Background
p53 is a well-known tumor suppressor gene that plays fundamental roles in maintaining host genome fidelity [
1,
2]. The function of p53 in cancer pathogenesis has been well-illustrated [
3,
4], and previous studies have also showed that p53 acts as an important host factor that interferes various virus infections [
5]. p53 was found in the interaction with viral proteins from a variety of DNA viruses, such as large T antigen of simian virus 40 [
6,
7], E6 of human papillomavirus [
8,
9], and E1b of adenovirus [
10], HBx of human hepatitis B virus and LMP1 of Epstein-Barr virus [
11‐
13]. Moreover, p53 is activated by phosphorylation after host cells are infected by viruses including vesicular stomatitis virus (VSV), newcastle disease virus (NDV), herpes simplex virus (HSV) and HIV [
14,
15]. Host cell cycle status, activation of the DNA repair pathway and induction of apoptosis, which are regulated by p53, are also essential for viruses to create an environment for their replication. These viral proteins engage p53 in a way to increase infection by impacting p53 function directly or indirectly.
p53 has been found to be involved retrovirus infections, but its role has been elusive for many years. Like many other viruses, the retrovirus is a parasite, its efficient replication in target cells relies on its ability to overcome host defense mechanisms and to use cellular resources to finish its life cycle. Previous research had showed that p53 interferes with HIV-1 infection in the late stage of replication. p53 binds to HIV-1 LTR promoter and represses its transcription from integrated provirus [
15‐
18]. However, the recognized functions of p53 also highly suggest its participation in the early stage of retrovirus replication, which starts from viral-host binding and entry, reverse transcription, cDNA transportation to nucleus, through integration into the host genome. First, retrovirus infection is highly dependent on host cell cycle status [
19,
20] and p53 regulates the cell cycle. Second, the presence of retrovirus RNA genome, the RNA-DNA heteroduplex, and linear cDNA produced during reverse transcription all have the potential to trigger DNA damage signals, which activate the host DNA repair pathway, while p53 is the main regulator in cellular response to DNA damage. Furthermore, the generation of episomal forms of viral DNA containing either one long-terminal repeat (1-LTR circle) or two long-terminal repeats (2-LTR circle) is dependent on host cell’s DNA double-strand break repair pathways. Retrovirus 2-LTR circles are made by the non-homologous DNA end-joining (NHEJ) pathway and 1-LTR circles are produced by homologous recombination [
21,
22]. p53 is involved in the regulation of homologous recombination [
22]. It has been suggested that the completion of retrovirus integration also requires the participation of unidentified host enzymes [
23]. p53 was found to interact with HIV reverse transcriptase by enhancing its accuracy of DNA synthesis with its 3′ to 5′ exonuclease activity [
24]. Studying the role of p53 in retrovirus infection is necessary for both using retrovirus vector as a tool in gene therapy and understanding the molecular mechanism between viral host interactions in the course of infection.
In this study, human colon cancer p53 knockout cells HCT116 p53−/− and its isogenic p53 wild type HCT116 p53+/+ cells are used to investigate the roles of p53 in early replication of retrovirus.
Methods
Cell culture
Human colon cancer HCT116 p53+/+ cells, HCT116 p53−/− cells, and retrovirus packaging cell line GP2-293 (Clontech, Mountain View, CA, USA) were maintained in Dulbecco’s modified Eagle’s medium (DMEM) (Life Technologies, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS), 2 mM L-Glutamine, 100 units/ml of penicillin and 100 μg/ml of streptomycin at 37 °C with 5% CO2. In the preparation of non-cycling cells 2 × 106 cells were cultured in a 10 cm dish. After 24 h cells were washed with PBS and cultured in DMEM medium without 0.5% fetal bovine serum (FBS) for 48 h. Cell viability was determined by a trypan blue exclusion assay. Cells were stained with 0.4% solution of trypan blue (Life Technologies, Grand Island, NY, USA) in phosphate buffered saline (PBS), and a hemocytometer was used to count the number of blue stained cells and total cells.
Production of VSV-G pseudotyped retrovirus
To produce VSV-G pseudotyped retrovirus, 4 × 106 of GP2-293 cells (Clontech Laboratories, Inc., Mountain View, CA, USA) were cultured in a 10 cm dish for 24 h, then co-transfected with plasmids pRetroX-IRES-ZsGreen1 (Clontech Laboratories, Inc., Mountain View, CA, USA) and pVSV-G (Clontech Laboratories, Inc., Mountain View, CA, USA) by using X-tremeGENE 9 DNA Transfection Reagent (Roche, Indianapolis, IN, USA.). Cells were washed with PBS after 24 h and the virus-containing culture supernatant was harvested after 48 h. After centrifugation to remove residual cells, the virus containing supernatant was aliquoted and kept in an −80 °C freezer.
Infection
A 24 well plate was coated with 0.5 ml 20 μg/ml RetroNectin (TaKaRa, Mountain View, CA, USA) by following the manufacturer’s instructions. Each RetroNectin coated well was incubated with 0.5 ml of retroviruses for 6 h at 37 °C to allow the retrovirus to bind to RetroNectin, then unbound viruses were removed. After being washed with PBS, each well was added with 2.5 × 105 HCT116 cells for infection. The infected cells were harvested at various time points post infection as designed by the experiment. In SYBR Green real time PCR experiments, the virus was treated with 4 units/ml Turbo DNase (Life Technologies, Grand Island, NY, USA) at 37 °C for 1 h to remove plasmid carry over before the infection. A heat inactivated virus control was made by incubation at 65 °C for 1 h and used in a parallel infection experiment to confirm the removal of remaining plasmid.
Flow cytometry
Flow cytometry was used for both cell cycle analysis and quantification of infection. For cell cycle analysis, cells were washed with PBS, fixed with ice-cold 70% ethanol, and stained with 0.1% (v/v) Triton X-100, 20 μg/ml propidium iodide (PI) (Sigma, St. Louis, MO, USA) and 100 μg/ml DNase-free RNase (Life Technologies, Grand Island, NY, USA). For the infection assay, cells were disassociated by trypsin and washed with PBS. The infected GFP+ cells and uninfected cells were analyzed and quantified by a BD FACSVerse™ flow cytometer (BD Biosciences, San Jose, CA, USA). The FACSuite (BD Biosciences, San Jose, CA, USA) and the FlowJo (Ashland, OR) software were used for data analysis.
Real time PCR
All PCR primers are listed in Table
1. For retrovirus RNA quantification, viral RNA was extracted from transfection supernatant by using RNeasy plus Mini Kit (Qiagen, Hilden, Germany). The RNA was treated with 5 units of RNase free DNase (Roche, Mannheim, Germany) to remove any remaining plasmid. Reverse transcription was performed using SuperScript® III First-Strand Synthesis Kit (Life Technologies, Grand Island, NY, USA). A series of 10-fold dilutions from 10
6 to 10
2 copies of template pRetroX-IRES-ZsGreen 1 was used as standards. A standard curve method was used to determine the copy number of viral RNA. For the quantification of late reverse transcription (RT) products and 2-LTR cycle DNA, DNA was extracted from infected cells by using DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany). The relative amount of late RT product and 2 LTR cycle DNA was detected and normalized to reference gene GAPDH using the real time PCR ΔΔCt method. Power SYBR® Green master mix (Life Technologies, Grand Island, NY, USA) was used for both viral RNA and DNA quantification experiments. Melting curve analysis was also performed to monitor and confirm the target gene amplification. SAMHD1, p21
Cip1 and reference gene GAPDH TaqMan real time assays were purchased from Life Technologies. Real time PCR reactions were carried out in a StepOne Plus real time PCR instrument (Life Technologies, Grand Island, NY, USA). StepOne software was used for quantitative analysis.
Table 1
List of PCR primers
RT-F | ACTTATCTGTGTCTGTCCGATTG | Late RT |
RT-R | GAACTCGTCAGTTCCACCAC | Late RT |
LTR-F | CTGAGCGGCTTCGAGGATAAA | 1-LTR and 2-LTR |
LTR-R | ACGCAGGCGCATAAAATCAG | 1-LTR and 2-LTR |
2-LTR-F | TGTGGTCTCGCTGTTCCTTG | 2-LTR |
2-LTR-R | AGTTGCATCCGACTTGTGGT | 2-LTR |
β-globin-F | CCCTTGGACCCAGAGGTTCT | β-globin |
β-globin-R | CGAGCACTTTCTTGCCATGA | β-globin |
Viral LTR sequence analysis
The primer LTR-F is located before the 3′ LTR, and the LTR-R is located after the 5′ LTR. Therefore, both the complete length of viral 1-LTR and 2-LTR can be amplified by PCR using primer LTR-F and LTR-R. Platinum Taq DNA Polymerase (Life Technologies, Grand Island, NY, USA) was used. After agarose gel electrophoresis 1-LTR cycle and 2-LTR cycle DNA were purified by Qiagen QIAquick PCR purification kit (Qiagen, Hilden, Germany), and cloned by using TOPO® TA Cloning® Kits for sequencing (Life Technologies, Grand Island, NY, USA). DNA sequencing was performed using ABI Prism 3730XL capillary-based DNA sequencer. BioEdit computer software was used for sequence alignment [
25]. The web based tool Highlight at Los Alamos HIV sequence database (
http://www.hiv.lanl.gov) was used for mutation analysis of LTR sequences [
26].
Western blot
Proteins from cells lysed with Laemmli buffer (BioRad, Hercules, CA, USA) were resolved by SDS-PAGE, transferred onto PVDF membrane (Millipore, Billerica, MA) and probed with the indicated antibodies. The primary antibodies used were: anti-p21Cip1 (#2947) and anti-anti-phospho-SAMHD1 (Thr592) (#89930) (Cell Signaling Technologies, Danvers, MA), anti-SAMHD1 (#12586-1-AP) and anti-GAPDH (#60004-1-Ig) (Proteintech Group, Inc. Rosemont, IL), anti-p53 (#sc-126, Santa Crus, Dallas, TX), and anti-β-actin (#A5441, Sigma-Aldrich, St. Louis, MO). SuperSignal™ West Pico Chemiluminescent Substrate (Thermo Fisher, Rockford, lL, USA) was used for signal development. Chemiluminescent blot imaging was done with ChemiDoc™ Imaging Systems (BioRad, Hercules, CA, USA).
siRNA transfection
Interfering RNA (siRNA) p21Cip1 (#4390824) and negative control non-target siRNA (#4392420) were purchased from Life Technologies (Life Technologies, Grand Island, NY). siRNA transfections were performed using Lipofectamine® RNAiMAX™ Transfection Reagent (Life Technologies, Grand Island, NY) according to the manufacturer’s instructions. After transfected with siRNA for 2 days, cells were cultured in DMEM with 0.5% FBS for another 24 h before infection. siRNA knockdown was confirmed by Western Blot, and infection was quantified by flow cytometer.
Statistical tests
The Student’s t-test was used to evaluate the difference in the amount of total RT, 2-LTR, and the gene expression levels of SAMHD1 and p21Cip1 between infected HCT116 p53+/+ cells and HCT116 p53−/− cells by real time PCR. Fisher’s exact test was used to evaluate the difference in the numbers of LTR clones that carry higher numbers of mutations between infected HCT116 p53+/+ cells and HCT116 p53−/− cells. P-values between 0.01 and 0.05, and less than 0.01 were considered significant and highly significant, respectively.
Discussion
The retrovirus vector based virus has been commonly applied in virology studies and in gene delivery experiments [
29]. In a single round of infection, VSV-G pseudotyped retrovirus goes through essential steps in retrovirus replication including entry, reverse transcription, viral cDNA nuclear transportation, integration and expression. This infection experimental system provides an ideal model for us to study the role of p53 in early replication of retrovirus.
The use of serum depletion in cell culture was previously reported to create cell cycle G
0 arrest, which produces non-cycling cells [
19]. Our experiment results by using flow cytometry analysis indicated that the majority HCT116 p53
+/+ cells and HCT116 p53
−/− cells were non-cycling cells after 48 h serum depletion. The RetroNectin (Clontech) used in this study is a recombinant fibronectin fragment that was previously reported to improve transduction of retrovirus [
30]. After a virus bound plate was prepared, the virus-containing supernatant was removed and washed with PBS before the addition of cells, which avoided serum in the culture medium in the non-cycling cell infection experiment. Cell division has been known to be a requirement for successful replication of retrovirus. In our study, the retrovirus infection of HCT116 p53
+/+ was greatly inhibited after the cell cycle was stopped at G
0, which agrees with previous conclusions by Lewis et al. and Roe et al. [
19,
20]. However, the block of infection in non-cycling cells was significantly attenuated in HCT116 p53
−/− cells, suggesting the block of retrovirus infection in non-cycling cells could be mediated by p53. The subculture and transferring of cells to RetroNectin coated virus bound plate before infection may stimulate cells to grow, and the retrovirus may also induce the host cell cycle progression to benefit its replication. As a result, we observed cell cycle changes at 16 h post infection even when infected cells were cultured in DMEM with 0.5% FBS. About 60% of the infected cell population entered S and G
2 phases 16 h post infection. Therefore, this result suggested the p53 regulated permeability to retrovirus infection might be highly dependent on the cell cycle status at the time of infection.
In an early study, Harel showed that the amount of unintegrated linear viral DNA was decreased in MLV infected quiescent NIH/3 T3 cells after serum depletion [
31]. Both Zack et al. and Kootstra et al. demonstrated that HIV-1 reverse transcription was blocked in quiescent macrophages and lymphocytes [
32,
33]. In this study we found that the block in the reverse transcription of retrovirus infection was attenuated in non-cycling HCT116 p53
−/− cells compared to p53
+/+ cells, implying that a process mediated by p53 triggered the restriction at reverse transcription. The depletion of dNTPs pool by SAMHD1 in non-cycling cells had been considered as host restriction to block HIV-1 reverse transcription [
28,
34]. p21
Cip1 was also identified to inhibit HIV-1 reverse transcription independent of SAMHD1 [
27,
35]. p21
Cip1 is a well-known p53 downstream gene. Our siRNA knockdown experiment strongly indicated that p21
Cip1 was responsible for the observed inhibition of retrovirus reverse transcription in the infection of HCT116 p53
+/+cells. The inhibition also highly depends on the host cell cycle status at the beginning of infection.
After reverse transcription the linear viral cDNA is transported into the cell nucleus, where part of viral cDNA is autointegrated as circular forms 1-LTR cycle and 2-LTR cycle DNA. 1-LTR cycle and 2-LTR cycle DNA are formed by the action of host proteins in DNA double-strand break repair pathways. 1-LTR is formed through homologous recombination end joining DNA double-strand break repair pathway, and 2-LTR is the product of non-homologous end joining DNA double-strand break repair pathway [
21,
36]. Since 2-LTR DNA is detected exclusively in the cell nucleus, it is considered a useful marker of viral nuclear import [
36]. In this study the amount of 2-LTR was significantly decreased in infected non-cycling HCT116 p53
+/+ cells compared to HCT116 p53
−/− cells. However ratios of the amount of 2-LTR to late reverse transcription products between HCT116 p53
+/+ and HCT116 p53
−/− cells did not show a significant difference. This suggests the observed decrease in 2-LTR DNA in non-cycling HCT116 p53
+/+ cells could be a consequence of the major block in reverse transcription, and there was no block in the nuclear transportation and formation of 2-LTR cycle DNA in non-cycling HCT116 p53
+/+ cells.
Sequence analysis of 1-LTR and 2-LTR may reveal the influence of host factors in the process of reverse transcription and the formation of LTR. The mutations detected in 2-LTR clones may directly reflect errors in the synthesis of viral cDNA by reverse transcriptase. Bakhanashvili et al. found that p53 has 3′ to 5′ exonuclease activity and may enhance the accuracy of DNA synthesis by HIV reverse transcriptase in the cytoplasm [
24]. We found the mutation frequency was decreased slightly in the 2-LTR clones in retrovirus infected HCT116 p53
+/+ cells compared to HCT116 p53
−/− cells. The mutations detected in 1-LTR clones may reflect both the errors in the synthesis of viral cDNA and the errors during its formation by homologous recombination in nucleus. p53 is involved in the regulation of homologous recombination [
22]. It was found in this study that the mutation frequency in 1-LTR clones in non-cycling HCT116 p53
+/+ cells was significantly decreased compared to HCT116 p53
−/− cells, which suggests that p53 also influenced the precise process in the formation of 1-LTR by the homologous recombination.
In retrovirus reverse transcription, the removal of the tRNA primer defines the right end of the viral DNA, the generation and removal of the polypurine tract primer defines the left end of the viral DNA. Normally it is the activity of RNase H of reverse transcriptase that removes either the tRNA or the polypurine tract primer [
37]. Our result showed that a higher frequency of insertions and deletions was detected in the joint region of 2-LTR DNA in infected HCT116 p53
+/+ cells. This provides evidence that p53 may play a role either on the influencing the function of RNase H or on the abnormal modification of viral cDNA ends in non-cycling cells.
Infection by retrovirus was reported to activate p53 by phosphorylation [
14]. The subsequent up-regulation of p21
Cip1 induced by p53 results in the block of retrovirus reverse transcription, which may reflect one of the antiretroviral actions mediated by p53. In this study the result that inhibition of reverse transcription was mediated by p53 in non-cycling cells was based on experiments with VSV-G pseudotyped retrovirus. It will be very interesting to investigate other retrovirus such as HIV-1, whose main host cells are non-cycling and differentiated macrophages and lymphocytes. Further understanding of molecular mechanism mediated by host cell p53 in the inhibition of replication of the retrovirus in non-cycling cells will have important implications not only for the basic biology of retroviruses, but also for our understanding of viral pathogenesis.