Introduction
Dendritic Cells (DCs) are the most potent antigen-presenting cells (APCs), having a role on both priming the adaptive immune response and induction of immunological tolerance[
1‐
3]. DCs can be either immunostimulatory or immunoregulatory; it has been demonstrated that the properties of DCs depend on maturation status, phenotype and source of origin. In general, mature DCs express high levels of CD11C, major histocompatibility complex class II (MHC II) and the costimulatory molecules CD40 and CD80. DCs that inhibit immune responses have been described as immature, having plasmacytoid morphology, or being alternatively activated. Collectively, suppressive DCs have been termed “tolerogenic DCs”. Previous studies have demonstrated that donor-specific, allogeneic tolerogenic DCs can enhance survival of transplanted grafts[
4,
5].
T cells require two signals to become fully activated. The first signal, which is antigen-specific, is provided through the T cell receptor which interacts with peptide-MHC molecules on the membrane of APCs. A second signal, the co-stimulatory signal, is antigen nonspecific and is provided by the interaction between co-stimulatory molecules expressed on the membrane of APCs and the T cells. T cell co-stimulation is necessary for T cell proliferation, differentiation and survival. Activation of T cells without co-stimulation may lead to T cell anergy, T cell deletion or the development of immune tolerance[
3,
6,
7].
Multiple costimulatory pathways are involved in primary T cells activation. CD28/Cytotoxic T-Lymphocyte Antigen 4 (CTLA4) binding to CD80/CD86 was the first costimulatory pathway identified and is one of the most potent and best characterized of costimulatory interactions[
8,
9]. CD80/CD86 on APCs ligated with their receptors CD28/CTLA4 on T cells could regulate T cell responses. Interaction through CD80/CD86-CD28 pathway is crucial for enhancing T cells activation and survival, however, the CD80/CD86-CTLA4 pathway is mainly for regulating inhibitory T cell responses. CD40 is a type I transmembrane protein which belongs to the TNF receptor superfamily and is found to be expressed on all types of antigen-presenting cells (APCs), particularly on DCs[
10]. CD40 on DCs bind to T cell CD40 ligand (CD40L) and activate T cells by upregulating CD80 and CD86 on DCs. As well, this interaction can induce high levels of the proinflammatory cytokine IL-12, which is critical for the development of Th1 type immune responses[
11,
12]. The blockade of the CD40-CD40L pathway will result in a deficiency in APC interaction, which will also lead to the global failure of T cell activation[
13,
14]. Costimulation blockade targeting either CD28-CD80/CD86 or CD40-CD40L alone rarely gave durable allograft survival. Therefore, simultaneous blockade of these two pathways has synergistic function in promoting allograft tolerance[
15].
Gene silencing by using small interfering RNA (siRNA) is capable of specifically blocking gene expression in mammalian cells without triggering the nonspecific panic response[
16,
17]. The strategies of using siRNA have been successful in inducing therapeutic benefits in animal models of various diseases and are currently in clinical trials[
18‐
23]. To date, blockade of the costimulatory molecules is being aggressively pursued as a tolerance-inducing strategy[
24]. Inhibition of this bidirectional interaction not only suppresses T cell responses[
25] and Th2 cytokines, but also actively generates regulatory T (Treg) cells[
26]. In the present study, we investigated the feasibility of silencing both CD40 and CD80 expression by siRNA treatment in the recipient to induce longer cardiac allograft survival.
Methods and material
Mice
Male 8–10 week old C57BL/6 and BALB/c mice (Charles River Canada, Saint-Constant, Canada) were used as donors and recipients, respectively. Animals were housed under conventional conditions at the Animal Care Facility, University of Western Ontario, and were cared for in accordance with the guidelines established by the Canadian Council on Animal Care.
DCs culture
DCs were cultured from bone marrow progenitor cells as previously described[
27]. Briefly, bone marrow cells were flushed from the femurs and tibias of C57BL/6 mice then washed and cultured in 6-well plates supplemented with 10 ng/ml of recombinant GM-CSF and recombinant mouse IL-4 (Peprotech, Rocky Hill, NJ, USA). All cultures were incubated at 37°C in 5% humidified CO
2.
CD40 and CD80 siRNA and expressed siRNA vector constructs
For in vitro studies, CD40 and CD80 siRNA were synthesized by Dharmacon (Chicago, IL). The sequence of CD40 siRNA used was UUCUCAGCCCAGUGGAACA, and the sequence of CD80 used was GUGUGGCCCGAGUAUAAGA. The DCs were transfected with siRNA by using lipofectamine 2000 (Life technologies, Burlington).
For
in vivo studies, the siRNA expression vector was constructed as previously described[
28,
29]. The oligonucleotides containing target-specific sense and anti-sense sequences of CD40 and CD80 mRNAs were synthesized, annealed and inserted into the pRNAT U6.1 siRNA expression vector utilizing restriction enzyme sites at the end of the strands (Genscript, Piscataway, NJ) to express the siRNAs.
Heterotopic cardiac transplantation and treatment
Recipients (BALB/c) were treated with CD40 and CD80 siRNA vectors 3 days prior to heart transplantation and 7, 14 and 21 days after transplantation by hydrodynamic injection. 50 μg of CD40 and CD80 siRNA vectors were diluted in 1.6 ml of PBS and rapidly injected into the mice through the tail vein within 5-7s[
23,
30,
31]. A low dose (2Gy) of whole body irradiation was administered to the recipient mice before heart transplantation. Recipient BALB/c (H-2
d) mice were subjected to intra-abdominal allogeneic cardiac transplantation using the hearts from fully MHC-mismatched C57BL/6 (H-2
b) mice. Pulsation of cardiac grafts was monitored daily by direct abdominal palpation in a double-blind manner to determine survival/rejection of the cardiac graft.
Quantitative real-time PCR (RT-PCR)
Total RNA was extracted from cells using Trizol (Invitrogen). Total RNA (3 μg) was used for cDNA synthesize using oligo-(dT) primer and reverse transcriptase (Invitrogen). Primers used to amplify murine CD40, CD80, FoxP3 and GAPDH genes were: CD40, 5′- AGCGGTCCATCTAGGGCAGTGTG -3′ (forward) and 5′- TGGGTGGCATTGG GTCTTCTCA-3′ (reverse); CD80, 5′- GCCTCGCTTCTCTTGGTTG - 3′ (forward), 5′- TTACTGCGCCGAATCCTG-3′ (reverse); FoxP3, 5′- CAGCTGCCTACAGTGCCCCT AG-3′(forward), 5′- CATTTGCCAGCAGTGGGTAG-3′ (Reverse); GAPDH, 5′- TGA TGACATCAAGAAGGTGGTGAA-3′ (forward) and 5′- TCCTTGGAGGCCATGTAG GCCAT -3′ (reverse). Real-time PCR reactions were performed in a Stratagene Mx3000P QPCR System (Agilent Technologies, Lexington, MA) using SYBR green PCR Master Mix (Life technologies) according to manufacture’s protocol. The PCR reaction condition was 95°C for 10 min, and 95°C for 30 sec, 58°C for 45 sec and 72°C for 30 sec (40 cycles).
Flow cytometry
Characterization of DCs or T cells was performed by flow cytometer (Becton Dickinson, San Jose, CA). All antibodies were purchased from eBioscience, San Diego, CA, unless otherwise indicated.
DCs were stained with FITC- or PE-CD40 and PE-CD80 monoclonal antibodies. For T cells, PE-Cy5-CD4, FITC-FoxP3, and PE-CD25 conjugated anti-mouse monoclonal antibodies were used for staining. Foxp3 expression was assessed by intracellular staining, using Foxp3 Staining Kits (eBioscience). All flow cytometric analysis was performed using appropriate isotype controls (Cedarlane Laboratories).
Mixed lymphocyte reaction (MLR)
For in vitro MLR, T cells (2 × 105/well) from naïve BALB/c mice were plated with DCs cultured from C57BL/6 mice in varying ratios of DC:T cells. For in vivo MLR, splenic DCs isolated from tolerant or rejecting recipients (BALB/c) using CD11c MACS beads (Miltenyi Biotec) were irradiated at 30 Gy. T cells (2 × 105/well) from C57BL/6 mice were added to the DC cultures, with the final MLR taking place in 200 μl of complete RPMI 1640 medium (Life Technologies). Cells were cultured at 37°C in a humidified atmosphere of 5% CO2 for 3 days, and pulsed with 1 μCi of [3H] thymidine (PerkinElmer, Woodbridge, ON) for the last 18 h of culture. Cells were harvested onto glass fiber filters, and the incorporated radioactivity was quantified using a Wallac Betaplate liquid scintillation counter. Results were expressed as the mean counts per minute (cpm) of triplicate cultures ± SEM.
To determine the ability of Treg to perform the inhibitory MLR splenic T cells (2 × 105/well) from naïve BALB/C mice were used as responder cells. Cultured bone marrow DCs (1 × 105) from naïve C57BL/6 and C3H (third party) mice were used as stimulators. CD4+CD25+ cells isolated from spleens of tolerant recipient mice using a Treg cells isolation kit (Miltenyi Biotec) were added to the cultures; ratios of Treg:stimulator were 1:100, 1:20, 1:10. Experimental procedures used to incubate and harvest cells were the same as described above.
Graft histology
At the experimental endpoint, cardiac tissue samples were collected and fixed in 10% buffered formaldehyde and processed for histology examination using standard techniques. Specimens were embedded in paraffin, and sectioned for H&E staining. The microscopic sections were examined in a blinded fashion by pathologist for rejection. Criteria for allograft rejection included the presence of myocardial infarction, lymphocytic infiltration, thrombosis and hemorrhage.
Statistical analysis
In this study, data were reported as the mean ± SEM. Allograft survival among experimental groups was compared using the log-rank test. Quantitative real-time PCR data were analyzed using one-way ANOVA. Differences with P values less than 0.05 were considered significant.
Discussion
Gene silencing offers the possibility of downregulating genes of interest in a specific and potent manner. Previous studies by our group have demonstrated that immature DCs, or DCs whose costimulatory molecules are silenced, are capable of promoting donor-specific tolerance, in part through induction of Treg cells[
27]. In the current study, we sought to utilize a clinically translatable approach, by targeting costimulatory molecules in the recipient through systemic administration of siRNA expressing vectors using hydrodynamic administration. We utilized DCs
in vitro as a model to assess whether the siRNA that we generated was sufficient for downregulating expression of CD40 and CD80. These molecules were chosen based on previous studies showing importance of these costimulators in blocking transplant rejection[
36,
37]. We observed that siRNA treatment resulted in specific downregulation of CD40 and CD80 molecules, without non-specific activation of the DC. Furthermore,
in vitro modulation of DC function was observed such that silenced stimulator DCs were hypoimmunogenic as compared to scrambled siRNA treated DCs in MLR. An additive suppressive effect was seen in MLR when CD80 and CD40 siRNA were simultaneously to treat stimulator DCs.
Gene silencing of DCs was also observed
in vivo subsequent to hydrodynamic administration of siRNA expression vector. Splenic DCs isolated from siRNA treated mice possessed specific suppression of CD40 or CD80 expression, subsequent to treatment with their respective siRNA sequences. It may be possible that hydrodynamic administration of siRNA vectors resulted in downregulation of costimulatory molecules on other cells as well, as it has been found that endothelial cells express both CD40 and CD80 and these molecules may be involved in allograft rejection[
38]. Indeed, previous studies have demonstrated that hydrodynamic administration of siRNA results in endothelial cell transfection[
39]. We plan to assess whether silencing in other cells besides DC occurs.
The demonstration of extended allograft survival by recipient treatment with siRNA vector suggests the possibility of developing clinically-relevant protocols for induction of transplantation tolerance. While clinical implementation of hydrodynamic administration is not practical, a more feasible means of recipient modification may be through administration of DC targeted immunoliposomes, which was previously demonstrated by our group[
40].
The demonstration of prolonged allograft survival by targeting of recipient costimulatory molecules suggests the possibility of inhibiting indirect antigen presentation. In the process of direct antigen presentation, donor MHC alloantigens are recognized by alloreactive T cells which are found in relatively high frequencies between, 1:100 and 1:10,000 T cells in humans[
41]. In contrast, the process of indirect antigen presentation involves recipient antigen presenting cell uptake of the donor antigen, processing of the antigen, and presentation of peptides in the context of self MHC. The frequency of alloreactive T cells with specificity for antigens presented through the indirect pathway is significantly less than for direct antigen presentation, which occurs with a frequency of T cells between 1:100,000–1:1,000,000 T cells[
42]. Accordingly, the large number of existing T cells in the direct antigen presentation pathway leads to relatively rapid allograft rejection. In our previous study, ex vivo perfusion of siRNA solution into heart graft effectively attenuated ischemia/reperfusion injury and protected cardiac function[
43]. It has not yet been reported the feasibility of perfusing allografts ex vivo using siRNA for prevent immune rejection. Indeed, perfusion of the allograft
ex vivo might lead to knocking down costimulatory molecules in donor-derived DC thus blocking the direct pathway of rejection. However, this strategy is not able to block the recipient's DC-medicated indirect pathway which induces chronic rejection. Acute rejection in this scenario is effectively controlled by clinical immune suppressants, however, chronic rejection appears to be resistant to current immune suppressants and is the major cause of graft failure today[
44]. Given that the mechanism of extended graft prolongation in our study was obtained via the manipulation of recipient antigen presenting cells, we propose that this approach of manipulating the recipient may be more effective at preventing chronic graft rejection in the future. This is supported by the histological observations of reduced signs of chronic rejection such as hemorrhage, infarction and thrombosis.
Mechanistically, prolongation of allograft survival by the CD40 and CD80 combination may be associated with development of a “tolerogenic feedback loop” between Treg cells and DC[
34]. In this scenario, hydrodynamic delivery of siRNA-expression vector by systemic administration may suppress the costimulatory molecules on DCs from donor grafts or DCs in recipients. For example, we have identified tolerogenic DCs in tolerant recipients that demonstrated attenuated the alloimmune stimulatory capacity (Figure
6A). These tolerogenic DCs would result in generation of Treg cells, which then would further induce an immature state in the DCs. Such tolerogenic loops have been previously demonstrated through induction of immature DC by blockade of IkB together with Treg stimulation by antiCD45 antibodies[
34]. Indeed the possibility of amplifying such tolerogenic loops by administration of agents that increase the number of Treg cells, which has previously been clinically applied using non-Fc binding antiCD3[
45], may be assessed in future experiments to augment the tolerogenic process.
In conclusion, the current paper provides proof of concept for the utilization of siRNA in modifying recipient responses to allogeneic transplantation. The possibility of inhibiting chronic rejection through targeting the indirect pathway of antigen presentation suggests a possibility to overcome limitations of current immune suppressants.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
Competing interests
The authors of this manuscript have no conflicts of interest to disclose.
Authors’ contributions
Xu Z, YL, GZ: performed experiments and wrote the manuscript. DL: performed heart transplantation surgery. AJ, KS and RC: helped with sample collections. DK and NJ: edited the manuscript. JS, XZ, Xi Z, ZZ, DQ, and WM: study design and edited the draft manuscript. All authors read and approved the final manuscript.