Background
The life cycle of
Plasmodium falciparum parasites includes multiple rounds of asexual replication in human host erythrocytes. A small subset of parasites, upon invasion of new red blood cells, do not enter schizogony, but develop into cell cycle-arrested gametocytes [
1]. Gametocytes are the only forms able to survive in the mosquito vector, and their formation is therefore essential for malaria transmission. How malaria parasites regulate the switch from erythrocytic schizogony to gametocytogenesis is still not understood. Bruce
et al.[
2] showed that merozoites released from a single schizont become either all asexual parasites or all gametocytes, indicating that the switch to sexual differentiation is likely to occur during the preceding asexual red blood cell cycle. Sex determination occurs at the same time or soon after the switch to sexual development, as the entire progeny of a given gametocyte-producing schizont comprises exclusively either male or female cells [
3]. The mechanism of parasite commitment to sexual differentiation appears to be constitutive but may be modulated by the environment, as reviewed in [
4].
The NIMA-related protein kinases (Neks) constitute a family of eukaryotic serine/threonine kinases implicated in cell cycle control, and whose main role is to regulate centrosome and cilia function [
5,
6]. The
P. falciparum kinome includes four Nek kinases, two of which, Pfnek-2 and Pfnek-4, were shown to be predominantly or exclusively expressed in sexual stages, suggesting a possible role in the sexual development of the parasite. Consistent with this hypothesis, it has been previously shown that the rodent malaria parasite
Plasmodium berghei NIMA-related kinases Pbnek-2 and Pbnek-4, displaying female gametocyte-specific expression, are essential for pre-meiotic genome replication in the zygote and ookinete formation in the mosquito host [
7‐
9]. Here, the expression and function of the
P. falciparum Nima-related kinase Pfnek-4 were investigated at the onset and during progression of gametocytogenesis. A subpopulation of asexual stage parasites undergoing schizogony and expressing the Pfnek-4 protein was identified. Further analyses indicate that the progeny of these asexual parasites is more likely to differentiate into gametocytes in the subsequent red blood cell cycle. Since not all asexual parasites expressing Pfnek-4 appear to be committed to sexual development, altogether the data suggest that Pfnek-4 identifies a population of committed and reversibly pre-committed parasites.
Methods
Molecular cloning and plasmid constructs
Genomic and cDNA sequence data were accessed via PlasmoDB [
10].
The pfnek-4 gene PlasmoDB identifier is PF3D7_0719200, MAL7P1.100 in earlier versions. The Pfnek-4-GFP plasmid (pCHD-Pfnek-4) was generated by using the pHGB and pCHD-1/2 transfection vectors based on Gateway
TM recombinational cloning and described in Tonkin
et al.[
11]. The 997-bp 5’-flanking region of Pfnek-4 was amplified from 3D7 genomic DNA using the forward OL-306 (GGGTCGACGAACTCATCATTCATA) and reverse OL-308 (CCAGATCTTGAATGGTTATAAGATATAC) oligonucleotides containing
Sal I and
Bgl II sites, respectively. The 933-bp Pfnek-4 open reading frame was amplified from a gametocyte cDNA library using the oligonucleotides forward OL-598 (CCCAGATCTATGAATAAATATGAAAAGATTAGAG) and reverse OL-599 (CCCCCTAGGAGTATCAACAACATCCAG) containing
Bgl II and
Avr II sites, respectively. The digested products, ~1-kb 5’-flanking region and open reading frame of Pfnek-4, were sequentially ligated into the plasmid pHGB to produce the pHGB-Pfnek-4-GFP entry clone. This plasmid was used in a recombination reaction with the pCHD-1/2 destination vector containing the cassette responsible for expression of hDHFR conferring resistance to WR99210 treatment, to produce the final transfection vector pCHD-Pfnek-4-GFP.
The pCC1 and pCC4 vectors constructed for negative selection of single crossover recombinants in the generation of knock-out parasites have been described [
12] and formed the basis for the generation of plasmids pScCDUP
Pfnek-4 and phDHFR
Pfnek-4 described here. The pScCDUP
Pfnek-4 plasmid was constructed by replacing the 857-bp SacII-XhoI hsp86 5’ sequence of pCC4 by the 997-bp 5’-flanking region of
pfnek-4 amplified from genomic DNA with forward OL-1082 (GGCCGCGGGAACTCATCATTCATA) and reverse OL-1083 (GGCTCGAGTGAATGGTTATAAGATATAC) containing
Sac II and
Xho I sites, respectively, generating an expression vector in which the yeast cytosine deaminase gene is placed under the control of the
pfnek-4 promoter. The phDHFR
Pfnek-4 plasmid was constructed by replacing the ~1.1–kb
Xho I-
Xma I yeast cytosine deaminase coding sequence from the pScCDUP
Pfnek-4 plasmid by ~0.6–kb of the hDHFR sequence amplified from plasmid pCC1 with forward OL-1084 (GGCTCGAGATGCATGGTTCGCTAAACTGC) and reverse OL-1085 (GGCCCGGGTTAATCATTCTTCTCATATAC) containing
Xho I and
Xma I sites, respectively, generating an expression vector in which the hDHFR gene is placed under the control of the
pfnek-4 promoter.
A pfnek-4 gene disruption plasmid was produced in the plasmid pCAM-BSD that contains the gene conferring resistance to blasticidin. The oligonucleotide pair forward OL-46 (GGGGGGATCCAATTATGGAAATACAATACT) and reverse OL-47(GGGGCGCCGGCGTGGACTTAAATAATAAGG) containing Bam HI and NotI sites was used to amplify a 1,017 bp fragment for insertion to pCAM-BSD. Ring-stage parasites were electroporated with 50–100 μg plasmid DNA, as previously described. Blasticidin (Calbiochem) was added to a final concentration of 2.5 μg/ml 48 hours after transfection to select for transformed parasites. Resistant parasites appeared after three to four weeks and were maintained under selection. After verification by PCR that pfnek-4
-
parasites were present, the population was cloned by limiting dilution in 96-well plates (0.25/0.5/1.0 parasite per well). Genotypic analysis enabled selection of independent pfnek4- clones for further phenotypic analysis. All constructs were sent to the Dundee Sequencing Service, University of Dundee, UK, for sequence verification before being used.
Parasite culture, transfection and determination of the growth rate
The 3D7 clone of
P. falciparum, its F12 subclone and the 3D7 and F12 transfectants were grown in human erythrocytes using 0.5% Albumax II (Invitrogen) and synchronized using sorbitol as described previously [
13]. For transfections, synchronized ring-stage parasites (3D7 and F12) were electroporated with 50–100 μg of plasmid DNA using standard procedures. Transformed parasites were selected in presence of 5 nM WR22910 (Jacobus Pharmaceutical Co Inc, Princeton, NJ, USA) or 2.5 μg ml
-1 blasticidin (Calbiochem). Parasitaemia was monitored by Giemsa-stained thin blood smears. Induction of gametocytogenesis was performed according to the protocol of Carter
et al.[
14], culturing asexual blood stage parasites for four to five days in 6%-haematocrit blood cultures to high 8-10% parasitaemia.
Nested RT-PCR and diagnostic PCR
Total RNA samples were extracted from parasite pellets using TRIzol lysis solution (Invitrogen). DNase treatment of RNA samples prior to RT-PCR was performed by incubation at 37°C for 30 min using the RQ1 RNase-free DNase I purchased from Promega. The DNase was inactivated by incubation at 65°C for 10 min. RT-PCRs were performed with 500 ng of total RNA/reaction using the ImPromII reverse transcription system purchased from Promega. The RT reactions were incubated at 42°C for 1 h. For the first round of PCR (30 cycles at 94°C for 45 sec, 55°C for 45 sec, and 68°C for 2 min), Pfnek-4-specific primers were forward OL-587 (GAGAGGGATCCATGAATAAATATGAAAAGA) and reverse OL-586 (GAGAGGTCGACTTAAGTATCAACAACATCC). For the second round of PCR (25 cycles at 94°C for 45 sec, 55°C for 45 sec, and 68°C for 2 min), 1 μl (1/25) of each PCR product was reamplified using the Pfnek-4-specific primers forward OL-46 (GGGGGGATCCAATTATGGAAATACAATACT) and reverse OL-47 (GGGGCGCCGGCGTGGACTTAAATAATAAGG).
Disruption of the pfnek-4 gene was analysed by diagnostic PCR using three primer pairs. The primer pair forward OL-761(CACGACATTACATAATAAAAGC) and reverse OL-763 (ATCCCTTTTATGAATTTACTG) produced a 1288-bp fragment corresponding to the undisrupted Pfnek-4 locus from wild-type 3D7. Primer pairs forward OL-761 and reverse OL-168 (CAATTAACCCTCACTAAAG), and forward OL-167 (TATTCCTAATCATGTAAATCTTAAA) and reverse OL-764 (TCGAAGAGGTCATTATATATC) amplified across the 5’ and 3’ ends of the integration site, giving rise to 1,179- and 1,277-bp products only in the disrupted locus, respectively.
Western blot analysis
Western blot analysis was performed on cell-free extracts prepared by resuspending parasite pellets in M-PER Mammalian Protein Extraction Reagent (Pierce) supplemented with 1 mM phenylmethylsulphonyl fluoride and Complex
TM mixture protease inhibitor tablet from Roche Applied Science. Immunoblotting was performed as described [
13], using monoclonal anti-GFP antibodies (Roche) and horseradish peroxidase-conjugated sheep anti-mouse IgG antiserum (Sigma). Lambda protein phosphatase (New England BioLabs) was used to dephosphorylate protein extracts (20 μg) 30 min at 30°C following the supplier recommendations prior to western blot analysis.
Fluorescence microscopy
Live imaging of parasite transfectants was performed on a Delta vision deconvolution fluorescence microscope (100x/1.4 oil immersion objective Olympus IX-70). Images were processed using IMARIS version 7.0. For live imaging, parasite nuclei were stained by incubation 10 min at 37°C in complete medium containing 1 μg ml-1 Hoechst 3342 (Invitrogen).
Flow cytometry and cell sorting
Flow cytometer analysis of parasite subpopulations was performed on a FACScan flow cytometer (Becton Dickinson Biosciences). Cells were either fixed in 0.025% glutaraldehyde and propidium iodide (PI)-stained or directly stained with 1 μg ml-1 Hoechst 33258 (Invitrogen) prior to analysis. The threshold was set to a value eliminating uninfected red cells. For sorting Pfnek-4-GFP-expressing transfectants, late trophozoite-stage parasites were first enriched by using the VarioMACS separator and CS MACS columns (MiltenyiBiotec), then returned to culture conditions for three to four hours prior to cell sorting using a FACS ARIA II SORP Instrument (Becton Dickinson Biosciences). In two independent experiments, Pfnek-4-GFP- (4 106 and 12 106) and Pfnek-4-GFP+ (0.8 106 and 1.6 106) parasites, respectively, were collected over a four-hour cell sorting period and returned to culture conditions in flat-bottom 96-well plates with fresh red blood cells to 2% -haematocrit and 1% -parasitaemia. Gating of GFP- and GFP+ parasite populations has been set in a restrictive way such that the sorted cells exhibited high levels of purity in both experiments (purity of GFP- sorted cells, 100%; GFP+ sorted cells, 92.8 and 97.2%) when re-analysed by FACS analysis.
Discussion
In
P. falciparum, the commitment to gametocytogenesis occurs during the preceding asexual RBC cycle [
2]. The present study identifies a subset of schizont-stage parasites expressing Pfnek-4, a protein kinase previously thought to be gametocyte-specific. Upon sorting, Pfnek-4-GFP positive schizonts produced elevated levels of gametocytes in the subsequent red blood cell cycle. The experimental approach is based on episomal expression of Pfnek-4-GFP fusion protein driven by 1 kb-genomic DNA upstream of the Pfnek-4 coding sequence. It cannot be formally excluded that the proper expression pattern is not maintained in this conditions. However, a study by Khan
et al.[
7] reported the ability of a 678 bp-
Pbnek-4 promoter to drive the expression of a reporter GFP protein in female gametocytes, but not in male gametocytes or asexual blood stages. In this latter study, nine out of ten promoters (the only exception being most likely due to the short 5’ region available from the genome database), were found to drive the expression of the GFP reporter protein in agreement with the prediction from proteomic analyses, suggesting that sex-specific expression is mainly controlled by the 5’ UTR/promoter. In another instance, the episomal expression of the HA-epitope-tagged
P. falciparum protease, PfROM1, placed under control of its own promoter element, revealed an expression at mature stages and localization to the mononeme, a newly described apical organelle of
P. falciparum merozoites [
17]. The nucleus-associated punctuate pattern observed for Pfnek-4-GFP distribution, which is reminiscent of what is observed with the
P. falciparum Aurora-related kinase Pfark-1, is consistent with the location of Nima- and Aurora-related kinases, many members of which associate with centrosomal structures (see below). Thus, it is proposed that there is a high likelihood that the localization observed with the episomally-encoded Pfnek-4-GFP fusion protein might reflect that of the endogenous enzyme.
It should be stressed that: (i) the sorted Pfnek-4-GFP positive schizont population not only generated gametocytes but also parasites undergoing asexual RBC cycles; and (ii) a proportion of the parasites positively selected for expression of the hDHFR resistance marker driven by the
pfnek-4 gene was still able to undergo asexual cycles. Altogether these findings support and expand previous studies indicating that malaria parasites have quantitative sensitivity to gametocyte induction and that multiple stimuli can induce gametocytogenesis, reflecting the highly flexible mechanism underlying sexual differentiation [
4]. Noteworthy, high rate conversion to sexual forms of asexual parasites grown at high densities was shown to be reversible by dilution within a time window smaller than the time required for one asexual cycle (48 hours) [
2]. This feature might explain the relatively lower gametocyte conversion rate observed in the GFP
+ sorted parasites (2.2%), as compared to normal 3D7 parasites grown under gametocyte-inducing culture conditions (~4-5%). Altogether, the data suggest that Pfnek-4 identifies a population of committed and reversibly pre-committed parasites. Since sex determination appears to occur simultaneously to commitment to sexual differentiation, the asexual subpopulation expressing Nek-4, a protein shown to be restricted to female gametocytes in the rodent malaria parasite
P. berghei[
7,
8], is likely to represent the progenitor of female rather than male gametocytes, although this question remains to be further investigated.
The expression of a gametocyte-specific gene product in sexually-committed asexual parasites is consistent with a developmental change in gene expression during sexual differentiation [
18,
19], and extends previous studies reporting the expression of gametocyte-specific genes, such as Pfs16, in sub-populations of asexual-stage parasites [
9,
20,
21]. Since some of the asexual parasite population expressing Pfnek-4 did not appear to be fully committed to sexual differentiation (being still able to undergo RBC cycles, see above), a switch to gametocyte-specific gene expression may occur before the “no-return”decision to commit to gametocytogenesis is made. Analysing genes expressed in the sexually-committed population would be of great interest to explore gene regulation in the context of commitment to gametocytogenesis, and would help to identify signatures of early sexual development of malaria parasites. Identification of Pfnek-4 as a molecular marker of sexually-committed schizonts provides a useful tool, making this parasite population amenable to purification followed by transcriptome and proteome analyses. Transcriptional regulator candidates controlling expression of subsets of genes are the ApiAP2 family of proteins. De Silva
et al.[
22], reported highly coherent expression patterns of predicted downstream targets of
P. falciparum AP2 transcription factors, suggesting essential roles in parasite development. Translational regulation also plays a critical role during commitment to gametocytogenesis [
18,
19]. Targeted disruption of PfPuf2, a member of the Puf family of translational repressors was shown to promote the formation of gametocytes and the differentiation of male gametocytes [
23].
In
P. berghei, the Nek-4 kinase does not appear to be required for gametocytogenesis but is essential for pre-meiotic DNA replication in the zygote, consistent with cell-cycle related functions [
7,
8]. That
pfnek-4
-
P. falciparum parasites are able to undergo gametocytogenesis and produce mature stage V gametocytes, indicates that Pfnek-4 is not required for the early stages of the sexual cycle in both
P. berghei and
P. falciparum. This conclusion is also supported by the finding that
pfnek-4
-
clones produce female gametocytes. It is intriguing that the timing of recruitment of the Pfnek-4 protein to schizont nuclear bodies appears to coincide with the occurrence of nuclear divisions. Noteworthy, all nuclei within a single schizont appear to be associated with punctuate Pfnek-4-GFP fluorescence from early developing to multinucleated schizont, in contrast to Pfark-1, a mitotic kinase that marks only a subset of nuclei in a given schizont as a result of transient recruitment at the spindle pole bodies, a consequence of asynchronous nuclear division in a single schizont [
13]. In contrast to Pfark-1, the Pfnek-4-GFP protein appears to associate to all nuclei, irrespective of their nuclear division status. Furthermore, cell cycle-arrested stage II gametocytes were found to express the Pfnek-4-GFP protein with a punctuate fluorescence similar to parasites undergoing schizogony. Preliminary results showing a close association of doublets of Pfnek-4-GFP fluorescence with short mitotic spindle microtubules in schizont-stage parasites (data not shown), are consistent with a recruitment of Pfnek-4 at nuclear spindle pole bodies, the centrosome equivalent of
Plasmodium parasites, an observation consistent with the known centrosomal functions of Nima-related kinases. However, the sub-cellular structure to which Pfnek-4 associates remains to be better defined. Whether the Pfnek-4 enzyme has cell-cycle-related functions in RBC-stages still remains to be elucidated.
Acknowledgements
We thank Richard Carter (University of Edinburgh, Edinburgh,UK) for providing the F12 clone, Geoffrey I. McFadden (University of Melbourne, Parkville, Australia) for providing pHGB and pCHD-1/2 plasmids, Alan F. Cowman (The Walter and Eliza Hall Institute of Medical Research, Parkville, Australia) for providing pCC1 and pCC4 plasmids. We also thank Gonzalo Tapia, Flow Cytometry Core Facility (EPFL, Lausanne, Switzerland), and members of the Bioimaging and Optics Platform (EPFL, Lausanne, Switzerland) for passing on their expertise in image analysis software IMARIS.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
LR carried out molecular cloning, RT-PCR, western blotting, parasite genetic manipulations, analyses by fluorescence microscopy and flow cytometry, and participated in conception of the study and writing of the manuscript. MG performed the cell sorting. AT performed and analysed parasite growth. SM performed and analysed parasite growth and participated in writing of the manuscript. CD participated in conception of the study and writing of the manuscript. All authors read and approved the final manuscript.