Background
Lung cancer is the leading cause of cancer-related deaths world-wide in both men and women [
1]. The carcinogenic toxins in cigarette smoke that create inflammation and accumulation of somatic mutations in the cellular DNA have been implicated as the leading cause of lung cancer development [
2,
3]. Non-small cell lung cancer (NSCLC) is the most common type of lung cancer comprising approximately 85 % of lung cancer diagnoses [
4]. NSCLC that is discovered early is often treated through resection and adjuvant therapy involving a platinum agent [
5]. Advanced disease is treated with palliative platinum based chemotherapy [
6]. Only about 10 % of patients with NSCLC will harbor molecular changes rendering their tumor sensitive to an approved targeted agent. While a number of new targeted agents are being investigated, therapies that have novel mechanisms of actions are urgently needed for lung cancer patients [
7].
Triptolide is a natural compound isolated from the Thunder God Vine,
Tripterygium wilfordii, which has been used in traditional Chinese medicine to treat autoimmune disorders and inflammation, including lupus and rheumatoid arthritis [
8]. Triptolide also has potent anti-tumor activity in a variety of cancers, including lung cancer [
9,
10]. Triptolide perturbs multiple signaling pathways including NFkB, HSP70, and p53 pathways, which decreases cell proliferation and induces apoptosis [
11‐
13]. In lung cancer, triptolide has been shown to sensitize cells to TRAIL-induced apoptosis and enhance p53 activity [
14]. We previously showed that triptolide inhibits the Wnt pathway in lung cancer via overexpression of Wnt inhibitory factor 1 (WIF1), which is silenced in most lung cancers by promoter hypermethylation. Though triptolide has anti-tumor effects, its clinical use is limited by toxicity and unfavorable pharmacokinetics [
15]. Recently, triptolide derivatives have been developed in order to optimize bioavailability with decreased toxicity.
The triptolide derivative MRx102 (MyeloRx, Vallejo, CA) has been previously shown to have antileukemic activity both in vitro and in vivo by promoting apoptosis of AML cells and can overcome the protection garnered by the microenvironment [
16]. Though MRx102 decreases tumorgenicity of blood malignancies, its effect on lung cancer is unknown. To determine the potential of MRx102 as a novel therapeutic for lung cancer, we investigated the effect of MRx102 on the proliferation, survival, and migration of NSCLC cell lines in vitro and the effect on tumor formation and metastasis in vivo. We found that MRx102 significantly decreases Wnt pathway activation, cell proliferation, migration, and invasion in H460 and A549 cells. In addition, both tumor formation and metastasis were inhibited in murine models, including a patient derived xenograft (PDX) NSCLC model.
Methods
Reagents and antibodies
Dulbecco’s Modified Eagle Medium (DMEM) was purchased from Life Technologies (Carlsbad, CA). 8.0 micron Transwell dishes with Matrigel coating for invasion assays or without ECM coating for the migration assays were purchased from BD Biosciences (San Jose, CA). MRx102 was a kind gift from MyeloRx LLC (Vallejo, CA).
WIF1 antibody (MABN722) was purchased from EMD/Millipore (Temecula, CA). The GAPDH, phospho β-catenin, and total β-catenin, and p53 antibodies were purchased from Cell Signaling (Danvers, MA). The phosphor Akt and total Akt antibodies were purchased from Santa Cruz Biotechnology (Dallas, TX). HRP-conjugated goat anti-rabbit and goat anti-mouse secondary antibody were purchased from Genetex (Irvine, CA).
Cell culture and drug treatment methods
H460 and A549 human NSCLC cells were acquired from ATCC and cultured in 5 % CO2 at 37 °C in DMEM containing 10 % FBS, 1 % sodium pyruvate, 1 % L-glutamine/gentamycin and 1 % penicillin/streptomycin (complete medium).
MRx102 (MyeloRx, Vallejo, CA) was diluted with DMSO and a 10nM concentration for use in the in vitro assays unless otherwise indicated.
Annexin V staining for apoptosis
Analysis of apoptosis was conducted using the AnnexinV-FITC Apoptosis Detection Kit from Life Technologies (Carlsbad, CA) according to the manufacturer’s protocol. Briefly, control and triptolide treated H460 and A549 cells were harvested after 48 h and washed with PBS and Binding Buffer. The cells were then labeled with AnnexinV-FITC for 15 min and washed and resuspended in Binding Buffer. Propidium Iodide staining solution was added to the resuspended cells to check for viability. Stained cells were examined using a CyAn flow cytometer (Beckman Coulter, Brea, CA). The FlowJo analysis software was used to analyze the percentage of cells undergoing apoptosis.
RT-PCR
RNA was isolated using the Purelink RNA Mini kit from Life Technologies (Carlsbad, CA) according to the manufacturer’s protocol. The RNA was then reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription kit from Applied Biosystems (Grand Island, NY) according to the manufacturer’s protocol. The RT-PCR was performed using Taqman gene-specific probes (Applied Biosystems) with Taqman Fast Universal Master Mix (Life Technologies) according to the published protocol using the Viia7 RT-PCR machine (Applied Biosystems). The GAPDH RNA expression was used to normalize the WIF1 levels.
Western blotting
Immunoblotting was performed using nitrocellulose membranes and 4–12 % Bis-Tris Nupage gels from Life Technologies (Carlsbad, CA). The membranes were blocked with 5 % non-fat milk before the addition of the primary antibody.
Migration and invasion assays
Migration was analyzed using Transwell filters coated with 5 μg/ml fibronectin on the bottom of the filter (haptotaxis). Control or MRx102 treated cells (1×10
5) were added to the top of the filter and allowed to migrate for 6 h. Cells remaining on top of the filter were removed. The migrated cells were fixed in 4 % paraformaldehyde and the filter was mounted in Prolong Gold with DAPI on a microscope slide. Migration and invasion was analyzed using fluorescence microscopy. The assay was completed three times in triplicate and nine random images were obtained per filter. Invasion assays were performed as previously described and DAPI was used to visualize the cellular nuclei [
17].
Top flash luciferase assay
Transient transfections were performed with polyethylenimine transfection reagent (Sigma, St. Louis, MO) on 1×105 H460 and A549 cells that were plated in a 24-well plate. In the corresponding wells, 0.5 μg of the TOP-FLASH or FOP-FLASH firefly luciferase reporter plasmid and, as an internal control, 0.05 ug of the Renilla luciferase reporter pTK (Promega, Madison, WI) was used. After 24 h, DMSO as a control or 10nM MRx102 was added to the corresponding wells. After 48 h of treatment, the cell lysate was collected and the luciferase activity was determined using the Dual Luciferase Assay System (Promega, Madison, WI) and a luminonmeter. The firefly luciferase activity was normalized to the Renilla luciferase activity.
Bisulfite conversion of genomic DNA and methylation analysis
Genomic DNA from control and MRx102 treated (96 h) A549 and H460 cells was extracted using the QIAamp DNA mini-kit (Qiagen, Valenica, CA) according to the manufacturer’s protocol. 400 ng of the genomic DNA was used for bisulfite conversion. The bisulfite conversion was carried out using the EZ DNA Methylation-Lightning kit (Zymo Research, Irvine, CA) according to the manufacturer’s published protocol. 5 ul of the bisulfite converted DNA was used for PCR analysis with primers specific for the methylated and unmethylated versions of the WIF1 promoter region. The PCR product was then run on a 2 % agarose gel and imaged using UVP Gel Imaging System (Upland, CA).
Primer Sequences:
-
WIF1-methylatedF,TCGTAGGTTTTTTGGTATTTAGGTC
-
WIF1-methylatedR,ATACTACTCAAAACCTCCTCGCT
-
WIF1-unmethylatedF,TGTAGGTTTTTTGGTATTTAGGTTG
-
WIF1-unmethylatedR,CATACTACTCAAAACCTCCTCACT
Microscopy
Fluorescence and brightfield imaging were performed using a Zeiss Axio Observer Z1 inverted microscope equipped with Axiocam MRc5 (brightfield) and Hamamatsu Orca CCD (fluorescence) cameras.
Animal studies
Subcutaneous Xenograft Mouse Model - H460 human lung cancer cells (5×105) were injected into the hind flank of 4–8 week old NSG mice. The mice were monitored for tumor growth. Treatment was started when tumors reached 50–100 mm3 by measurement with calipers. Mice were split into groups of at least nine mice and treated as indicated with either control (PBS) five times per week, triptolide (0.5 mg/kg) three times per week, MRx102 (1, 2, 3, or 4 mg/kg) five times per week, carboplatin (15 mg/kg) once per week, or a combination of MRx102 (2 mg/kg) and carboplatin (15 mg/kg) once per week, by interperitoneal injection (IP). Tumors were harvested when the tumors in the control group began to reach 1500 mm3 (approximately two and half weeks).
Patient-Derived Xenograft Mouse Model – Human lung cancer tissue was obtained from research participants at the time of surgical resection of lung cancer. The tissue was collected fresh and was immediately dissected, minced into tissue blocks at about 3 mm in diameter and placed in saline with antibiotics. NSG mice at 6–10 weeks old were anesthetized by isoflurane inhalation. The dorsal area of NSG mice was shaved and prepared with a povidine-iodine/alcohol solution. A small cut was made in the prepared skin and a pocket under skin was created using a pair of forceps. The human cancer tissue blocks were transplanted into this subcutaneous dorsal skin compartment of the NSG mice. The wound was closed by using skin glue. Once the tumors reached a sufficient size, the tissue was passaged into another group of NSG mice. On the third passage, and once tumors reached 100 mm3 (as measured by calipers) treatment was started as indicated with either control (PBS) five times per week, MRx102 (3 mg/kg) five times per week, cisplatin (6 mg/kg) once per week, or a combination of MRx102 (3 mg/kg) and cisplatin (6 mg/kg) once per week, by IP injection with at least seven mice per treatment group. Tumors were harvested when control tumors began to approach the 1500 mm3 maximum (approximately 3 weeks). Tumors were stained for Wnt3a expression by a participating pathologist (SWT). One high Wnt3a and one low Wnt3a lung adenocarcinoma PDX model was selected for these experiments.
Tail Vein Injection Mouse Model - H460 (5×104) and A549 (1×105) cells were injected into the tail vein of 6–8 week old NSG mice. After 2 weeks the mice began to receive control (PBS) or MRx102 (3 mg/kg) by IP injection three times a week for 8 weeks with at least eight mice per group. Mice were then euthanized and the lungs and liver were harvested, fixed in 10 % formalin, and paraffin embedded for pathological examination of H&E slides.
The NSG mice used for these studies were bred at the City of Hope Medical Center animal facility.
Statistical analysis
All quantified data were plotted and analyzed in GraphPad Prism 6.0 using a Student t-test or one-way Anova with Tukey post test. Data are representative of at least 3 independent experiments as replicate means ± SEM. ** or *** are p values < 0.01, or 0.001, respectively.
Discussion
Triptolide is a natural product that has been shown to be an effective anti-inflammatory and anti-tumor compound [
8]. Though triptolide has potent effects in pre-clinical studies, the development of triptolide into a useful cancer drug has been limited by its unfavorable pharmacokinetic and toxicity profile [
15]. The toxicity of triptolide has led to the development of derivatives that are being tested for having a similar effect as triptolide without the unwanted toxicity. One of these triptolide derivatives is MRx102. MRx102 is converted to triptolide during in vivo treatment and was found to have a similar mechanism of action compared to triptolide [
16]. Here we have shown that MRx102 significantly decreases NSCLC cell proliferation, migration, and invasion. MRx102 also leads to increased apoptosis in H460 cells through upregulation of p53 and decreased Akt activity. In addition to its anti-proliferative effects in vitro, MRx102 is also effective in reducing tumor formation and metastasis in NSG mice injected with NSCLC cells.
Canonical Wnt pathway signaling is crucial for proper embryonic development by controlling cell migration, proliferation, and differentiation [
22]. Wnt pathway components also facilitate the maintenance of the adult stem cell population [
23]. Aberrant activation of these components and maintenance of the stem cell populations is thought to contribute to the carcinogenesis of many malignancies including NSCLC [
24,
25]. Promoter hypermethylation and downregulation of WIF1, a secreted Wnt inhibitor that modulates Wnt activity by directly binding to Wnt ligands, is thought to be critical for lung cancer progression and is a prognostic biomarker for patient survival [
26]. We found that MRx102 decreases Wnt pathway activation and increases WIF1 expression. Notably, we determined that the increase in WIF1 expression was due to changes in epigenetic modification at the WIF1 promoter region. Importantly, we discovered that MRx102 has the greatest efficacy in lung cancer cell lines with low WIF1 expression. Also patient tissue that has low expression of WIF1 was more sensitive to MRx102 treatment than tumors with high WIF1 expression. The ability of MRx102 to target the Wnt pathway and the sensitivity of WIF1 downregulated tumors to MRx102 treatment could lead to MRx102 as a viable therapeutic for patients who have low expression of this inhibitory factor.
We did not observe any adverse effects, including no change in weight or activity level, with 2–4 mg/kg MRx102 treatment administered by IP injection 5 days a week. The time lengths of treatment varied from 3 to 8 weeks, so it is possible that there may be treatment-related adverse effects during prolonged treatment. Taken together, MRx102 appears to be well tolerated at higher doses compared to triptolide.
Acknowledgements
We would like to thank the City of Hope Animal Tumor Model Core for their assistance with the patient-derived xenograft in vivo assay and the Light Microscopy, Veterinary Pathology, and Analytical Cytometry cores for their help with assays defined in this paper. M50 Super 8x TOPFlash (Addgene plasmid # 12456) and M51 Super 8x FOPFlash (Addgene plasmid # 12457) was a gift from Randall Moon.