagtctttgg gcggctgttgatctgtagga | NM_205281.1 | 192 |
avidin | caggcacctacatcacagcc tcaggacctccttcccattc | NM_205320.1 | 192 |
estrogen receptor alpha | gtccatctgctggaatgtgc aagatttccaccatgccctc | NM_205183.1 | 149 |
progesterone receptor | cagccagagctcccagtaca gacagcagttcctcaagcga | NM_205262.1 | 249 |
gapdh | acgccatcactatcttccag cagccttcactaccctcttg | NM_204305.1 | 578 |
Immunohistochemistry and lectin staining
The oviductal magnum segments of juvenile (10-week-old) and egg-laying adult (30-week-old) chickens were fixed in 4% buffered paraformaldehyde after strong washing with phosphate-buffered saline (PBS). Segments were subsequently embedded into a paraffin block and the paraffin-embedded oviductal tissue was sectioned at a thickness of 6 μm. The deparaffinized and rehydrated samples were heated in a microwave for 10 min after immersion in a sodium citrate buffer solution at pH 6.0 for heat-induced epitope retrieval (HIER). For immunohistochemical analysis, samples were permeabilized with 0.1% Triton X-100 in PBS for 5 min and incubated with 0.1% normal goat serum for 1 h to block nonspecific binding. Samples were serially stained at 4°C for overnight by indirect labeling using the following primary antibodies; mouse anti-chicken OVA antibody (1:200 dilution; Sigma), rabbit anti-human ESR1 antibody (1:100 dilution; Sigma), and mouse anti-human PGR antibody (1:100 dilution; Biocare Medical, Concord, CA, USA). To detect the primary antibodies, an AP detection system (Dako Universal LSAB2 kit; DakoCytomation, Carpinteria, CA, USA) was conducted [
23] and then samples were observed under an inverted microscope (TE2000-U; Nikon).
For lectin histochemistry, the oviductal samples were reacted with FITC-conjugated lectins (Sigma) such as peanut agglutinin (PNA),
Helix pomatia agglutinin (HPA), concanavalin A (ConA),
Ulex europaeus agglutinin-1 (UEA-1),
Wisteria floribunda agglutinin (WFA), and wheat germ agglutinin (WGA) at 10 μg/ml [
9,
24] for 30 min. For double staining, juvenile and adult oviductal samples were incubated with anti-OVA, anti-PGR and anti-ESR1 antibodies at 4°C for overnight, respectively, and serially reacted with 10 μg/ml Cyanine (Cy) 3 or PE-conjugated anti-mouse IgG or rabbit IgG antibodies for 1 h at RT, and each samples were incubated with FITC-conjugated lectin-WGA for 30 min. These fluorescent samples were counterstained with diamidino-2-phenylindole (DAPI) and observed under a confocal microscope (LSM-700; Carl Zeiss, Wetzlar, Germany).
Histochemistry
For histological and chemical dye staining, sections were stained with hematoxylin-eosin (HE; Sigma, St. Louis, MO, USA) for 2 min and 20 min, respectively [
23], Periodic acid-Schiff's staining (PAS; Sigma) for 5 min and 15 min, respectively, or Toluidine blue (TB; Sigma) for 2 min. All procedures were performed at room temperature, and stained cells were observed under an inverted microscope (TE2000-U; Nikon, Tokyo, Japan).
Statistical analysis
The PROC-GLM model of the SAS program (SAS Institute, Cary, NC, USA), which employs an analysis of variance (ANOVA) and the least-squares method, was used to statistically analyze the numerical data, i.e., oviductal samples from juveniles and adults, and muscle samples as controls. A significant difference was determined when the P value was less than 0.05.
Discussion
In this study, it revealed that the chicken oviductal magnums from juvenile and egg-laying adult hens were physiologically and functionally different, based on the studies of the ultrastructural analysis, quantitative RT-PCR analysis, immunohistochemical analysis of ovalbumin and steroid hormone receptors, and lectin histochemistry. Our results also indicated that the juvenile oviductal magnum was not differentiated into functional tubular gland cells, even though ciliated non-secretory cells were rarely observed on the luminal surface.
In chicken, juvenile oviductal magnum is simply lined up by undifferentiated oviductal epithelia, which could be cytodifferentiated into tubular gland cells by estrogen [
1]. Two types of columnar epithelial cells on the surface of the granular lumen and three types of tubular gland cells located under the luminal epithelium of the magnum mucosa were observed in the oviductal magnum from the egg-laying hen. Ciliated non-secretory cells were broadly scattered and covered the surface of the glandular lumen. Non-ciliated secretory cells were surrounded by numerous ciliated cells and secreted large masses of egg-white components such as ovalbumin. In the oviductal magnum, tubular gland cells are classified into another three different types: type A cells, filled with electron-dense granules; type B cells, filled with a large mass of homogenous material with low amounts of electron-dense granules; and type C cells, which are occupied by GER cisternae and a large and prominent Golgi area. The type C cells are regarded as recovered type A cells that have transferred their granules during passage of the egg [
26]. In the present study, we confirmed previous studies of the adult oviductal magnum comparing with the ultrastructural observations on the juvenile magnum region.
During development of the chicken oviduct, oviduct-specific gene expression and cytodifferentiation of epithelial to tubular gland cells is mainly triggered by steroid hormones. Basically, estrogen initiates the differentiation of progenitor cells of the epithelium into tubular gland cells in the magnum [
1,
27,
28]. These cells then synthesize and secrete large amounts of major egg-white proteins (ovalbumin, conalbumin, lysozyme, and ovomucoid) [
29]. It is therefore no wonder that chicken oviductal epithelial cells express steroid/nuclear hormone receptors, including PGR and ESR [
18,
19,
30,
31], which are induced by primary stimulation of estrogen and secondary stimulation of estrogen, progesterone, and glucocorticoids [
1,
27,
32]. In this study, the mRNA expression levels of
ESR1 and
PGR in the juvenile oviductal magnum were significantly higher than those of the adult oviductal magnum. This result represents
ESR1 and
PGR are expressed in the oviductal epithelia and may receive steroid hormone signals, which regulate the vigorous proliferation and cytodifferentiation from the epithelium to the tubular gland at the juvenile stage. These signals result in a massive increase in oviduct size and weight before sexual maturation. However, directly comparing
ESR1 and
PGR mRNA expression in the juvenile and adult oviductal magnum was difficult because cell types and their populations in juvenile and adult oviduct were obviously different. Furthermore, anti-OVA, anti-ESR1, and anti-PGR antibodies were more strongly and obviously bound to the outer layer of the tubular gland, compared with the inner layer of adult oviduct. In contrast, lectin WGA and ConA were localized in the tubular gland cells of both layers of tubular gland. This result suggests that tubular gland cells located in the inner layer are not activated and differentiated enough to secret granules as compared with those in the outer layer of the tubular gland.
With respect to reproductive biology, lectins are known to act as functional molecules that regulate cell adhesion binding to glycoproteins. Lectins allow the sperm reservoir to interact with the oviductal epithelium [
33]. Specifically, they bind to a soluble carbohydrate or to a carbohydrate moiety that is part of extracellular and intracellular glycoproteins. In numerous studies on the mammalian oviduct, lectins have been used to detect a variety of carbohydrate residues such as mannose [
34], fucose [
34], galactose (
N-acetylgalactosamine) [
35‐
37],
N-acetylglucosamine [
38], and
N-acetylneuraminic acid (sialic acid) [
38]. These studies also revealed that lectins such as Con A (concanavalin A; α-
D-mannose and α-
D-glucose) [
34], HPA (
Helix pomatia agglutinin;
D-
N-acetyl-galactosamine) [
35,
36], LTA (
Lotus tetragonolobus agglutinin; α-L-fucose), RCA 1 (
Ricinus communis agglutinin 1; β-
D-galactose), UEA-1 (
Ulex europaeus agglutinin-1; α-
L-fucose) [
39], and WGA (
Triticum vulgaris agglutinin;
D-
N-acetyl-glucosamine, and sialic acid) [
38] can be exploited to identify certain components such as epithelial cell types in the oviduct. Those lectins play a crucial role in the binding of spermatozoa to epithelial cells and gamete interactions [
8]. Lectin-binding sites on the oviduct show different patterns depending on age, region, sex cycle, and estrous cycle [
14,
40,
41]. Lectin studies, however, have primarily focused on the mammalian oviduct, and little is known regarding the chicken oviduct and glycoconjugates. In the present study, we revealed that lectins are selectively bound to the oviductal epithelium, stroma, and tubular gland layers. Particularly, lectin WGA and ConA bound to the electron-dense tubular gland cells in the chicken oviduct, which means that secretory granules of tubular gland are contained
N-acetylglucosaminyl, sialic acid,
D-mannosyl, and
D-glucosyl residues in adult oviduct. These results also indicate that changes in hormonal responsiveness in the oviductal magnum during development can generate differences in the expression of sugars and glycosylation patterns of egg-white proteins [
42]. We hypothesize that these carbohydrate modifications might be involved in oviduct-specific gene expression, such as ovalbumin, and sperm adhesion for the fertilization. However, further studies are necessary to confirm this postulate.
In the biopharmaceutical industry, glycosylation is critically related to protein reactivity and modulates the efficacy of therapeutic proteins [
43,
44]. The production of human pharmaceutical glycosylated proteins derived from mammalian cell lines have limited production capacity and require glycoengineering processes to add
N-linked glycosylation [
45]. Potential advantages of using transgenic chickens as bioreactors include the simplistic egg mixture, which is composed of approximately 11 major proteins, the massive production of eggs, and similarities with the glycosylation of
N- and
O-linked glycans of humans as compared with other mammals [
46,
47], which leads to a reduced potential risk for adverse immune responses to pharmaceutical proteins produced in eggs [
48]. For example, a study examining the glycosylation of IgGs in different species revealed that IgG from cows, sheep, and goats contain oligosaccharides with
N-glycoyslneuraminic acid (NGNA), whereas humans and chickens only incorporate
N-acethylneuraminic acid (NANA, referred to as sialic acid) [
47], which shows a prolonged serum half-life and increased biological activity [
49]. Pathways for both
N- and
O-linked glycosylation are highly activated in the tubular gland cells of the oviduct, which secrete egg-white proteins that are almost all glycosylated. In this study, lectin-binding patterns in egg-laying hens demonstrated the need for combination studies examining glycosylation profiles of lectins and egg-white proteins and their precursors in the oviductal magnum. These profiles could provide a better understanding of the glycosylation of pharmaceutical proteins generated from transgenic chickens, including
N-linked glycan and sialic acid, because the target tissue for producing recombinant proteins is the oviductal magnum. However, further studies would be necessary to characterize egg-white proteins and their precursors in the tubular gland of the oviductal magnum, classify sialic acid and
N-acetyl-glucosamine that bind to lectin WGA, and identify the glycosylation profiles of therapeutic proteins from the oviduct.
Consequently, it is the first study to combine ultrastructural analysis, immunohistochemistry, and lectin-binding patterns of the juvenile and adult oviductal magnum in chickens. This study contributes to our understanding of the mechanisms underlying avian reproductive biology and transgenesis. In addition, these results can help to conduct further studies such as in vitro culture of oviductal cells, development of novel markers, glycoengineering for bioreactors, female reproductive biology, and immortalized cell-lines for producing exogenous proteins in vitro.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
JGJ designed and performed all the experiments and drafted the manuscript. WL contributed to the tissue sampling. TSP and GS participated in the design of the study, data analysis and drafted the manuscript. JNK and BKH carried out experimental animal management and participated manuscript writing. JYH, as a corresponding author, designed the experiments, analyzed experimental data and drafted the manuscript. All authors read and approved the final manuscript.