Successful establishment of primary small airway cell cultures in human lung transplantation

Foetal Calf Serum (FCS), RPMI-1640 media, penicillin G, streptomycin sulphate, amphotericin B and L-glutamine were purchased from Invitrogen (Melbourne, Australia). Insulin, bovine serum albumin (BSA), hydrocortisone, recombinant human epidermal growth factor (EGF), epinephrine hydrochloride, triiodothyronine, retinoic acid, trypsin and gentamycin were obtained from Sigma (St. Louis, USA). Bronchial epithelium basal medium (BEBM) was purchased from LONZA™ (Basel, Switzerland). Ultroser G was supplied from Ciphergen (Cergy-Saint-Christophe, France). Collagen S (type I) as well as fibronectin were purchased from Roche (Dee Why, Australia). All tissue culture plastic ware was obtained from Sarstedt (Mawson Lakes, Australia).

A total of 62 bronchoscopies were performed in 26 patients (11 female; aged 18 to 64 years (median 51 years); 4 BOS). Patient demographics are summarized in Table 1. BOS was diagnosed and graded according to international guidelines [2]. The study was approved by the Royal Perth Hospital Human Research and Ethics Committee.

Human airway epithelial cells (AEC) were collected using a bronchial brush during routine surveillance and diagnostic post-transplant bronchoscopies. Bronchoscopy was conducted under general anaesthesia with a laryngeal mask or endotracheal tube. The bronchoscope(Olympus^® Evis EXERA II) was wedged in a suitable lateral segment of the right or left lower lobe. Prior to the acquisition of transbronchial biopsies, the sheathed nylon cytology brush (10 mm, 2 mm outer diameter, Olympus BC-25105, Waverley, Australia) was passed down the working channel of the bronchoscope and then unsheathed under radiological guidance with the brush tip lying 2-3 cm from the pleural surface. Small airway brushings (2-3 brushings) were collected from this area (Fig. 1).

Large airways brushings (*2-3) were obtained from segmental bronchi in the standard way. In both cases, brushings were collected into a tube containing 2 ml of RPMI on ice and the brush tip was also cut off and collected after the final brushing. After the completion of brushings, 20% (v/v) FCS was added to the tubes and processed immediately. Tubes and brushes were kept separate for large and small airways to prevent cross contamination. The lung apex was screened to exclude a pneumothorax as part of routine care following a transbronchial biopsy.

During processing, the cells were fractionated for RNA archiving, cytospins and cell culture as previously described [8]. Successful culture establishment was assessed as previously described [8] and cultures were passaged at 90% confluence. Additionally, a human bronchial epithelial cell line (16HBE14o^-; provided by Dieter Gruenert, University of California San Francisco, USA) was also utilised and maintained as previously described [8].

Primary SAEC and LAEC were maintained in Bronchial Epithelial Basal Media (BEBM) (Lonza™) supplemented with 2% (v/v) Ultroser G, 50 μg/mL bovine pituitary extract, 0.5 μg/mL hydrocortisone, 5 ng/mL human epidermal growth factor, 0.5 μg/mL epinephrine, 6.5 ng/mL triiodothyronine, 5 μg/mL insulin, 1 ng/mL retinoic acid, 10 μg/mL transferrin, and 0.001% gentamycin (v/v). 16HBE14o^- cells were maintained in Dubelco's Minimum Essential Media (DMEM) (Invitrogen (Melbourne, Australia)), FCS (10%, v/v), penicillin (100 U/ml), streptomycin (100 μg/ml) and amphotericin B (2.5 μg/ml). All cell cultures were grown in a NUAIRE (Plymouth, USA) incubator at 37°C in an atmosphere of 5% CO₂/95% air under strict aseptic conditions.

Cells from the cultures before the first passage (p0) and after the second passage (p2) of both SAEC and LAEC were cytospun onto glass slides and epithelial lineage verified by immunocytochemistry (ICC) as previously described [8]. First passage (p0) and p2 were specifically chosen because most experiments were conducted at p2 and cells were generally not propagated beyond that. Briefly, cytospins were incubated with primary antibodies specific for mesenchymal (Vimentin 1:250) (Santa Cruz Biotechnology Inc., Santa Cruz, USA), endothelial (von Willebrand factor 1:500) (Santa Cruz Biotechnology Inc., Santa Cruz, USA), macrophage (CD68 1:500) (DAKO Corp, Carpinteria, USA), dendritic (CD1a 1:250) (Santa Cruz Biotechnology Inc., Santa Cruz, USA), and epithelial lineages (AE1-AE3 1:250) (DAKO Corp, Carpinteria, USA) for 24 hours at 4°C followed by fluorescently conjugated secondary antibodies for a similar period. Secondary antibodies included; anti-mouse FITC conjugate (1:100), anti-goat FITC conjugate (1:100) and anti-rabbit FITC conjugate (all Sigma, St. Louis, USA). The slides were observed under a fluorescent microscope (Leica Microsystem Pty. Ltd., Wetzlar, Germany) for staining. AE1-AE3 was chosen as the positive marker for epithelial cells since it is a mixture of clones AE1 and AE3. AE1 detects high molecular weight keratins 10, 14, 15, and 16 as well as low molecular weight cytokeratin-19. Clone AE3 detects the high molecular weight cytokeratins 1, 2, 3, 4, 5, and 6, and the low molecular weight cytokeratins 7 and 8. By combining the two reagents a broad spectrum of reactivity is achieved.

When cells reached 90% confluence in culture, they were trypsinised, collected and resuspended in 1 ml of RPMI. The cell suspension was then fractionated and a 350 μl aliquot was centrifuged and pelleted cells stored in RLT buffer (QIAGEN, Hamburg, Germany). RNA was extracted using QIAGEN RNA Easy Mini Kit. The remainder of the cell suspension was seeded into pre-coated flasks to continue propagation of the culture. Lineage was verified by analysing mRNA from a representative group of cultures chosen at random from patients who were not diagnosed with BOS. Quantitative polymerase chain reaction (qPCR) was used to assess expression of the Clara Cell Secretory Protein (CCSP), which is uniquely expressed by small airway epithelial cells, and surfactant protein B (SP-B), which is commonly expressed by non-ciliated bronchial epithelial cells [9] and type II alveolar cells [10]. Lineage verification was carried out on mRNA from cultures at p0 and p2. Gene expression was analyzed using two-step reverse transcription polymerase chain reaction (RT-PCR) and cDNA synthesized using hexanucleotide primers and Multiscribe™ Reverse Transcriptase (Applied Biosystems, Foster City, USA) in a final reaction volume of 20 μL containing 1 × RT buffer (Promega Madison, USA), 5.5 mM MgCl₂, 0.5 mM of each of the dNTPs, 2.5 μM random hexamers, 0.4 U RNase inhibitor, 1.25 U Multiscribe (Applied Biosystems, Foster City, USA) reverse transcriptase and 200 ng RNA. All reactions were performed under the following conditions: initial primer incubation step at 25°C for 10 minutes followed by RT incubation at 48°C for 1 hour and ended by reverse transcriptase inactivation at 95°C for 5 minutes. The cDNA was then used in a final PCR reaction volume of 25 μL containing 1× Sybr Green PCR master mix (Applied Biosystems, Foster City, USA), 0.5 μM each of forward and reverse primers and 5 μL of cDNA (1:5). The conditions for the PCR include initial incubation at 50°C for 2 minutes, AmpliTaq Gold activation at 95°C for 10 minutes followed by 40 cycles of 15 seconds at 95°C and 1 minute at 60°C. The sequences of the primers used included;CCSP; forward; '5AAACCCTCCTCATGGACACAC3' and reverse '3GACGGTACGAAACTCAGGT5', SP-B; forward; '5TCACACACAGGATCTCTCCG3' and reverse 3'AGGTCGTGGTAGGTGTGGAG5', 18S; forward; '5TAACCCGTTGAACCCCATTC3' and reverse '3TCCAATCGGTAGTAGCGACG5'.

Quantitative PCR was performed using the ABI Prism 7700 Sequence Detection System (Perkin-Elmer, USA) and signals were analyzed by the ABI Prism Sequence Detection System software version 1.9. Expression of CCSP and SP-B was quantified relative to the expression of 18S.

All results were tested for population normality and homogeneity of variance and are presented as mean ± SEM unless otherwise specified. Comparisons were made using odds ratios for dichotomous variables and Student's t-test for continuous variables. p values < 0.05 were considered to be significant.

Cell cultures were successfully established from both large and small airway brushings with a similar success rate (83.8 ± 4.7% and 79.0 ± 5.2%; p = 0.49 respectively). Established cultures reached confluence within a median 21 days (range 13 - 57 days) and maintained a polygonal, cobblestone appearance, typical of epithelial cells. No major morphological variations were observed between LAEC and SAEC over the life of the culture (Fig 3). Immunocytochemistry conducted on cells from passage 0 (p0) and passage 2 (p2) with epithelial, and mesenchymal markers confirmed the preservation of epithelial lineage of the cells.

Culture fates are presented in Table 2. Successful establishment was limited predominantly by superinfection by organisms colonizing the transplanted organ (2 patients, A. fumigatus and S. aureus) and low cell yield. The latter problem was confined to SAEC - failure of five of the cultures could be attributed to low cell yield and they were all from small airway brushings. The mean cell yield for the five failed cultures was 0.326 ± 0.055 × 10⁶ cells, which is significantly lower than the cell yield for successful cultures (1.071 ± 0.070 × 10⁶ cells; p < 0.01). The presence of BOS significantly compromised culture success for SAEC (odds ratio (95%CI) 0.067 (0.01-0.40)) but not for LAEC (0.3 (0.05-1.9)). Since the cell yield was not different for BOS SAEC, poor culture establishment did not appear to be related to low starting cell numbers.

Morphological analysis of established cultures over repetitive passage showed that the typical cobblestone morphology indicative of epithelial cells was maintained over culture duration. Epithelial lineage was further verified at each passage via immunocytochemical staining. Cultured SAEC and LAEC stained intensely and exclusively for the epithelial specific marker, AE1-AE3 (cytokeratin) at both p0 and p2. No expression was observed for mesenchymal (Vimentin), macrophage (CD68), dendritic (CD1a) or endothelial (Von Willebrand Factor) lineage markers at either passage (Fig. 4).

Lineage verification of established cultures was then assessed using known and suggested markers of small airway epithelium [11, 12]. Here, we assessed small airway gene expression of CCSP and SP-B using qPCR on RNA extracted from cultures at p0 and p2. CCSP was exclusively expressed in SAEC (4592 ± 743.4 fold normalized to 18 s at p0; 7148 ± 5385 fold normalized to 18 s at p2) compared to LAEC (11.56 ± 9.113 fold normalized to 18 s at p0, p = 0.0001; 235 ± 275.6 normalized to 18 s at p2, p = 0.0113). CCSP was not expressed in a LAEC immortalized cell line (16HBE14o^- cells (Fig. 5A &5B)). To exclude an alveolar source for the small airway brush cellular material, SP-B gene expression was also assessed in large and small airway cell cultures at p0 and p2. SP-B was expressed only at low levels in both SAEC and LAEC at p0 and p2. There was no difference between SAEC and LAEC SP-B expression (p = NS at both p0 & p2). SP-B was not expressed by 16HBE14o^- cells (Fig. 5C &5D).