The long noncoding RNA PCGEM1 promotes cell proliferation, migration and invasion via targeting the miR-182/FBXW11 axis in cervical cancer

Sixty-eight fresh CC tissues and their adjacent normal cervical tissues were obtained from patients diagnosed with cervical cancer in The First Affiliated Hospital of Jinzhou Medical University. All the tissue specimens were stored at − 80 °C until use. RNA later solution (Invitrogen™) was used to avoid the degradation of RNA, and all of the tissues were detect in a short time after resection from patients. This study was conducted with the approval of the Ethics committee of The First Affiliated Hospital of Jinzhou Medical University. The research has been carried out in accordance with the World Medical Association Declaration of Helsinki. Informed consent was obtained from all patients.

A normal human cervix epithelial cell line (Ect1/E6E7) and four cervical cancer cell lines (C33A, HeLa, SiHa, and CaSki) were purchased from American Type Culture Collection (Manassas, USA). The STR profiling and mycoplasma testing in all cervical cancer cell line was checked. Cells were routinely cultured in Dulbecco’s Modified Eagle Medium (DMEM) (Gibco, USA) supplemented with 10% fetal bovine serum, 100 U/mL penicillin, and 100 µg/mL streptomycin in a humidified atmosphere of 5% CO₂ at 37 °C.

siRNAs targeting PCGEM1, FBXW11 and a negative control (siNC) were purchased from Ribobio Company (Guangzhou, China). miR-NC (control), miR-182 mimics, miR-182 inhibitors (inh-182) were also obtained from GenePharma Technology (Shanghai, China). PCGEM1 overexpression plasmids (pcDNA3.1-PCGEM1) were purchased from Genearray Biotechnology (Shanghai, China). Transfections were performed using lipofectamine 2000 (Invitrogen, USA) according to the manufacturer’s instructions. After 48 h, the cells were used for further experiments.

Cells were lysed using RIPA buffer (Beyotime, Beijing, China). A total of 20 μg protein samples were separated using SDS-PAGE, and then transfer onto PVDF membranes (Millipore). The membranes were blocked by 5% non-fat milk, and incubated with antibodies: anti-FBXW11 (Abcam), or anti-GAPDH (Proteintech), at 4 °C overnight. After wash, the membrane was probed with matched secondary antibody, and then the proteins were visualized using Immobilon Western Chemiluminescent HRP substrate (Millipore).

Total RNA from CC tissues and cells was isolated by using Trizol reagent (Invitrogen, CA). The cDNA was synthesized from total RNA using the cDNA Reverse Transcription Kit (Takara). qRT-qPCR was performed using a StepOne Real-Time PCR System (Applied Biosystems, USA). Relative expression was normalized to GAPDH and was calculated by 2^−ΔΔCt method. The primer sequences were shown as follow: GAPDH (forward: GGTGTGAACCATGAGAAGTATGA, reverse: GAGTCCTTCCACGATACCAAAG), PCGEM1 (forward: CTGTGTCTGCAACTTCCTCTAA, reverse: TCCCAGTGCATCTCGTAGTA), cyclinD1 (forward: CCTCTCCCATGACCACAATATC, reverse: GAGAATCCCAAAGGACCAGAC), IL-6 (forward: GGAGACTTGCCTGGTGAAA, reverse: CTGGCTTGTTCCTCACTACTC), MMP9 (forward: GAACTTTGACAGCGACAAGAAG, reverse: CGGCACTGAGGAATGATCTAA), CD44 (forward: AATGGTCGCTACAGCATCTC, reverse: GCAAACTGCAGGTCTCAAATC), Bcl-xL (forward: GGTGGTTGACTTTCTCTCCTAC, reverse: TCTCCGATTCAGTCCCTTCT), myc (forward: GCTGCTTAGACGCTGGATTT, reverse: GAGTCGTAGTCGAGGTCATAGTT), MMP7 (forward: CACTGTTCCTCCACTCCATTTA, reverse: GACATCTACCCACTGCAAGTATAG), Axin-2 (forward: CTTATCGTGTGGGCAGTAAGA, reverse: GTTCTCGGGAAATGAGGTAGAG), TCF-1 (forward: ACCTATGACTCCGTCGATCTAT, reverse: TCAGCCCATCTCTGACCTAT).

3 × 10³ cells were seeded into 96-well plates. At indicated time point, cell proliferation was measured using the Cell Counting Kit-8 reagent (CCK-8, Dojindo, Kyushu, Japan). Briefly, 10 μL CCK-8 reagent was added into each well of cell culture, and the plates were further incubated for another 2 h. The absorbance at 450 nm was evaluated by a microplate reader. For colony formation assay, 2 × 10³ cells were plated in six-well plates for 2 weeks. Cells were fixed in 4% paraformaldehyde for 10 min and then stained by 0.1% crystal violet for 30 min. Experiments were repeated at least three times.

Apoptotic cells were evaluated by ANXA5 and propidium iodide (PI) staining (Invitrogen, A13201) according to the manufacturer’s instructions, and analyzed by flow cytometry (Beckman Coulter, USA).

Cells were trypsinized and resuspended, fixed overnight at 4 °C in 70% ethanol, stained with propidium iodide, and then analyzed by flow cytometry (Beckman Coulter, USA).

To detect cell migration and invasion, the cells were pretreated with mitomycin C (10 μg/mL) for 1 h to eliminate the influence of cell proliferation. The transwell chambers with 8-μm pores were obtained from Corning (Corning, NY). For cell migration detection, the transfected cells were harvested and resuspended in 100 μL serum-free medium and then transferred to the upper chambers. 500 μL DMEM supplemented with 10% FBS was added to the lower chamber. After incubation for 24 h, the Transwell membrane was fixed with 4% paraformaldehyde, stained with 0.1% crystal violet for 30 min, and then counted under a light microscope. For the invasion assay, the Transwell membrane (filter) was precoated with Matrigel BD Biosciences) at 37 °C overnight; the remaining experimental procedures were similar to the migration assay.

For RIP assay, cells were transfected with miR-182 or miR-NC. After 48 h, cells were used to perform RIP experiments by using an AGO2 antibody and the Magna RIP™ RNA-Binding Protein Immunoprecipitation Kit according to the according to the manufacturer’s instructions.

MS2-RIP assay was performed as previously described [21]. Cells were transfected with pcDNA3.1-MS2, pcDNA3.1-PCGEM1-MS2, or pcDNA3.1-PCGEM1-mut-MS2 (mutation in miR-182 binding sites). After 48 h, cells were used to perform RIP by using an anti-GFP antibody (Abcam) and the Magna RIP RNA-Binding Protein Immunoprecipitation Kit (Millipore) according to the manufacturer’s instructions. Then the co-precipitated RNAs level was analyzed by qRT-PCR.

RNA pull-down assay was performed as previously described [22]. In brief, PCGEM1 or PCGEM1-mut were in vitro transcribed, respectively, and biotin-labeled with the Biotin RNA Labeling Mix (Roche) and T7 RNA polymerase (Roche), treated with RNase-free DNase I (Roche), and purified with an RNeasy Mini Kit (Qiagen, Valencia, CA). 1 mg of whole-cell lysates were incubated with 3 μg of purified biotinylated transcripts for 1 h at 25 °C, then the complexes were isolated with streptavidin agarose beads (Invitrogen). The RNA present in the pull-down material was detected by qRT-PCR analysis.

The wild-type or mutant PCGEM1 was cloned into pmirGLO plasmid (named pmirGLO-PCGEM1 and pmirGLO-PCGEM1-mut). Cells were co-transfected with pmirGLO-PCGEM1 or pmirGLO-PCGEM1-mut and miR-NC or miR-182. After 48 h, Luciferase activities were measured using the Dual-Luciferase Reporter Assay System (Promega, USA). To detect the effect of PCGEM1 on FBXW11 3′UTR, the FBXW11 3′UTR was cloned into pmirGLO plasmid (named pmirGLO-FBXW11). Cells were co-transfected with pmirGLO-FBXW11 and miR-NC or miR-182. After 48 h, Luciferase activities were measured using the Dual-Luciferase Reporter Assay System (Promega, USA). NF-κB and β-catenin/TCF firefly luciferase reporter construct (TOPflash) and pRL-TK reporter plasmid encoding Renilla luciferase was purchased from Promega. Cells were plated in a 24-well plate and cotransfected with PCGEM1, NF-κB or β-catenin/TCF firefly luciferase reporter, and pRL-TK (Promega) by using Lipofectamine 2000. The pRL-TK vector was used as an internal control. 48 h later, cells were collected and analyzed using the Dual-Luciferase Reporter Assay System (Promega).

All experiments were performed at least three times. Data are presented as the mean ± standard error of mean (SEM). Statistical analysis was performed by using the SPSS 23.0 software. Student’s t test (for two groups comparison) or one-way analysis of variance (ANOVA; for more than two groups comparison) was utilized to analyze significant difference. The χ² test was carried out to explore the correlation between PCGEM1 levels and clinical features. Kaplan–Meier method and log-rank test was used to assess overall survival. p < 0.05 was considered statistically significant.

To verify the expression levels of PCGEM1 in human CC tissues, the expression of PCGEM1 in 68 pairs of CC and normal cervical tissues was determined by qRT-PCR. As shown in Fig. 1a, PCGEM1 expressions were significantly increased in CC tissues compared with normal tissues. In addition, the association between PCGEM1 expression and clinicopathological features of CC patients was analyzed. It was found that the elevated PCGEM1 expression was correlated with advanced International Federation of Gynecology and Obstetrics (FIGO) stage, lymph node and distant metastasis (Table 1). Kaplan–Meier survival curves showed that patients with high PCGEM1 levels presented with worse overall survival than patients with low PCGEM1 levels (Fig. 1b). Moreover, we detected the PCGEM1 levels in four CC cells, including C33A, HeLa, SiHa, and CaSki, and Ect1/E6E7 cells (normal human cervix epithelial cells). The results demonstrated a higher expression of PCGEM1 in these four CC cells, when compared with the Ect1/E6E7 cells (Fig. 1c). These data showed that the expression of PCGEM1 was upregulated in CC tissues and cell lines, indicating PCGEM1 might be involved in the CC progression.

To evaluate the roles of PCGEM1 in CC, overexpression and knockdown experiments were conducted. HeLa cells who had highest PCGEM1 were transfected with two different specific siRNAs (Fig. 2a), and SiHa cells who had lowest expression level of PCGEM1 were transfected with functional pcDNA3.1-PCGEM1 (Fig. 2b). The CCK-8 assay showed that knockdown of PCGEM1 significantly inhibited the proliferation of HeLa cells (Fig. 2c), while overexpression of PCGEM1 increased the proliferation of SiHa cells (Fig. 2d). A colony formation assay also confirmed that PCGEM1 knockdown markedly suppressed the colony formation ability in HeLa cells (Fig. 2e), whereas ectopic expression of PCGEM1 increased the colony formation number in SiHa cells (Fig. 2f).

We then detected apoptosis by flow cytometry analysis in CC cells. The results showed that deletion of endogenous PCGEM1 expression significantly promoted apoptosis in HeLa cells (Fig. 2g), while overexpression of PCGEM1 inhibited apoptosis in SiHa cells (Fig. 2h). Consistent with the flow cytometry data, the protein levels of Bax, cleaved PARP1, and cleaved caspase 3, the apoptosis protein markers, increased in PCGEM1 knockdown HeLa cells, but decreased in PCGEM1 overexpressing SiHa cells (Fig. 2i).

To further gain insights into the mechanism by which PCGEM1 promotes CC cell proliferation, flow cytometry was used to analyze differences in cell cycle distributions following PCGEM1 alteration. It was found that PCGEM1 knockdown significantly induced G1/S arrest in HeLa cells (Fig. 2j), while PCGEM1 overexpression drove progression beyond the G1/S transition in SiHa cells (Fig. 2k). Consistent with the flow cytometry data, the expression of G1/S phase checkpoint protein, such as CDK4, CDK6, and cyclinD1, was significantly markedly downregulated in HeLa cells with PCGEM1 knockdown and increased when PCGEM1 was overexpressed (Fig. 2l). Together, these data strongly demonstrated that PCGEM1 promotes cell proliferation by facilitating cell cycle progression and inhibiting cell apoptosis in CC.

A transwell assay demonstrated that knockdown of PCGEM1 significantly suppressed cell migration and invasion in HeLa cells (Fig. 3a), while ectopic expression of PCGEM1 markedly facilitated cell migration and invasion in SiHa cells (Fig. 3b). Since EMT progression is important for migration and invasion of CC cells, we tested whether PCGEM1 could induce EMT in CC cells. The qRT-PCR and western blotting analysis demonstrated that knockdown of PCGEM1 significantly reduced the mRNA and protein expression of mesenchymal markers (N-cadherin and vimentin), but increased the expression of epithelial markers (E-cadherin and ZO-1) in HeLa cells (Fig. 3c, e). In contrast, ectopic expression of PCGEM1 reduced the expression of epithelial marker E-cadherin and ZO-1, while increased mesenchymal marker N-cadherin and vimentin compared with control group in SiHa cells (Fig. 3d, e). Taken together, these results suggested that PCGEM1 facilitated CC cell migration and invasion.

We then investigated the mechanism of the effect of PCGEM1 on CC cells. Because the functions of lncRNAs depend on their subcellular distributio, we first examined the cellular localization of lncRNA PCGEM1. Using cytoplasmic and nuclear RNA fraction assay from CC cells, we observed that PCGEM1 was expressed in relative abundance in the cytoplasm (Fig. 4a), indicating that PCGEM1 may regulate gene transcription through association with miRNAs in a post-transcriptional manner. The online software miRcode (http://​www.​mircode.​org/​) was utilized to screen miRNAs that have complementary base paring with PCGEM1 (Additional file 1: Fig. S1). miR-182, miR-216a, miR-124a, miR-124b and miR-506 was identified to associate with PCGEM1. To validate this result, we performed MS2-binding sequences-MS2-binding protein-based RIP assay (MS2-RIP) and found that only miR-182 could be significantly pulled down by PCGEM1 (Fig. 4b). The RNA pull-down assay further demonstrated a direct interaction between PCGEM1 and miR-182, while PCGEM1 with mutations in miR-182 targeting site (PCGEM1-mut) could not associate with miR-182 (Fig. 4c). For further confirmation, we constructed luciferase reporters containing wild-type (WT) or mutated miR-182 binding sites (PCGEM1-mut). The luciferase activity of cells transfected with PCGEM1 WT plasmid was significantly decreased by miR-182 mimics, while there was no difference in cells transfected with empty vector or PCGEM1-mut plasmid (Fig. 4d). To assess whether PCGEM1 was regulated by miR-182 in an AGO2-dependent manner, we conducted anti-AGO2 RIP in CC cells transiently overexpressing miR-182. Endogenous PCGEM1 pull-down by AGO2 was specifically enriched in miR-182-transfected cells (Fig. 4e). Overexpression of wild-type PCGEM1 instead of the mutant PCGEM1, significantly reduced the levels of miR-182 in SiHa cells (Fig. 4f). Conversely, miR-182 expression was increased by depletion of endogenous PCGEM1 expression in HeLa cells (Fig. 4g). The expression of miR-182 was downregulated in CC tissues compared with normal tissues (Fig. 4h). Additionally, we found a dramatically negative correlation between PCGEM1 and miR-182 in CC tissues in CC tissues (Fig. 4i). Taken together, these results suggest that miR-182 is a bona fide PCGEM1-targeting microRNA.

To investigate the miR-182 effect on CC, we detected CC cell proliferation, migration and invasion after miR-182 overexpression or inhibition. The cell proliferation, migration and invasion was inhibited by miR-182 overexpression in HeLa cells (Fig. 5a, b), while miR-182 knockdown showed the opposite effects in SiHa cells (Fig. 5c, d). To determine whether the oncogenic effects of PCGEM1 were mediated by miR-182, CC cells with PCGEM1 alteration were transfected miR-182 mimics or inhibitor (Fig. 5e, f). It was shown that miR-182 mimics abolished the promotion of proliferation, migration and invasion mediated by PCGEM1 upregulation (Fig. 5g, i). In contrast, transfection with miR-182 inhibitor rescued the inhibitory effect of PCGEM1 siRNAs on cell proliferation, migration and invasion (Fig. 5h, j). Together, these data confirmed that miR-182 mediates the oncogenic effects of PCGEM1 in CC cells.

To explore the target of PCGEM1-miR-182, informatics tools of three miRNA target-prediction programs (TargetScan, miRDB and miRcode) were used to search for the candidate targets and found oncogene FBXW11 3′UTR contains the binding sits of miR-182 (Fig. 6a). We performed luciferase reporter assays to confirm that the luciferase activity of wild-type FBXW11 3′UTR instead of its mutant was significantly inhibited by transfection of miR-182 mimics (Fig. 6b), but increased by miR-182 inhibitor (Fig. 6c). Furthermore, the mRNA and protein expression of FBXW11 was significantly reduced by miR-182 overexpression in HeLa cells (Fig. 6d, f). Conversely, miR-182 knockdown increased the expression of FBXW11 in SiHa cells (Fig. 6e, f).

Next, we investigated whether PCGEM1 could regulate the expression of FBXW11. Our data showed that overexpression of PCGEM1 upregulated FBXW11 mRNA and protein expression in SiHa cells, which was attenuated by miR-182 overexpression (Fig. 7a, b). Conversely, FBXW11 expression was suppressed by PCGEM1 knockdown, which was rescued by inhibition of miR-182 (Fig. 7c, d). To ascertain whether this observed effect depends on regulation of the FBXW11 3′UTR, luciferase reporters plasmid containing FBXW11 3′UTR (pmirGLO-FBXW11) was constructed. pmirGLO-FBXW11, or the control reporter was transfected into CC cells with PCGEM1 alteration. Ectopic expression of PCGEM1 increased the luciferase activity of pmirGLO-FBXW11 in SiHa cells. miR-182 abolished this upregulation (Fig. 7e). Reciprocally, silence of PCGEM1 reduced the luciferase activity of pmirGLO-FBXW11, which was rescued by inhibition of miR-182 (Fig. 7f). The pathologic correlation of PCGEM1 and FBXW11 was then explored. FBXW11 was overexpressed in CC tissues compared with normal tissues (Fig. 7g). Notably, an obvious positive correlation between the levels of PCGEM1 and FBXW11 mRNA was observed in CC tissues (Fig. 7h). Thus, we concluded that FBXW11 was a direct target of miR-182 and positively regulated by PCGEM1 in CC cells.

NF-κB and β-catenin/TCF play important roles in CC progression [23, 24]. Since FBXW11 could activate both the NF-κB and β-catenin/TCF signaling pathways [25], we suspected that lncRNA PCGEM1 may regulate these two signaling pathways through FBXW11. For confirmation, a dual luciferase reporter system was used and the results showed that both the NF-κB and β-catenin/TCF signaling pathways were enhanced by PCGEM1 overexpression, while knockdown of FBXW11 abolished this upregulation (Fig. 8a, b). Furthermore, we detected whether PCGEM1 affected the expression of downstream gene of NF-κB and β-catenin/TCF signaling pathways by qRT-PCR. NF-κB-regulated (including cyclinD1, IL-6, MMP9, CD44, Bcl-xL) and β-catenin/TCF-regulated (including myc, MMP7, Axin-2, CD44, cyclinD1, TCF-1) genes were markedly upregulated by PCGEM1. This upregulation was attenuated by silence of FBXW11 (Fig. 8c). The above data suggested that PCGEM1 promoted the activation of NF-κB and β-catenin/TCF signaling pathways via regulating of FBXW11.