Gene silencing of IL-12 in dendritic cells inhibits autoimmune arthritis

Male DBA/1 LacJ and BALB/c mice (The Jackson Laboratories, Bar Harbor, ME), 5 weeks of age, were kept in filter-top cages in the Animal Care and Veterinary Services Facility at the University of Western Ontario according to the Canadian Council for Animal Care Guidelines. Mice were fed by food and water and allowed to settle for 2 weeks before initiation of experiments, which had ethical approval from the university review board.

DBA/1 LacJ mice, 7 weeks of age, were intradermally immunized (Day 0) at several sites into the base of the tail with 200 μg of bovine type II collagen (CII) (Sigma-Aldrich, St. Louis, MO) dissolved in 100 μl of 0.05 M acetic acid and mixed with an equal volume of complete Freund's adjuvant (CFA) (Sigma). CII was dissolved at a concentration of 2 mg/ml by stirring overnight at 4°C. On day 21 after priming, the mice received an intraperitoneal booster injection with 200 μg of CII in the equal volume (100 μl) of PBS. Mice were examined visually three times per week for the appearance of arthritis in the peripheral joints, and arthritis score index for disease severity was given as follows: 0 - no evidence of erythema and swelling; 1 - erythema and mild swelling confined to the mid-foot (tarsals) or ankle joint; 2 - erythema and mild swelling extending from the ankle to the mid-foot; 3 - erythema and moderate swelling extending from the ankle to the metatarsal joints; 4 - erythema and severe swelling encompass the ankle, foot, and digits. Scoring was done by two independent observers, without knowledge of the experimental and control groups.

At Day 0, bone marrow cells were flushed from the femurs and tibias of DBA/1 LacJ mice, washed and cultured in 6-well plates (Corning, NY) at 4 × 10⁶ cells/well in 4 ml of complete medium (RPMI 1640 supplemented with 2 mM L-glutamine, 100 U/ml penicillin, 100 μg of streptomycin, 50 μM 2-ME, and 10% FCS (all from Life Technologies, Ontario, Canada) supplemented with recombinant GM-CSF (10 ng/ml; PeproTech, Rocky Hill, NJ) and recombinant mouse IL-4 (10 ng/ml; PeproTech). All cultures were incubated at 37°C in 5% humidified CO₂. Non-adherent cells were removed after 48 h of culture (Day 2) and fresh medium was added every 48 h.

siRNA sequences were selected according to the method of Elbashir SM et al. [36]. The siRNA sequence specific for IL-12p35 (AACCUGCUGAAGACCACAGAU) was selected and cloned into Psilencer 3.1 vector (Ambion, Austin, TX) which expresses short hairpin RNA (shRNA) under the control of the mouse U6 promoter, using the method described by the supplier of the vector. IL-12 shRNA was sequenced and prepared in a large scale for in vitro and in vivo study. Gene silencing was examined with DC. DC were generated from bone marrow progenitor cells as previously described [35]. Transfection of DC was conducted as described previously [36]. 24 h before transfection (day 4), DC were plated to be 60-90% confluent on the day of transfection. On day 5, 2 μg of IL-12 shRNA and 3 μl of GenePORTER reagent (Gene Therapy Systems, San Diego, CA) were separately diluted with serum-free medium RPMI 1640 using 1/2 of the transfection volume (125 μl). The diluted DNA was added to the diluted GenePORTER reagent, mixed rapidly and incubated in total volume of 250 μl of the medium at room temperature for 45 min. The culture medium from the DC was aspirated, and the DNA-GenePORTER mixture was added carefully to the DC. Mock controls were transfected with 3 μl of the GenePORTER reagent alone. After 4-h incubation, an equal volume of RPMI 1640 (250 μl) supplemented with 20% FCS was added to the cells. 48 h after the start of transfection (day 7), DC were washed and pulsed with 10 μg/ml of CII for 24 h. At day 8, DC were then activated with LPS/TNF-α for additional 24 h. 7 days before and/or 12 days after priming with CII, different groups of mice with 6 animals per group were i.p. injected with shRNA-transfected or control DC at a dose of 5 × 10⁶ cells per mouse.

Total RNA was extracted from cells using Trizol (Invitrogen). 3 μg total RNA was used to synthesize the cDNA with oligdT and reverse transcriptase (Invitrogen) in 20 μl reaction volume. Primers used for the amplification of murine IL-12, IFNγ, IL-2, IL-4, IL-10 and GAPDH were as follows [37]: IL-12, 5'- CTT GCC CTC CTA AAC CAC CTC AGT-3' (forward) and 5'- CCA CCA GCA TGC CCT TGT CTA-3' (reverse); IFNγ, 5'- CAC GGC ACA GTC ATT GAA AGC CTA-3' (forward) and 5'- TGA GGC TGG ATT CCG GCA ACA GCT-3' (reverse);

IL-2, 5'- ACA TTG ACA CTT GTG CTC CGT GTC-3' (forward) and 5'- TTG AGG GCT TGT TGA GAT GAT GCT-3' (reverse); IL-4, 5'- AGC TAG TTG TCA TCC TGC TCT TCT-3' (forward) and 5'- CGA GTA ATC CAT TTG CAT GAT GCT-3' (reverse); IL-10, 5'- GAA GAC AAT AAC TGC ACC CAC TTC-3' (forward) and 5'- ATG GCC TTG TAG ACA CCT TGG TCT-3' (reverse); GAPDH, 5'-TGA TGA CAT CAA GAA GGT GGT GAA-3' (forward) and 5'-TGG GAT GGA AAT TGT GAG GGA GAT-3' (reverse).

Polymerase chain reaction (PCR) was performed in a 25 μl of reaction volume containing 0.2 μmol/L primers, 1 U Taq DNA polymerase under the following conditions: 95°C for 30 s, 58°C for 30 s, and then 72°C for 30 s (30 cycles). PCR products were visualized with ethidium bromide on 1.5% agarose gel.

At day 5 of culture, bone marrow-derived DC from DBA/1 LacJ mice were transfected with IL-12 and scrambled siRNAs or mock-transfected followed by activation with LPS/TNF-α. Activated DC were irradiated (3,000 rad) and seeded in triplicate in a flat-bottom 96-well plate (Corning) for use as stimulator cells. Spleen T cells from BALB/c mice were isolated by gradient centrifugation over Ficoll-Paque (Amersham Pharmacia Biotech, Quebec) and added as responders (5 × 10⁵ cells/well). The mixed lymphocytes were cultured at 37°C for 72 h in 200 μl of RPMI 1640 supplemented with 10% FCS, 100 U/ml of penicillin, and 100 μg/ml of streptomycin and pulsed with 1 μCi/well of ³H-labelled thymidine (Amersham Pharmacia Biotech) for the last 16 h of culture. Finally, cells were harvested onto glass fiber filters, and the radioactivity incorporated was quantitated using a Wallac Betaplate liquid scintillation counter (Beckman, Fullerton, CA). Results were expressed as the mean counts per min of triplicate cultures ± SEM.

T cell proliferative responses to CII in subsequent groups of mice were measured with a standard microtiter assay. Following CII immunization, the proliferative responses could be detected for several weeks. Immune cells from either draining lymph node or spleen T cells collected from the mice treated with CII and IL-12 silenced DC or control DC, at 5 × 10⁵/well were seeded to a 96-well flat-bottom microtiter plate (Corning) in triplicates and mixed with serial dilutions of CII with concentrations ranging from 5 to 50 μg/well. Following a 72 h incubation, 1 μCi of [³H] thymidine (Amersham) was added to each well for 16 h. Using an automated cell harvester, the cells were collected onto glass microfiber filter, and the radioactive labeling incorporation was measured by a Wallac Betaplate liquid scintillation counter.

CII-specific Abs were evaluated using a standard indirect ELISA in which 500 ng of CII was absorbed to each well of a 96-well microtitre plate. Following blocking and washing steps, serial dilutions of immune mouse serum were added to the appropriate wells in duplicates and incubated overnight at 4°C. Dilutions of serum were 1:100-1:100,000. To develop the ELISA, horseradish peroxidase-conjugated goat anti-mouse IgG Fc and ortho-phenylenediamine dihydrochloride substrate buffer (Sigma) were used. The OD of each well was measured at a wavelength of 490 nm in an ELISA plate reader.

Mock or shRNA-transfected DC of DBA/1 LacJ origin were cultured with the allogeneic (BALB/c) T cells or alone for 48 h. The supernatants were collected and assessed for DC cytokines (IL-10 and IL-12) and T cell cytokines (IFN-γ and IL-4) by ELISA. Cytokine-specific ELISA (Endogen, Rockford, IL) was used for detecting cytokine concentrations in culture supernatants according to the manufacturer's instructions using a Benchmark Microplate Reader (Bio-Rad, Hercules, CA).

Paws from experimental and control groups of freshly dissected mice were removed and joint tissues were immersion-fixed for 4 day in 10% (wt/vol) neutral buffered formalin in 0.15 M PBS (pH 7.4). After decalcification by immersing in Decalcifier I solution (Winnipeg, Canada) overnight and subsequent dehydration in a gradient of alcohols, tissues were rinsed in running water. The specimens were processed for paraffin embedding in paraplast (BDH, Dorset, UK) as routine procedure. Serial paraffin sections throughout the joint were cut at 5-μm thickness on a microtome, heated at 60°C for 30 min, and deparaffinized. Hydration was done by transferring the sections through the following solutions: triple to xylene for 6 min, and then for 2 min to 100% ethanol twice, 95% ethanol, and 70% ethanol. Sections were stained with H&E and mounted on glass slides.

Transfected DCs were treated with 20 ng/ml phorbol myristate acetate and stained with FITC-conjugated IL-12. Ig of the same isotype was used as controls. Flow cytometry analysis was performed in a FACScan II (Becton Dickinson, San Jose, CA- BD) system using FACSDiva software (BD).

Silencing of IL-12p35 on bone marrow derived DC was previously performed by our group using presynthesized siRNA [35]. Although this approach is widely used, one disadvantage is the relatively low efficacy due to consumption of the exogenously administered siRNA. An alternative approach would be to induce the cell to produce siRNA endogenously. One way of achieving this is using so-called DNA-directed RNAi (ddRNAi), which utilizes a DNA construct expressing double stranded RNA. Accordingly we transfected DC with a vector comprising a hairpin loop of siRNA (shRNA), driven by U6 promoter.

We determined the gene silencing efficacy of IL-12 shRNA on DC by RT-PCR (Figure 1A). IL-12 shRNA reduced IL-12 expression on DC by 3-fold as compared with control. The gene silencing effect of IL-12 shRNA was further confirmed at the protein level by intracellular staining with anti-IL-12 antibody using flow cytometry (Figure 1B). These data suggest feasibility of specific gene silencing in DC using the shRNA approach.

IL-12 is an important cytokine for the interaction of DC and T cells. IL-12 secreted by DC controls T helper cell deviation. Thus, we assessed whether silencing of IL-12p35 using shRNA would alter the ability of the DC to modulate a Th1 to Th2 shift. Using an allogeneic system, we co-cultured C57/BL6 DC, treated with IL-12 shRNA, together with responder BALB/c T cells. This resulted in a predominant Th2 cytokine profile (e.g. high IL-4, low IFN-γ), as compared to the co-culture with DC treated with control shRNA which possessed a Th1 profile (Figure 2A). We next tested the antigen presentation capacity of DC after gene silencing of IL-12 by quantifying proliferative response of the BALB/c T cells reacting against control and IL-12 silenced C57BL/6 DC. Figure 2B showed that T cell response was reduced after being stimulated by the DC in which IL-12 gene is silenced. These data suggest that IL-12 not only plays a role in production of IFN-g and IL-4, but also is involved in stimulation of T cell proliferation by allogeneic DC. Accordingly, we sought to determine whether DC modulated in this manner may be useful for modulating an immune response in vivo in an autoimmune disease model.

The CIA model of RA is an ideal system for assessment of therapeutics based on the fact that it displays similar onset, progression, and pathology to clinical RA. Importantly, the autoantigen in CIA is molecularly defined CII and T cell responses to this protein are essential for disease continuation [38]. We have previously demonstrated that silencing expression of IL-12p35 in DC leads to in vivo immune modulation of T cell response to a nominal antigen KLH [35]. In the previous study we utilized presynthesized siRNA, and we did not assess ability to inhibit immunity in a therapeutic model. In this study, we used a clinically relevant model of autoimmune arthritis and evaluated two treatment protocols. When, 12 days after priming with CII, DBA/1 mice were administered a single injection of IL-12 shRNA-transfected DC pulsed with CII, an inhibition of arthritis clinical score had been observed 11 days after arthritis onset as opposed to control-treated mice receiving DC that were not gene-silenced for IL-12 (Figure 3A). The average clinical scores per affected paw in the control group were two times higher than that in the treatment group. To confirm the therapeutic effects by IL-12 silenced DC, we further sought to examine microscopic histological differences induced by treatment of CIA mice with the IL-12-silenced and CII-pulsed DC. Accordingly, animals treated with IL-12 shRNA-transfected DC or control DC were sacrificed 4 weeks following onset of arthritis and joints were examined by serial sectioning. We observed that control mice possessed severe bone erosion, pannus formation, and synovitis (Figure 3B). A marked neutrophilic and mononuclear cell infiltration was seen. In contrast, joint histology of the IL-12-silenced DC treated mice revealed markedly attenuated morphological changes and cellular infiltration, and the preservation of normal cartilage structure (Figure 3C). The histological verification of the arthritis clinical score strongly suggests that the IL-12 silenced and CII-pulsed DCs can serve as a potent tolerogenic vaccine that might be useful for the treatment of autoimmune arthritis.

While the protocol above was therapeutic in the sense that the intervention was given after initiation of immune response, we chose to determine whether the combination of a prophylactic (i.e. 7 days before priming with CII) and the therapeutic IL-12-silenced DC injection resulted in additive or synergistic inhibition of arthritis development. Using this combination we observed a lower severity of arthritis, as compared to a single injection protocol (Figure 3D). Furthermore, the control DC group had higher average clinical score than experimental group ranged from 2-fold to more than 4-fold depending on the timepoint of assessment. This suggests that a combination of cellular vaccine strategies could lead to additive anti-arthritis effects.

It has been previously described that immune modulation by administration of IL-10-treated DC can inhibit antigen-specific recall response [39]. However, the long-term effects of immune modulation with inhibitory DC have not been reported. Here, we have measured CII-specific T cell recall responses after arthritis development in mice treated with IL-12 shRNA-transfected DC pulsed with CII. Four-weeks after arthritis onset, we extracted lymph node and spleen T cells from correspondent group of animals in 4 weeks following the first signs of arthritis. A profound suppression of response to CII was observed in T cells derived from both lymph node (Figure 4A) and spleen (Figure 4B) sources in the mice treated with IL-12 siRNA.

The importance of CII-specific antibodies in development of CIA pathology is well-known [21]. However, control of antibody responses by DC has not been previously examined in a therapeutic sense. Tolerogenic DC may directly block antibody production through inhibition of BlyS and APRIL, factors which the DC use to directly induce Ig production and class switching in B cells [40, 41]. Alternatively, tolerogenic DC may indirectly prevent antibody production through the inhibition of T cell helper function. Here, we assessed antibody responses to CII in animals 4 weeks after arthritis onset. Using a titration experiment, we compared the serum levels of anti-CII Ig from control mice with CIA mice treated with single injection of IL-12-silenced/CII-pulsed DC twice, before and after CII administration. CII-specific antibody response was inhibited by both the single injection (Figure 5A) and by the two injections of the IL-12 silenced DC (Figure 5B). This indicates that the IL-12 shRNA-transfected DC represent an immunomodulatory therapeutic strategy since they are not only involved in suppression of T cell responses but also in antibody production.