TGFβ1-induced SMAD2/3 and SMAD1/5 phosphorylation are both ALK5-kinase-dependent in primary chondrocytes and mediated by TAK1 kinase activity
verfasst von:
Arjan van Caam, Wojciech Madej, Amaya Garcia de Vinuesa, Marie-José Goumans, Peter ten Dijke, Esmeralda Blaney Davidson, Peter van der Kraan
Dysregulated transforming growth factor β (TGFβ) signaling is implicated in osteoarthritis development, making normalizing TGFβ signaling a possible therapy. Theoretically, this can be achieved with small molecule inhibitors specifically targeting the various TGFβ receptors and downstream mediators. In this study we explore in primary chondrocytes the use of small molecule inhibitors to target TGFβ-induced pSmad1/5/9-, pSmad2/3- and TGFβ-activated kinase 1 (TAK1)-dependent signaling.
Method
Primary bovine chondrocytes and explants were isolated from metacarpophalangeal joints. To modulate TGFβ signaling the activin receptor-like kinase (ALK)1/2/3/6 inhibitor LDN-193189, the ALK4/5/7 inhibitor SB-505124 and the TAK1 inhibitor (5Z)-7-Oxozeaenol were used. pSmad1/5 and pSmad2 were measured using western blot analysis and TGFβ1-induced gene expression was measured using quantitative real time PCR (qPCR).
Results
In chondrocytes, TGFβ1 strongly induced both pSmad1/5 and pSmad2. Remarkably, LDN-193189 did not inhibit TGFβ-induced pSmad1/5. In contrast, SB-505124 did inhibit both TGFβ-induced Smad2 and Smad1/5 phosphorylation. Furthermore, (5Z)-7-Oxozeaenol also profoundly inhibited TGFβ-induced pSmad2 and pSmad1/5. Importantly, both SB-505124 and (5Z)-7-Oxozeaenol did not significantly inhibit constitutively active ALK1, making an off-target effect unlikely. Additionally, LDN-193189 was able to potently inhibit BMP2/7/9-induced pSmad1/5, showing its functionality. On gene expression, LDN-193189 did not affect TGFβ1-induced regulation, whereas both SB-505124 and (5Z)-7-Oxozeaenol did. Similar results were obtained in cartilage explants, although pSmad1/5 was not strongly induced by addition of TGFβ1.
Conclusion
Our data suggest that ALK5 kinase activity plays a central role in both TGFβ-induced Smad1/5 and Smad2/3 phosphorylation, making it difficult to separate both pathways with the use of currently available small molecule inhibitors. Furthermore, our data regarding (5Z)-7-Oxozeaenol suggest that TAK1 facilitates Smad-dependent signaling.
The online version of this article (doi:10.1186/s13075-017-1302-4) contains supplementary material, which is available to authorized users.
Abkürzungen
μl
Microliter
μM
Micromolar (10-6 mol per liter)
ALK
Activin receptor-like kinase
BCA
Bicinchoninic acid assay
BMP
Bone morphogenetic protein
caALK
Constitutively active activin receptor-like kinase
CDK
Cyclin-depdendent kinase
cDNA
Complementary deoxyribonucleic acid
DMEM
Dulbecco’s modified Eagle’s medium
DNAse
Deoxyribonuclease
dNTP
Deoxynucleoside triphosphate
dT
Deoxythymidine
DTT
Dithiothreitol
EDTA
Ethylenediaminetetraacetic acid
ERK
Extracellular signal-regulated kinase, also known as mitogen-activated protein kinase (MAPK1)
g
Gravitational force
Gapdh
Glyceraldehyde-3-phosphate dehydrogenase
h
Hour
HRP
Horseradish peroxidase
IC50
Half maximal inhibitory concentration
JNK
JUN N-terminal kinase
kDa
Kilodalton
LacZ
β-galactosidase
m/v
Mass per volume
mAb
monoclonal antibody
MAPK
Mitogen-activated protein kinase
min
Minute
ml
Milliliter
mm
Millimeter
M-MLV
Moloney murine leukemia virus
MMP
Matrix metalloproteinase
(m)RNA
(messenger) Ribonucleic acid
Ng
Nanogram
OA
Osteoarthritis
PCR
Polymerase chain reaction
R-Smad
receptor-regulated Smad
TAK1
TGFβ-activated kinase 1, also known as: mitogen-activated protein kinase kinase kinase 7 (MAP3K7)
TGFβ
Transforming growth factor beta
U
units
Background
Transforming growth factor β (TGFβ) plays a crucial role in regulation of tissue homeostasis via its control over diverse cellular processes such as proliferation, differentiation and matrix formation. By binding to different receptors of the activin-receptor like kinase (ALK) family, TGFβ induces intracellular carboxy-terminal (C-terminal) phosphorylation of receptor-regulated Smad (R-Smad) proteins. Phosphorylated R-Smads form complexes with the common-mediator Smad; Smad4, and these complexes translocate to the nucleus where they bind DNA to regulate gene transcription via recruitment of transcription factors [1, 2]. Use of different ALKs can result in activation of different R-Smads; activation of ALK5 (TGFβR1) induces phosphorylation of Smad2 and Smad3, whereas activation of an ALK1 (or 2 or 3) complex mediates phosphorylation of Smad1, Smad5 and Smad9 [3, 4]. However, TGFβ signaling is not limited to R-Smads as Smad-independent signaling can occur by activation of e.g. TGFβ-activated kinase 1 (TAK1 or MAP3K7). Smad-independent signaling results in activation of various downstream signaling pathways, including the JUN N-terminal kinase (JNK) and p38 mitogen-activated protein kinase (MAPK) pathways [5].
In many tissues, e.g. in cartilage, phosphorylated Smad2/3 and Smad1/5 have opposing functions [6, 7]. In cartilage, phosphorylated Smad3 guards chondrocyte phenotype against deleterious hypertrophy and production of catabolic enzymes like matrix metalloproteinases (MMPs) [8‐10]. In contrast, phosphorylated Smad1/5 is essential for chondrocyte hypertrophy [11, 12], and is associated with expression of matrix metalloproteinase 13 (MMP13), the main cartilage-degrading enzyme [13]. Therefore, balancing TGFβ signaling via Smad2/3 or Smad1/5 is important for chondrocytes to maintain cellular homeostasis and deregulation of this balance has been proposed as a cause of disease, e.g. osteoarthritis (OA) [4, 13]. It would be of great benefit if cellular responses to TGFβ could be directed towards either the Smad1/5 or Smad2/3 pathway; this would enable blockade of deleterious pathways while maintaining beneficial signaling.
Anzeige
Inhibiting Smad phosphorylation can be achieved by blocking the kinase domain of ALK receptors. Small molecules have been developed that specifically inhibit the kinase activity of ALK4, ALK5 and ALK7, the receptors that phosphorylate Smad2 and Smad3, or ALK1, ALK2, ALK3 and ALK6, the receptors that phosphorylate Smad1, Smad5 and Smad9 [14, 15]. In this study we investigated in chondrocytes and cartilage explants the use of SB-505124 [15, 16], an inhibitor of ALK4/5/7 kinase activity and LDN-193189, an inhibitor of the ALK1/2/3/6 kinase activity [14, 16] to study their ability to direct R-Smad signaling and downstream effects. Furthermore, we used (5Z)-7-Oxozeaenol as a selective inhibitor of TAK1 kinase activity to evaluate the importance of TAK1 in TGFβ signaling in chondrocytes [17, 18], because of the ability of TAK1 to induce the JNK and p38 MAPK pathways and MMP production in cartilage [19, 20].
In this study we show that inhibition of ALK4/5/7 kinase activity prevented TGFβ1-induced C-terminal phosphorylation of both Smad2 and Smad1/5. Furthermore, treatment with (5Z)-7-Oxozeaenol, a selective TAK1 kinase inhibitor, attenuated phosphorylation of both Smad2/3 and Smad1/5 and expression of Smad target genes. Use of the ALK1/2/3 inhibitor LDN-193189 did not affect TGFβ1-induced R-Smad phosphorylation or gene expression. In conclusion, our data show that in cartilage the activity of the ALK5 kinase domain is essential for TGFβ1 signaling, whereas ALK1 kinase activity is not. Furthermore, our results obtained with (5Z)-7-Oxozeaenol underline that TAK1 kinase activity is facilitating R-Smad phosphorylation. Our study indicates that TGFβ1-induced Smad1/5 and Smad2/3 phosphorylation cannot be selectively targeted by using the small molecule inhibitors SB-505124 and LDN-193189.
Methods
Chondrocyte culture
Primary bovine chondrocytes were isolated from the metacarpophalangeal joint of cows (2–5 years old) obtained from a slaughterhouse within 3 hours post mortem. Chondrocytes were obtained by incubating cartilage slices overnight in Collagenase B (for details see [21]). Chondrocytes were seeded in DMEM/F12 1:1 containing 10% fetal calf serum (Thermo Scientific UK) at a density of 0.5 × 105 cells per cm2 in 6-well plates (Greiner Bio-one International, the Netherlands) for protein studies, or in 24-well plates (Bio-one International, the Netherlands) for mRNA experiments. Cells were cultured for 1 week at 37 °C and 5% CO2 before the start of the experiments. For explant studies, four 7-mm2 explants per condition were pooled in 1 ml of medium. Both monolayer and explant studies were repeated in different donors.
Adenoviral transfection of primary chondrocytes
Adenoviruses were used to induce expression of constitutively active (ca)ALK1 [4], constitutively active ALK5 [4] and the CAGA12-luciferace reporter construct [22] in primary chondrocytes. Cells were rinsed twice with saline, and adenoviruses were added in a multiplicity of infection of 200 for 3 h at 37 °C in a minimal volume of DMEM/F12 1:1. Hereafter, cells were washed twice with saline, and DMEM/F12 1:1 was added. Cells were used 48 h after transfection.
Anzeige
Inhibition of TGFβ1 signaling
Before stimulation, cells were deprived of serum for 24 h and thereafter stimulated with 1 ng/ml recombinant human TGFβ1 (Biolegend, the Netherlands) for 2 or 24 h. In experiments where inhibitors were used, DMSO was used as vehicle control. To block TAK1 activity, we used (5Z)-7-Oxozeaenol [17] (Tocris Bioscience) in a concentration of 0.5 μM. To inhibit ALK5 kinase, we used SB-505124 [15] (Sigma Aldrich) in a concentration of 5 μM. For inhibition of ALK1 kinase, LDN-193189 [14] (Axon Medchem) was used in a concentration of 0.05 μM. This concentration of LDN-193189 is well above its reported half maximal inhibitory concentration (IC50), 0.8 nM for ALK1, but far below its IC50 for ALK5 of 350 nM [16, 23]. Cells were pre-incubated with the inhibitors for 1 h prior to addition of TGF-β1. Either 2 or 24 h after addition TGF-β1, medium was removed and TRI-reagent was added for RNA isolation.
Protein isolation
To isolate proteins from monolayer cultures, cells were lysed on ice using lysis buffer (Cell signaling, USA) containing a protease inhibitor cocktail (complete, Roche Diagnostics, Germany) and subsequently sonicated on ice using a Bioruptor (Diagenode, USA). With a BCA-assay (Thermo Scientific, USA) protein concentration was measured and after addition of Laemmli sample buffer, samples were boiled for 5 minutes at 99 °C.
To isolate proteins from explants, four 7-mm2 explants were homogenized using a Mikro-dismembrator (B. Braun, Germany) and dissolved in 1 ml ice cold radioimmunoprecipitation assay (RIPA) buffer with added 1 mM Na3VO4 and protease inhibitor cocktail (Roche Diagnostics, Germany). After 1 h incubation on a roller bench at 4 °C, samples were spun down for 3 minutes at 104 × g and the pellet was discarded. Cetylpyridinium chloride was added up to a concentration of 1% (m/v) and samples were incubated on a roller bench for 1 h at 4 °C. Hereafter, samples were spun down twice for 15 minutes at 104 × g at 4 °C and the pellet was discarded. Using 10 kDa centrifugal filter units (Millipore, USA) the supernatant was concentrated to a volume of 50 μl. Subsequently, proteins were precipitated by addition of 950 μl of 20% m/v trichloroacetic acid and 0.1% m/v dithiothreitol in aceton at -20 °C and spinning samples down for 15 minutes at 6700 × g at 4 °C. Next, the pellets were washed three times with 0.1% m/v dithiothreitol in aceton at -20 °C. Finally, the pellets were dried under vacuum for 20 minutes and dissolved in 100 μl 1% m/v sodium dodecyl sulfate in 100 mM tris(hydroxymethyl)aminomethane in H2O pH 9.0.
Detection of proteins using SDS-PAGE and western blot
Proteins were seperated on a 7.5% Bisacrylamide gel, and transferred to a nitrocellulose membrane using wet transfer (Towbin buffer, 2.5 h 275 mA at 4 °C). After overnight incubation at 4 °C with 1:1000 polyclonal Rabbit anti P-Smad1/5 (S463/465)/Smad8 (S426/428) (Cell signaling, USA) or anti P-Smad2 (S465/467) (Cell signaling, USA), membranes were incubated with 1:1500 polyclonal Goat anti Rabbit labeled with horseradish peroxidase (HRP) (DAKO, Belgium) for 1 h. Hereafter, enhanced chemiluminescence using ECL plus (GE Healthcare, UK) was used to visualize the proteins. To visualize overexpression of constitutively active ALKs, a rabbit polyclonal antibody directed against their internal HA tag was used: HA-probe Antibody (Y-11) (Santa Cruz, USA) (1:1000). As loading control either Gapdh was stained with an anti-Gapdh mouse mAb (1G5) (Sigma Aldrich, Germany) (1:10 000) in combination with IRDye 680RD Donkey anti mouse (1:10 000) (Licor, USA) using the Odyssey detection system (Licor, USA) or Vinculin with a rabbit pAb (H300) (Santa Cruz, USA) (1:1000) in combination with HRP-labeled Goat-anti Rabbit (1:2000) (DAKO, Denmark) using ECL. Finally, blots were quantified using ImageJ.
Detection of gene expression
TRI-reagent (Sigma-Aldrich, Germany) was used for RNA isolation according to the manufacturer’s protocol (for details see [21]). RNA concentration was measured using a Nanodrop photospectrometer (Thermo Scientific, USA). Per sample, 1 μg of RNA was treated with DNAse (Life Technologies, USA), which was subsequently inactivated at 65 ° C with 1 μl 25 mM EDTA (Life Technologies, USA). To perform reverse transcriptase reaction, 1.9 μl ultra pure water, 2.4 μl 10 × DNAse buffer, 2.0 μl 0.1 M DTT, 0.8 μl 25 mM dNTP, 0.4 μg oligo dT primer, 1 μl 200 U/μl M-MLV Reverse transcriptase (all Life Technologies, USA) and 0.5 μl 40 U/μl RNAsin (Promega, the Netherlands) was added, and samples were incubated for 5 minutes at 25 °C, 60 minutes at 39 °C, and 5 minutes at 95 °C using a thermo cycler. The obtained cDNA was diluted 10 times in ultra pure water, and gene expression was measured using 1 μM of validated cDNA-specific primers (Biolegio, the Netherlands; see Table 1) in a quantitative real-time polymerase chain reaction (qPCR) using SYBR green master mix (Applied Biosystems). The following protocol was used: after 10 minutes at 95 °C, 40 cycles of 15 sec at 95 °C and 1 minute at 60 °C each were run. Hereafter a melting curve was made to verify gene-specific amplification. For calculations of the -ΔCt, two reference genes were used: glyceraldehyde 3-phosphate dehydrogenase and ribosomal protein S14.
Table 1
Sequence and efficiency of the primers used in this study
Gene
NCBI reference sequence
P (bp)
E (%)
Forward primer
Reverse primer
bGapdh
NM_001034034.2
90
101
CACCCACGGCAAGTTCAAC
TCTCGCTCCTGGAAGATGGT
bRps14
NM_001077830.2
125
105
CATCACTGCCCTCCACATCA
TTCCAATCCGCCCAATCTTCA
bAlk1
NM_001083479.1
109
100
ACAACACAGTGCTGCTCAGACA
TGCTCGTGGTAGTGCGTGAT
bAlk2
NM_176663.3
61
105
CGTTGGAGACAGCACTTTAGCA
AGAGCCGCTTCCCGATGTA
bAlk3
NM_001076800.1
142
96
GAGCAAGATGAAGCATTTATTCCA
CAACCTGCCGAACCATCTG
bAlk5
NM_174621.2
75
94
CAGGACCACTGCAATAAAATAGAACTT
TGCCAGTTCAACAGGACCAA
bSerpine1
NM_174137.2
55
99
CGAGCCAGGCGGACTTC
TGCGACACGTACAGAAACTCTTGA
bId1
NM_001097568.2
73
107
GCTCCGCTCAGCACTCTCAA
GATCGTCCGCTGGAACACA
bMmp3
NM_001206637.1
130
106
GAATCTGTGCCTCCCGAACC
TCCTGAAAGATTTCCGCCAA
bSmad7
NM_001192865.1
72
98
GGGCTTTCAGATTCCCAACTT
CTCCCAGTATGCCACCACG
bTgfb1
NM_001166068.1
80
107
GGTGGAATACGGCAACAAAATCT
GCTCGGACGTGTTGAAGAAC
bJunb
NM_001075656.1
139
97
CCTTCTACCACGACGACTCA
CCGGGTGCTTTGAGATTTCG
bNgf
NM_001099362.1
110
85
CAGCTCTTTTGATCGGCATACA
TGTGTCAAGGGAATGCTGAAGT
bFn1
NM_001163778.1
95
96
GCACCACTCCCGACATTACT
CTGATCGGCATGGACCACTT
bCol2a1
NM_001001135.2
60
97
TGATCGAGTACCGGTCACAGAA
CCATGGGTGCAATGTCAATG
P is product length in base pairs, E is efficiency in percentage. Alk1 is also known as Acvrl1, Alk2 as Acvr1, Alk3 as Bmpr1a and Alk5 as Tgfbr1
Statistics
All quantitative data are expressed as a mean of multiple repeats ± SD. For every analysis data were checked for normality using the Shapiro-Wilk test. One-way analysis of variance (ANOVA) with Tukey multiple comparison post-hoc test was used to determine the significance. The statistical analyses were performed using Graphpad Prism 5.0 software.
Results
SB-505124 and (5Z)-7-Oxozeaenol both inhibit TGFβ1-induced Smad1/5 and Smad2/3 phosphorylation whereas LDN-193189 does not
To begin, we confirmed in primary bovine chondrocytes the expression of the receptors that TGFβ can use to induce Smad2/3 phosphorylation i.e. ALK5 or Smad1/5 phosphorylation, i.e. ALK1, ALK2 and ALK3 [3, 4]. All four receptors were readily detected using qPCR (Additional file 1: Figure S1), and indeed confirmed that stimulation of chondrocytes with TGFβ1 results in both Smad2 and Smad1/5 phosphorylation (Fig. 1a).
×
Subsequently, we analyzed the effects of the ALK4/5/7-kinase inhibitor SB-505124, the ALK1/2/3-kinase inhibitor LDN-193189 and the TAK1-kinase inhibitor (5Z)-7-Oxozeaenol on TGFβ1-induced R-Smad phosphorylation (Fig. 1a, b and c). Strikingly, addition of 5 μM SB-505124 not only inhibited Smad2 phosphorylation, but also pSmad1/5 phosphorylation. Remarkably, treatment with 0.5 μM (5Z)-7-Oxozeaenol also resulted in inhibition of TGFβ1-induced Smad1/5 and Smad2 phosphorylation. Noteworthy, addition of 0.05 μM LDN-193189 did not affect TGFβ1-induced Smad1/5 phosphorylation but did significantly enhance TGFβ-induced pSmad2.
Anzeige
To investigate if the striking effect of SB-505124 on Smad1/5 phosphorylation was a dose-dependent effect, we performed a dose-response experiment (Fig. 1d and e). This experiment showed that at all tested doses (0.1, 0.5, 1, 5, 10 and 25 μM), SB-505124 inhibited TGFβ1-induced Smad1/5 phosphorylation, and that Smad1/5 phosphorylation was inhibited more potently than that of Smad2. Therefore, to address if ALK1 inhibition was a possible off-target effect of SB-505124, this compound was added to cells over-expressing constitutively active (ca)ALK1 or caALK5. This experiment showed that SB-505124 did not affect caALK1-induced Smad1/5 phosphorylation (Fig. 2a and b), but did inhibit caALK5-induced Smad2 phosphorylation (Fig. 2a and b). Therefore, SB-505124 is specific for ALK5 kinase and does not inhibit ALK1 kinase. The same experimental setup was used to address the specificity of (5Z)-7-Oxozeaenol, and no significant inhibitory effect of this compound on either caALK1 or caALK5 function was detected, making it unlikely that either the ALK1 or ALK5 kinase domain is an off-target of (5Z)-7-Oxozeaenol.
×
To investigate if the lack of effect of LDN-193189 on TGFβ1-induced Smad1/5 was maybe dose-dependent, we added a 10 times higher dose of LDN-193189 (0.5 μM) to the cells, but were still unable to inhibit TGFβ1-induced Smad1/5 phosphorylation (Fig. 2c). Therefore we sought to validate the function of LDN-193189. To do this, we added 0.05 μM LDN-193189 to chondrocytes over-expressing caALK1 and observed that this blocked caALK1-induced Smad1/5 phosphorylation (Fig. 2a and b), Furthermore, the effect of 0.05 μM LDN-193189 on bone morphogenic protein (BMP) signaling was also investigated (Fig. 2d) by stimulating primary chondrocytes for 1 h with either the ALK2/3 ligands BMP2 or BMP7 [24] or the ALK1/2 ligand BMP9 [25, 26]. We observed that BMP-induced Smad1/5 phosphorylation was clearly inhibited by 0.05 μM LDN-193189. Together, these experiments strongly confirm the function of 0.05 μM LDN-193189 in primary chondrocytes.
In conclusion, in primary chondrocytes, TGFβ1-induced Smad1/5 phosphorylation is unaffected by LDN-193189, whereas both Smad2/3 and Smad1/5 phosphorylation are inhibited by SB-505124 and (5Z)-7-Oxozeaenol.
SB-505124 fully and (5Z)-7-Oxozeaenol partly inhibit TGFβ1-induced Smad-dependent gene expression whereas LDN-193189 does not
Next, we analyzed the effects of TGFβ1 signaling inhibitors on TGFβ1-induced Smad-dependent gene expression. For this, bId1 and bSerpine1 were used as markers of pSmad1/5 and Smad3 signaling, respectively [4, 27] [22, 28]. Expression of bId1 was profoundly upregulated by stimulation with 1 ng/ml of TGFβ1 (Fig. 3a). In accordance with our western blot data on pSmad1/5, expression of bId1 was inhibited by both SB-505124 and (5Z)-7-Oxozeaenol, and was unaffected by LDN-193189. Expression of bSerpine1 was upregulated by 1 ng/ml of TGFβ1 and fully inhibited by SB-505124, but was only partly inibited by (5Z)-7-Oxozeaenol (Fig. 3b). To confirm these effects on pSmad3-dependent gene expression, we used the CAGA12-luc construct, which produces luciferase specifically in response to pSmad3. After 8 h, TGFβ-induced CAGA12-luc activity was significantly inhibited by (5Z)-7-Oxozeaenol and SB-505124, showing that pSmad3-signaling is indeed lowered in these conditions. When the effect of the inhibitors on multiple TGFβ1-induced (Fig. 3c), genes like bSmad7, bMmp3, bCol2a1, bNgf, bAlk5, bJunb, bFN1 and bTgfb1 was measured, none of these genes was significantly downregulated by LDN-193189, unlike SB-505124, which profoundly downregulated bSmad, bNgf, bAlk5, bJunb, bFN1 and bTgfb1, or unlike treatment with (5Z)-7-Oxozeaenol, which significantly lowered bNgf, bTgfb1 and bMmp3 expression (Fig. 3d). Because a role for pSmad1/5 in the regulation of e.g. Smad7, Junb and Col2a1 has been established [29‐31], these data indicate that the ALK5 kinase inhibitor SB-505124 inhibits gene expression downstream of both pSmad2/3 and pSmad1/5, whereas (5Z)-7-Oxozeaenol does so to a lesser extent and in a more limited amount of genes. No effect of LDN-193189 was observed on TGFβ1-induced gene expression.
×
Anzeige
In intact cartilage, SB-505124 and-Oxozeaenol inhibit TGFβ1-induced pSmad1/5 and pSmad2
As TGFβ1 signaling is known to be affected by cellular context, we sought to validate our observations in monolayer chondrocytes in intact cartilage ex vivo. Therefore we stimulated cartilage explants with 1 ng/ml TGFβ1 with or without inhibitors, and investigated Smad phosphorylation. Explants were stimulated for 2 h to allow for diffusion of TGFβ1 through the cartilage matrix. In explants, 1 ng/ml TGFβ1 induced pSmad2, but Smad1/5 phosphorylation was more difficult to detect (Fig. 4a), in contrast to in monolayer cultures. Therefore BMP9 was used as positive control, which, in comparison to TGFβ, resulted in far stronger induction of pSmad1/5 (for quantification see Additional file 2: Figure S3). A smaller amount of pSmad1/5 was detected in explants treated with TGFβ1 and SB-505124, (5Z)-7-Oxozeaenol or LDN-193189 compared to TGFβ1-treated samples alone. TGFβ-induced phosphorylation of Smad2 was clearly inhibited by SB-505124 and partly by (5Z)-7-Oxozeaenol (Fig. 4a), but on gene expression bSerpine1 was only significantly inhibited by SB-505124 and not by (5Z)-7-Oxozeaenol (Fig. 4b). In explants, expression of bId1 could not be used as a read-out for pSmad1/5 signaling, because TGFβ1 downregulated its expression, in contrast to its induction in monolayer experiments. This is a well-known Smad3-dependent cytostatic effect of TGFβ1 [32], and further indicates that TGFβ1 signaling differs between chondrocytes in monolayer and chondrocytes in intact cartilage. Notably, LDN-193189 did downregulate bId1 expression, even in absence of TGFβ1 (Additional file 3: Figure S2), demonstrating the bioactivity of this compound in cartilage explants. Again, when multiple, TGFβ1-induced, Smad-dependent, genes were measured (Fig. 4c) SB-505124 inhibited TGFβ1-induced expression of bSmad7, bNgf, bFn1 and bTgfb1, and (5Z)-7-Oxozeaenol inhibited TGFβ1-induced expression of bFn1, bTgfb1, whereas no effect of LDN-193189 was observed. Therefore, SB-505124 also inhibits both TGFβ1-induced Smad1/5 and Smad2 phosphorylation and gene expression in intact cartilage, whereas LDN-193189 does not. Furthermore, (5Z)-7-Oxozeaenol partly inhibited both TGFβ1-induced Smad1/5 and Smad2 phosphorylation.
×
Discussion
TGFβ1 signaling is a crucial regulator of chondrocyte homeostasis. We investigated the impact of small molecule inhibitors on TGFβ1 signaling in primary chondrocytes both in vitro and ex vivo. We report that inhibition of ALK4/5/7 kinase with SB-505124 lowered both TGFβ1-induced Smad1/5 and Smad2/3 phosphorylation and downstream gene expression, whereas inhibition of ALK1/2/3/6 kinase with LDN-193189 did not affect TGFβ1-induced Smad1/5 phosphorylation or transcriptional activity. In addition, we showed that treatment with (5Z)-7-Oxozeaenol, a selective TAK1 kinase inhibitor, attenuated TGFβ1-induced R-Smad phosphorylation and downstream gene expression.
In many tissues, including cartilage, TGFβ1 induces pSmad1/5 and pSmad2/3 [3, 4, 7]. ALK5 is essential for TGFβ1-induced Smad2/3 phosphorylation, whereas a role for ALK1 [4], ALK2 and ALK3 [3] has been demonstrated in TGFβ-induced Smad1/5 phosphorylation (see Fig. 5). Remarkably, we found that specific inhibition of ALK4/5/7 kinase with SB-505124 was sufficient to inhibit both TGFβ1-induced Smad2/3 and Smad1/5 phosphorylation and transcriptional activity. In contrast, we were unable to block TGFβ1-induced Smad1/5 phosphorylation with LDN-193189, even though we used a dose (0.05 μM) well above the reported IC50 of this inhibitor for ALK1 (0.8 nM), ALK2 (0.8 nM) and ALK3 (5.3 nM) [23]. Additionally, even a 10 times higher dose of LDN-193189 (0.5 μM) was unable to block TGFβ1-induced Smad1/5 phosphorylation. LDN-193189 has been established as an efficient inhibitor of BMP type I receptors, i.e. ALK1/2/3 and ALK6, both in vitro and in vivo [14, 23, 33]. We were able to confirm this inhibitory effect of LDN-193189 on BMP-induced Smad1/5 phosphorylation in primary chondrocytes by using BMPs that signal via ALK1, ALK2 and/or ALK3, i.e. BMP2, BMP7 and BMP9 [24, 25]. Furthermore, we were also able to block caALK1 activity with LDN-193189 in our primary cell cultures. Together, these experiments indicate that LDN-193189 is functional in primary bovine chondrocytes and blocks the ALK1, ALK2 and ALK3 kinase activity at a dose of 0.05 μM. Therefore, our data indicate that ALK1, ALK2 or ALK3 kinase activity is not required for TGFβ1-induced Smad1/5 in primary chondrocytes and cartilage. Notably, various studies using the LDN-193189 precursor dorsomorphin also show that this BMP type I receptor blocker is unable to block TGFβ1-induced Smad1/5 phosphorylation, supporting our observations [34, 35].
×
Based on structural analyses of R-Smad-ALK interactions, the ability to phosphorylate Smad1/5 is thought to be limited to BMP type I receptors [36, 37]. Our data indicate that ALK5 kinase activity is crucial, and possibly sufficient, for TGFβ1-induced Smad1/5 phosphorylation. In line with our data, it has previously been demonstrated that inhibition of ALK5-kinase with SB-431542 in endothelial cells [6] or with SB-505124 in synovial fibroblasts [34] attenuates TGFβ1-induced phosphorylation of Smad1/5. Furthermore, by knocking down ALK5, it has been shown by others that this receptor is necessary for TGFβ-induced Smad1/5 phosphorylation [3, 6]. Possibly, ALK5 can directly phosphorylate Smad1/5 independently of BMP type I receptors in cartilage. Direct phosphorylation of Smad1 by caALK5 has been demonstrated by in vitro kinase assays [35, 38], and it has been shown that TGFβ1-induced Smad1 phosphorylation is inhibited in cells expressing a kinase defective ALK5 variant: ALK5KR [38]. Together, these studies indicate a direct induction of pSmad1/5 by ALK5, which would be blocked by SB-505124, but challenge the dogma that ALK5 cannot directly interact with Smad1 [36, 37]. In contrast, multiple studies show that in the absence of BMP type I receptors, TGFβ1-induced pSmad1/5 is reduced [3, 6] indicating at least a role for these receptors.
Anzeige
Apart from R-Smad phosphorylation, TGFβ1 also induces TAK1 activation, a key component of Smad-independent TGFβ signaling [5]. Noteworthy, with the use of the specific TAK1 kinase inhibitor (5Z)-7-Oxozeaenol [17] at 0.5 μM, we showed that TAK1 kinase activity facilitates canonical C-terminal R-Smad phosphorylation in chondrocytes and cartilage. Previous studies support a role for TAK1 in R-Smad-dependent signaling; with the use of cartilage-specific TAK1 knockout animals, it has been shown that loss of TAK1 greatly diminishes BMP-induced C-terminal Smad1/5 phosphorylation while not affecting total R-Smad levels [39, 40]. Furthermore, tissue specific knockout of TAK1 in mesenchymal cells of neural crest origin shows that also C-terminal Smad2/3 phosphorylation is inhibited in the absence of TAK1 [41]. The pronounced effects of TAK1 on canonical C-terminal Smad phosphorylation have been ascribed to TAK1-induced Smad-linker phosphorylation, a post-translational Smad modification [41, 42].
Linker modification of R-Smads is an essential aspect of TGFβ1-signaling (reviewed in [43, 44]). The linker region of R-Smads contains threonine and serine residues that can be phosphorylated by various intracellular kinases like extracellular signal-regulated kinases (ERK), cyclin-depdendent kinases (CDKs) and JNKs [43, 45]. Degradation, nuclear transport and interaction of R-Smads with other proteins are regulated by phosphorylation of this region, enabling context-dependent TGFβ signaling [43, 44]. TAK1 can directly interact with R-Smads via the R-Smad MH2 domain [42], and phosphorylate, e.g. Smad2 at threonine 220 (Thr-220). Phosphorylation of this threonine greatly affects cellular localization and transcriptional activity of this Smad [41, 42]. TAK1 kinase activity is essential for this interaction of TAK1 with R-Smads [42]. As a consequence of this kinase dependency, it has been reported that the use of (5Z)-7-Oxozeaenol results in similar effects on C-terminal Smad1/5 and Smad2/3 phosphorylation as knockout of TAK1 [41]. We did not have access to cartilage-specific TAK1 knockout animals, but with the use of (5Z)-7-Oxozeaenol, we show for the first time that this selective TAK1 kinase inhibitor greatly affects TGFβ1-induced C-terminal R-Smad phosphorylation both in vitro and ex vivo in articular cartilage.
A limitation of our study is the possibly imperfect specificity of the used compounds, making it possible that off-target effects can explain our observations and interfere with our conclusions. However, in the experiments with the caALKs, we did not observe a significant effect of SB-505124 or (5Z)-7-Oxozeaenol on caALK1-induced pSmad1/5, or an effect of (5Z)-7-Oxozeaenol on caALK5-induced pSmad2. Therefore we do not think that these compounds have off-target effects on ALK1. Furthermore, a dose-response curve showed that SB-505124 inhibited TGFβ-induced Smad1/5 phosphorylation more potently than Smad2/3 phosphorylation, demonstrating that this effect of SB-505124 on TGFβ signaling is not an off-target effect obtained at high dosage, and this compound therefore cannot be used to specifically inhibit TGFβ-induced Smad2 in chondrocytes.
Another limitation of our study is that we did not include in vivo data. Unfortunately, the in vivo use of both SB-505124 and LDN-193189 is difficult because of their unfavorable pharmacokinetic properties, resulting in the need for daily re-administation via injection [33]. Up to now, only one study has used SB-505124 as a TGFβ blocker in vivo in a model of OA; i.e. in anterior cruciate ligament transection in mice [46]. In this study, inhibition of TGFβ signaling with 1 mg/kg/day of SB-505124 attenuated OA development, confirming that inhibition of TGFβ signaling with a small molecule inhibitor is a feasible and promising approach to treat OA. However, the use of a higher dose of SB-505124 (2.5 mg/kg/day) was detrimental for cartilage because this resulted in proteoglycan depletion, indicating that total TGFβ inhibition comes with a risk. Possibly, a small molecule inhibitor that prevents TGFβ-induced pSmad1/5 but leaves pSmad2 unaffected will not have this risk. To our knowledge, both LDN-193189 and (5Z)-7-Oxozeaenol have not been used in vivo to study their effects on OA development. They have been used in other applications, e.g. LDN-193189 in atherosclerosis research and (5Z)-7-Oxozeaenol in cancer studies; however, this was not to specifically modulate TGFβ signaling but to inhibit BMP and TAK1 signaling, respectively. Therefore it is as yet unknown how these inhibitors modulate TGFβ signaling in vivo or in OA.
Conclusions
In conclusion, with the use of the small molecule inhibitors SB-505124 and LDN-193189 we were unable to direct TGFβ1-signaling towards either Smad1/5 or Smad2/3 phosphorylation in cartilage. Our data suggest that in cartilage, ALK5 plays a central role in both TGFβ-induced Smad1/5 and Smad2/3 phosphorylation, making it difficult to separate the Smad pathways with the use of currently available intracellular small molecule inhibitors of the ALK receptors. Furthermore, we showed that treatment with the TAK1 inhibitor (5Z)-7-Oxozeaenol inhibits TGFβ-induced C-terminal phosphorylation of both Smad1/5 and Smad2/3, suggesting a link between the non-canonical and the canonical TGFβ pathway in cartilage.
Acknowledgements
Not applicable.
Funding
This study was supported by a grant from: The Netherlands Organization for Scientific Research (NWO, ZonMW) for AvC, AGV, MJG and PtD, and the Dutch Arthritis Association (Reumafonds) for WM, EBD and PvdK.
Availability of data and materials
All data generated or analyzed during this study are included in this published article (and its supplementary information files).
Authors' contributions
Conception and design: AC, EBD and PK. Collection and assembly of data: AC and WM. Analysis and interpretation of data: AC, WM, AGV, MJG, PD, EBD and PK. Drafting of the manuscript: AC, EBD and PK. Critical revision: AC, WM, AGV, MJG, PD, EBD and PK. Final approval of the article: AC, WM, AGV, MJG, PD, EBD and PK.
Authors' information
Not applicable.
Competing interests
The authors declare that they have no competing interests.
Consent for publication
Not applicable.
Ethics approval
Not applicable. No live animals were used for this study, nor were animals specifically killed for this study to obtain material; all animals were slaughtered for their meat. Therefore ethical approval of an ethics committee was not required, nor was it applicable for this study.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Ob bei einer Notfalloperation nach Schenkelhalsfraktur eine Hemiarthroplastik oder eine totale Endoprothese (TEP) eingebaut wird, sollte nicht allein vom Alter der Patientinnen und Patienten abhängen. Auch über 90-Jährige können von der TEP profitieren.
Wenn unter einer medikamentösen Hochdrucktherapie der diastolische Blutdruck in den Keller geht, steigt das Risiko für schwere kardiovaskuläre Ereignisse: Darauf deutet eine Sekundäranalyse der SPRINT-Studie hin.
Insektenstiche sind bei Erwachsenen die häufigsten Auslöser einer Anaphylaxie. Einen wirksamen Schutz vor schweren anaphylaktischen Reaktionen bietet die allergenspezifische Immuntherapie. Jedoch kommt sie noch viel zu selten zum Einsatz.
Beginnen ältere Männer im Pflegeheim eine Antihypertensiva-Therapie, dann ist die Frakturrate in den folgenden 30 Tagen mehr als verdoppelt. Besonders häufig stürzen Demenzkranke und Männer, die erstmals Blutdrucksenker nehmen. Dafür spricht eine Analyse unter US-Veteranen.
Update Innere Medizin
Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.