Introduction
Lung cancer remains the leading cause of cancer-related deaths worldwide with non-small cell lung cancer (NSCLC) attributed to more than 80% of all lung cancer cases [
1,
2]. Moreover, NSCLC is seldom detected at an early stage [
3]. Most patients with NSCLC are diagnosed at advanced stages and have lymph node and distant organ involvement with high rates of therapy resistance [
2,
4]. The diagnosis of NSCLC is further complicated by its heterogeneity into subgroups with different transcription and prognostic profiles. The largest of these subgroups are lung squamous cell carcinoma (LUSC) and adenocarcinoma (LUAD) [
5,
6]. Therefore, therapy that focuses on specific targets and mutations to halt the spread of NSCLC may improve survival rates in subsets of patients.
MEX3C (also known as RKHD2) belongs to the MEX3 (Muscle Excess 3) protein family consisting of four members (MEX3A-D) in human [
7]. The MEX3 family are important RNA-binding ubiquitin ligases that post-transcriptionally regulate various biological processes [
8]. Recent studies demonstrated that MEX-3 proteins are dysregulated in multiple cancers and influence apoptosis, antigen processing and immune evasion of tumor cells, implicating important roles of MEX-3 in tumorigenesis as potential markers and therapeutic targets [
9‐
13]. MEX3C was upregulated in ovarian cancer (OC) tissues, acting as a new oncogene in OC [
14]. Moreover, study have demonstrated that MEX3C promotes bladder carcinogenesis via controlling lipid metabolism through the JNK pathway [
7]. MEX3A, a homolog of MEX3C, has similarly been demonstrated to have an oncogenic function in LUAD. MEX3A promotes metastasis of lung cancer via interacting with LAMA2 and activating the PI3K/AKT pathway [
15]. This raises the question of whether or not MEX3C is likewise carcinogenic in LUAD. In-depth research will be conducted to determine the specific procedure.
The runt-related transcription factors (RUNX) family in mammals consists of three key developmental regulators: RUNX1, RUNX2, and RUNX3, which serve important roles in cell cycle progression, differentiation, apoptosis, immunology, and epithelial–mesenchymal transition (EMT) [
16]. RUNX3 has been linked to the development of cancers such as colorectal cancer, liver cancer, lung cancer, and breast cancer [
17]. Ubiquitylation is a post-translation modification involved in cell-cycle integrity that has been often implicated in the genome instability that accompanies tumorigenesis including lung cancer [
18,
19]. In human gastric cancer, suppressing MEX3B expression inhibits the ubiquitylation and degradation of RUNX3, while the interaction of lncRNA HOTAIR with RUNX3 promotes the MEX3B-dependent ubiquitylation and degradation of RUNX3 [
20]. Furthermore, it has been documented that the transcription factor RUNX3 has binding affinity towards the promoter region of SOD3, hence impeding its transcription [
21]. Although the ubiquitylation and degradation of RUNX3 has been reported in other cancer types, the role of MEX3C as the specific E3 ubiquitin ligase regulating this process in LUAD remains unknown. We hypothesized that MEX3C induces ubiquitylation of RUNX3, leading to its degradation and driving tumorigenesis in LUAD.
Suppressor of variegation 3–9 homolog 1 (Suv39H1), a SET domain-containing histone methyltransferase, has been reported to participate in tumorigenesis in various types of cancer [
22]. Suv39H1 is widely considered as a tumor suppressor due to its activities in inhibiting proliferation-related genes and promoting senescence [
23]. However, mounting evidence suggests that Suv39H1 may possibly function as an oncogene in various malignancies, including colon carcinoma, bladder cancer, and hepatocellular carcinoma [
24]. Our investigation revealed the existence of binding sites between RUNX3 and Suv39H1. Consequently, we formulated the possibility that the transcription factor RUNX3 may functionally link to Suv39H1 by binding to its promoter region. This potential connection could be important in LUAD pathogenesis and merits further investigation.
In this study, we aim to determine the expression pattern and clinical significance of MEX3C and RUNX3 in LUAD. We hypothesize that MEX3C functions as an oncoprotein that promotes LUAD progression by interacting with tumor suppressor RUNX3, triggering its degradation and transcriptional inactivation. RUNX3 may further regulate downstream targets including Suv39H1 that are involved in LUAD cell activities. Our objectives are to investigate the effects of MEX3C on LUAD cell proliferation, apoptosis, migration and invasion in vitro and tumor growth and metastasis in vivo. We will also elucidate the potential molecular mechanisms focusing on MEX3C-RUNX3 interplay and downstream signaling such as Suv39H1. We expect to establish the role of MEX3C in LUAD and provide evidence that targeting MEX3C could be a promising therapeutic strategy.
Material and methods
Clinical samples
From 2018 to 2022, tumor and adjacent tissues were gathered from Huashan Hospital, Fudan University, from 55 LUAD patients, 33 males and 22 females ranging in age from 23 to 76 years. Prior patient consent and approval from the Institutional Research Ethics Committee were obtained (Ethics No.: 2022-490). During the trial, information about patients who did not receive radiotherapy or chemotherapy was documented in their medical records before surgery to ensure that they were followed up properly. Relative gene mRNA expressions in the tumor tissues of LUAD patients were detected by reverse transcription-quantitative polymerase chain reaction (qRT-PCR). Clinical and pathological information was obtained and immunohistochemical studies were performed in paraffin-embedded tissue sections. Table
1 presents a summary of the clinicopathological characteristics of the cases.
Table 1
Association between the mRNA Expression of MEX3C with clinical indicators
Sex |
Male | 33 | 16 (48.49) | 17 (51.52) | 0.7885 | 0.3746 |
Female | 22 | 8 (36.37) | 14 (63.63) |
Age, year |
≤ 60 | 21 | 11 (52.3) | 13 (47.7) | 0.0836 | 0.7725 |
> 60 | 34 | 13 (38.2) | 18 (61.8) |
Smoking history |
Yes | 36 | 16 (44.4) | 20 (55.6) | 0.0277 | 0.8678 |
No | 19 | 8 (42.1) | 11 57.9) |
Histological types |
LUSC | 35 | 15 (42.9) | 20 (57.1) | 0.0236 | 0.8744 |
LUAD | 20 | 9 (45) | 11 (55) |
Tumor size, cm |
≤3 | 23 | 13 (56.6) | 10 (43.4) | 2.6686 | 0.1023 |
> 3 | 32 | 11 (34.4) | 21 (65.6) |
TNM stage |
I–II | 30 | 9 (30.0) | 21 (70.0) | 4.9899 | 0.0255* |
III–IV | 25 | 15 (60.0) | 10 (40.0) |
LNM |
Yes | 23 | 12 (52.2) | 11 (47.8) | 1.1715 | 0.2791 |
No | 32 | 12 (37.5) | 20 (62.5) |
Distant metastasis |
Yes | 33 | 18 (54.5) | 15 (45.5) | 3.9919 | 0.0457* |
No | 22 | 6 (27.3) | 16 (72.7) |
TCGA, GTEx database analysis
RNA-sequencing expression (level 3) profiles and corresponding clinical information for tumors were downloaded from the The Cancer Genome Atlas (TCGA) and Genotype-Tissue Expression (GTEx) dataset [
25]. All the analysis methods and R package were implemented by R version 4.0.3. Two-group data performed by wilcox test. P values less than 0.05 were considered statistically significant.
Cell cultures
Human bronchial epithelial (HBE) cell line BEAS-2B and human LUAD cell lines A549, PC-9, H1975, and NCI-H1299 were obtained from the Cell Bank of the Chinese Academy of Sciences (Beijing, China). HBE cells were grown in DMEM culture media (Invitrogen, Gaithersburg, CA, USA). A549, H1650, H838 and H1299 cell lines were grown in RPMI-1640 medium (Invitrogen) supplemented with 10% fetal bovine serum (FBS, Invitrogen) and 1% penicillin/streptomycin (P/S, Sigma-Aldrich, Steinheim, Germany) solution, in an incubator with 5% CO2 at 37 ℃. HEK293 cells were purchased from the Chinese Academy of Science Cell Bank (Shanghai, China). HEK293 cells were grown in DMEM (Invitrogen) with 10% FBS, 100 U/ml penicillin, and 100 μg/ml streptomycin at 37 °C in a humidified atmosphere of 5% CO2.
Cell transfection
siRNAs specific for MEX3C, E-cadherin, and RUNX3 as well as the corresponding scrambled siRNA were purchased from GenePharma (Shanghai, China). MEX3C and RUNX3 overexpression plasmid (OE-MEX3C and OE-RUNX3) and the NC plasmid (an empty vector) were generated using the pcDNA3.1 vector purchased from GenePharma company (Shanghai, China). The A549 and H1299 cells were seeded on coverslips in 6-well dishes at a density of 3 × 106 cells per well, and they were allowed to attach in a culture medium for a period of 24 h. Overexpressing plasmid (2 μg) or siRNA (1.5 μg) of indicated genes were transfected into cells using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions, which were described for over-expression and knockdown of indicated genes. The selected sequences for knockdown as follow: si-MEX3C-1: 5′-GGCUAAAGUUGUUAGUAAACU-3′, si-MEX3C-2: 5′-AGUUGUUAGUAAACUUAUAAA-3′; si-MEX3C-3: 5′-GGUCAGUAUUGAAACCUAAUC-3′; si-RUNX3-1: 5′- GAUUUGUUACAAUAAUAUAAC-3′, si-RUNX3-2: 5′-GCUCUGUGAUUAUAAGCAACA-3′, si-RUNX3-3: 5′-GACUGAUUUGUUACAAUAAUA-3′; si-E-cadherin-1: 5′- GAGUAAGUGUGUUCAUUAAUG-3′, si-E-cadherin-2: 5′- GUGUGUUCAUUAAUGUUUAUU-3′, si-E-cadherin-3: 5′- GGAGUUCUCUGAUGCAGAAAU-3′. The expression efficiency was detected by qRT-PCR and western blotting analysis after transfection.
Cell counting kit-8 (CCK-8) assay
LUAD cell viability was determined by CCK-8 assays. After transfection, cells (4 × 103 cells/well) that had been transfected were seeded in DMEM (Capricorn Scientific, USA) supplemented with 10% fetal bovine serum (FBS, Capricorn Scientific, USA) for 24, 48, 72, 96, or 120 h. The cell suspension was then allowed to remain in an environment containing 20 μL of CCK-8 for a period of 4 h. After then, 150 μL of DMSO was added to the medium. After 10 min, cell viability was assessed using a microplate reader (Olympus Corporation, Tokyo, Japan) to determine the optical density at 490 nm.
Flow cytometry
The annexin V-fluorescein isothiocyanate (FITC)/propidium iodide (PI) apoptosis detection kit (Beijing Biosea Biotechnology, China) was used in conjunction with flow cytometry analysis to determine the percentage of cells that had undergone the process of apoptosis. Fixed cells were then washed twice in PBS and stained in PI/FITC-annexin V in the presence of 50 μg/ml RNase A (Sigma-Aldrich). The apoptotic cell rate was measured using a FACS can after an incubation period of 2 h at room temperature in the absence of light (Beckman Coulter, USA). FlowJo was utilized in order to perform the statistical analysis on the data (TreeStar, USA).
Terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) assay
TUNEL assay (Roche, Indianapolis, IN, USA) was used to measure apoptosis following the manufacturer’s instructions. Briefly, 3 × 105 cells were seeded onto a cover slip in a 6-well plate and attached overnight. Then, cells were treated as indicated followed by 4% formaldehyde-PBS fixation for 15 min at room temperature, after which they were permeabilized with 0.2% Triton X-100 in PBS for another 10 min under the same conditions. After being washed twice with PBS, the cells were incubated with a fluorometric terminal deoxytransferase mixture at 37 °C for 1 h. After three washes with PBS, cover slips were mounted with Vectashield Antifade Mounting Medium (Vector Laboratories) containing DAPI, to counterstain cellular nuclei. Fluorescence images were captured in at least five views using a Nikon Eclipse Ti-E fluorescence microscope (Nikon Corporation, Tokyo, Japan).
EdU (5-ethynyl-2′-deoxyuridine) incorporation assay
Cell proliferation was measured by EdU assay using the Cell-LightTM EdU Apollo®567 In Vitro Kit (RiboBio, Guangzhou, China) according to the manufacturer’s protocol. Briefly, 1 × 105 cells were incubated with 10 μM EdU for 2 h before fixation with 4% paraformaldehyde, permeabilization with 0.5% Triton X-100 and EdU staining. Cell nuclei were stained with DAPI at a concentration for 10 min. The number of EdU-positive cells was counted under a fluorescence microscope in five random fields (Olympus IX53; Olympus, Tokyo, Japan). ImageJ software was used to quantify fluorescence levels.
Transwell assay
After the cells were transfected, 5 × 104 of A549 and H1299 cells in serum-free medium were plated on uncoated upper chambers (Merck Millipore) for migration tests and Matrigel-coated upper chambers (BD Bioscience, USA) for invasion assays, respectively. These steps were repeated for invasion assays. After an additional twenty-four hours had passed, the lower wells received the culture medium that was 10% FBS containing. After that, a cotton swab was used to remove the cells that had not invaded or migrated from their original location. After that, the filters were first steeped in ethanol (90%) for 10 min, and then crystal violet was used to dye them for the following 15 min. The utilization of a microscope with its objective turned upside down made it possible to count five random fields in each chamber (Leica, Germany). Each experiment was repeated three times.
For the colony formation assay, cells were seeded at a density of 1 × 103 cells/well. Cells were treated with 150 μM CoCl2, and seeded in each well of a 6-well cell culture plate. After 2 weeks, they were fixed in 4% paraformaldehyde and stained with 1% crystal violet. The colony numbers were counted to assess cell proliferation. The assays were performed in three independent experiments.
Hematoxylin and eosin (H&E) staining
Tumor or lung tissues were fixed in 4% paraformaldehyde overnight and then embedded in 4% paraffin overnight at 4 °C. 4 μm thick tissues sections were stained by using H&E for histological analysis under a light microscope.
Immunohistochemical staining
For immunohistochemistry analysis, tumor tissue sections (5 µm) were dewaxed with a gradient alcohol series and incubated with goat serum for 30 min at 37 °C. The sections were stained for primary antibody overnight at 4 °C. The primaery antibodies used were as follows: MEX3C (Abcam, Ab243457, 1:150), RUNX3 (Cell signaling, #9647, 1:100), E-cadherin (Abcam, ab231303, 1:50), N-cadherin (Abcam, ab207608, 1:50), anti-Ki-67 (Abcam, ab15580, 1:100), and anti-PCNA (Abcam, ab29, 1:50). Thereafter, sections were incubated with secondary anti-IgG antibody and incubated at 37 °C for 30 min. Finally, sections were stained by a DAB (3,3′-diaminobenzidine) substrate kit (Dako, Carpinteria, CA, USA), counterstained with hematoxylin, and observed microscopically under a microscope.
Wound healing assays
To assess the migration of cells, LUAD cells were seeded onto six-well plates (3 × 106 cells/well) and incubated at 37 °C in 5% CO2 for 48 h in RPMI-1640 medium containing 2% FBS. The surface of the cells was scratched with a 200 μL tip and then washed twice with PBS to remove detached cells. The cells were then cultured for indicated hours in RMPI-1640 supplemented with 2% FBS, to minimize cell proliferation during the period of assay. The image of each scratch at the same location was captured after the indicated incubation time using an optical microscope (IX53, Olympus, Tokyo, Japan) and assessed using ImageJ software.
Treatment with proteasome inhibitor
1 × 106 LUAD cells were transfected by Lipofectamine 2000. After overnight culture, the culture medium was replaced with fresh medium containing proteasome inhibitor MG132 (10 μm, MedChemExpress, Shanghai, China). The cells were further cultured at 37 °C with the proteasome inhibitor for 24 h. The cells were then harvested for western blot analysis.
qRT‐PCR analysis
Total RNA was extracted from cells with TRIzol reagent (TransGen Biotech, Beijing, China). RNA was reverse transcribed using a TransScript All-in-One First-Strand cDNA Synthesis Kit (TransGen Biotech). The resulting cDNA was amplified using a reaction mix containing 10 μL of SYBR Green qPCR Master Mix (TransGen Biotech). The PCR conditions were a denaturation step at 94 °C for 5 min, followed by 40 cycles of 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 30 s. The primer sequences can be found in Table
2. The GAPDH gene was used as an internal control and the relative level of expression was determined using the 2
−ΔΔct method.
Table 2
Primers used in the RT-qPCR
MEX3C | GAAAGAGCGTCAACACCACC | AAATGGGCTCTTCACCACGA |
RUNX3 | AGCACCACAAGCCACTTCAG | GGGAAGGAGCGGTCAAACTG |
Suv39H1 | CCTGCAGGTGTACAACGTCT | ATCAAAGGTGAGCTCCTCGC |
CEA | TTACCTTTCGGGAGCGAACC | GTGTGTGTTGCTGCGGTATC |
SCCAg | GATGCAGACCTCTCAGGCAT | AATCCTACTACAGCGGTGGC |
Ki-67 | GGAAGCTGGACGCAGAAGAT | CAGCACCATTTGCCAGTTCC |
PCNA | CCTGAAGCCGAAACCAGCTA | TGAGTGCCTCCAACACCTTC |
GAPDH | CCAGCAAGAGCACAAGAGGA | ACATGGCAACTGTGAGGAGG |
Ubiquitination assay
For in vivo ubiquitination assay, HEK-293 cells were co-transfected with Flag-RUNX3 (1 μg), HA-ubiquitin (2 μg), and Myc-MEX3C (1 μg) expression plasmid using Lipofectamine 3000 (Invitrogen). Immunoprecipitates with anti-Flag agarose were analyzed via immunoblotting with anti-Flag and Myc antibodies. 48 h after transfection, cells were harvested and split into two aliquots, one for immunoblotting and the other for ubiquitination assay. For ubiquitination analysis, A549 and H1299 cells were transfected with His-Ub and MEX3C overexpression plasmid, immunoprecipitation and immunoblot analysis were performed using anti-RUNX3 and anti-ubiquitin antibody (1:1,000; Sigma-Aldrich, China), respectively.
Luciferase reporter assay
A549 and H1299 cells were co-transfected with RUNX3-OE plasmid or empty vector control and Suv39H1-WT or -MUT. Lipofectamine 2000 (Invitrogen) was used for transfection. After 48 h of transfection at 37 °C with the luciferase reporter vector (Promega), a Dual Luciferase Reporter Assay kit (Promega) was used to evaluate the relative luciferase activities. The Renilla luciferase reporter was used as internal control. The activities of firefly luciferase and Renilla luciferase were quantified by using the dual luciferase reporter assay system (Promega).
Co-immunoprecipitation (IP) assay
For Co-IP assay, A549 and H1299 cells with or without transfection were collected through an ice‐cold PBS wash and plated on 10 cm dishes and lysed in a lysis buffer containing 1% Triton X-100, 150 mM NaCl2, 1.5 mM MgCl2, 50 mM HEPES pH 7.6, 1 mM EDTA, 10% glycerol, 10 mM NaF, 1 mM NaVO3, 10 mM β-glycerolphosphate, 50 ml DDM, and 5 protease inhibitor tablets and further centrifuged at 12,000 ×g at 4 °C for 10 min. Cell lysates were incubated with protein A and/or protein G agarose beads (Santa Cruz Biotechnology) conjugated with specific antibodies for target protein and incubated overnight at 4 °C. Proteins beads were washed three times and boiled with 2 × SDS sample buffer for 10 min at 95 °C, then analyzed by western blotting to detect levels of MEX3C and RUNX3.
Chromatin immunoprecipitation IP (ChIP) assay
ChIP assays were done on A549 and H1299 cells using a SimpleChIP® Enzymatic Chromatin IP Kit in accordance with the protocol provided by the manufacturer. Following the collection of crosslinked chromatin DNA and its subsequent sonication into fragments ranging from 200 to 1000 bp, the sample was immunoprecipitated with either an RUNX3 antibody (#18,113, Cell Signaling Technology) or a control IgG antibody (#3900, Cell Signaling Technology). After the addition of magnetic beads, the pieces of precipitated chromatin were cleaned, separated, and quantified by using qRT-PCR.
RNA pull-down assays
LUAD cells (1 × 106) seeded in 6-well plate were transfected with biotinylated RUNX3 and NC (biotin-NC) using Lipofectamine 3000 (Invitrogen). The transfected cells were collected after 48 h following a 10-min lysis buffer treatment at room temperature (25 °C). The cell lysates were then incubated with M-280 Streptavidin magnetic beads (Invitrogen) for 3 h at 4 °C to pull down the biotinylated RNAs and associated proteins. Afterwards, the beads were washed with ice-cold lysis buffer to remove unbound components. The level of Suv39H1 protein enriched by RUNX3 pull-down was measured by qRT-PCR.
Immunofluorescence assay
The A549 and H1299 cells in a 6-well plate at a density of 3 × 105 cells/well and rested overnight. The slides were then permeabilized by 1% Triton X-100 in PBS for 10 min and blocked in 10% normal goat serum, followed by the incubation with the Cleaved-caspase-3 (Cell signaling, #9661, 1: 400) primary antibody overnight. They were then rinsed 3 times with PBS, and then the secondary antibody was incubated on the coverslips at room temperature for 1 h. The sections were stained by DAPI and observed under a fluorescence microscope.
SCID mice (6–7 weeks old, male) were purchased from Shanghai Experimental Animal Center of Chinese Academic of Sciences (Shanghai, China), housed in specific pathogen-free conditions with 12 h day/12 h night. The use of animals was approved by the Institutional Animal Care and Use Committee at Huashan Hospital of Fudan University, and all studies were conducted in compliance with the Committee's Guidelines for Animal Care. MEX3C knockdown or scramble control (si-NC) transfected A549 and H1299 cells were injected subcutaneously (3 × 106 cells/100 μL PBS per mouse) into the left flanks of mice. Tumor size was recorded every week using a caliper. Tumor volumes were calculated based on the following formula: Volume (mm3) = (L × W2)/2, with L being the largest diameter (mm) and W being the smallest diameter (mm). After 6 weeks, the mice were humanely sacrificed. Images were obtained using an Animal Vivo Imaging Machine (Perkin Elmer, Waltham, MA, USA). The tumors were collected for weighing, H&E staining, western blotting and IHC analysis.
In order to create a model of experimental metastasis, mice were split into four groups (n = 5 per group), and then a mixture of resuspended A549 and H1299 cells (2 × 106 cells per 100 μL PBS) transfected with either si-NC or si-MEX3C and tagged with luciferase was injected into the tail vein. Bioluminescent imaging using the IVIS image system was used to check for lung metastatic progression weekly. After 8 weeks mice were killed and the lungs were removed and embedded in paraffin for stained with H&E or TUNEL staining. Under a microscope, the number of lung nodules caused by metastasis was tallied.
TUNEL assay in tumor tissue
The tissue that had been removed from the tumor was deposited in a solution containing 4% paraformaldehyde for the purposes of fixing, routine sectioning, and finally deparaffinizing to water. In order to retrieve the antigen, a working solution of proteinase K was added to the samples, and then they were left to fix at room temperature for 15–30 min. After that, 50 µL of 3% H2O2 was added, and the mixture was left to incubate at room temperature for 10 min. After that, 50 µL of TUNEL reaction solution was added, and the mixture was left to incubate at 37 °C in the dark for 60 min. Finally, the sample was rinsed three times with PBS for 5 min each time. After that, 50 µL of peroxidase buffer solution was added, and the mixture was allowed to react at 37 °C for 30 min. After that, the sample was rinsed three times with PBS, developed with DAB, and stained in accordance with the instructions that came with the TUNEL kit (Invitrogen).
Western blot analysis
Cells and tissue were first lysed with RIPA buffer (Beyotime Biotechnology, Shanghai, China) at room temperature for 1 h. The bicinchoninic acid method was used to measure the level of proteins. Proteins in the lysate were separated by electrophoresis and then transferred to a polyvinylidene difluoride membrane. The membrane was blocked with 5% skimmed milk powder (Sigma-Aldrich) and then incubated with primary antibodies overnight at 4 °C. The following antibodies were used: anti-MEX3C (Cell signaling, #50,844, 1:1,000), anti-RUNX3 (Cell signaling, #9647, 1:1,500), anti-Suv39H1 (Novus, NBP1-21,367, 1:1,000), anti-E-cadherin (Abcam, ab231303, 1:1,500), anti-N-cadherin (Abcam, ab76011, 1:1,000), anti-Bcl-2 (Abcam, ab182858, 1:1,000), anti-Bax (Abcam, ab32503, 1:1,000), anti-Cleaved-caspase-3 (Cell signaling, #9661, 1:1,000), and anti-GAPDH (Abcam, ab8254, 1:2,000). The membranes were then washed in TBST and incubated with horseradish peroxidase-labeled secondary antibody. After washing in TBST again, protein bands were visualized using an ECL detection agent (GE Healthcare, Chicago, IL, USA) and ImageJ software. GAPDH were used as internal loading controls.
Statistical analysis
Three individual replicates were performed for each experiment, and the data were presented by mean ± SD. The statistical analysis was conducted by SPSS 22.0 (SPSS Inc., IL, USA) and Prism 9.0 (GraphPad Software, La Jolla, CA, USA). Paired data were analyzed using the paired Student's t-test. One-way ANOVA followed by Dunnett’s multiple comparison test was used to evaluate significant differences between multiple groups. Chi-square test was performed to evaluate the relationship between MEX3C expression and clinicopathological features. The prognostic value was calculated by the Kaplan–Meier analysis with log-rank test. P < 0.05 was considered statistically significant.
Discussion
As one of the most prevalent malignancies, lung cancer is a deadly disease with a 5-year survival rate of approximately 21% [
2]. NSCLC accounts for the majority of lung cancer but it has a low survival rate because it is diagnosed predominantly at a later stage when metastasis can occur [
32,
33]. LUAD, accounting for approximately 40% of lung malignancies, is the most known subtype of lung cancer. Moreover, the treatment of LUAD is complicated by the heterogeneity of tumors and a diverse number of genetic profiles [
34,
35]. Therefore, therapeutic approaches involving posttranslational modifications such as ubiquitylation may result in targets with greater specificity in NSCLC [
36].
MEX3 family are implicated in numerous biological processes that contribute to the occurrence and progression of cancer [
13]. Numerous investigations demonstrate the oncogenic roles of MEX3 family proteins in various cancers [
11,
12,
37,
38]. MEX3C, which is occasionally referred to RKHD2, is a member of the Mex-3 protein family. MEX3A-D, are the four different protein members that make up the Mex-3 protein family [
8]. According to the findings of research, MEX3A has the potential to act as both a predictive biomarker and a target for metastatic therapy in LUAD [
15]. Despite the fact that it is widely expressed in a variety of tissues, however, very little is known about the role that another essential member plays in cancer: MEX3C. Other study has suggested that MEX3C is involved in a number of different biological processes, including immunological responses [
39], the transfer of RNA molecules [
40], the suppression of translation [
41], and energy balance [
42]. On the other hand, there is not a lot of information available about MEX3C and its connection to human LUAD at this time. In this study, we investigated the consequences of MEX3C ubiquitylation on RUNX3 LUAD. We found that MEX3C is upregulated in LUAD tissue and cells, especially in A549 and H1299 cell lines. We also found that knockdown of MEX3C could inhibit LUAD proliferation, migration and invasion and promote apoptosis in vitro and in vivo. Therefore, MEX3C is a new oncogene in LUAD, and may be a new drug candidate for use in LUAD therapeutics.
The RUNX3 gene is situated on the chromosomal region 1p.13-p36.11, which is recognized as a deletion hotspot in several types of malignancies originating from epithelial, hematological, and neural tissues [
43]. RUNX3 inactivation, as found in this study, has been associated with the progression of several cancers including NSCLC [
44‐
48]. RUNX3 suppression is thought to lead to the activation of the S phase in the cell cycle. Therefore, the combined loss of RUNX3 and p53 would result in greater tumor progression and would explain the elevated levels of tumor characteristics that we discovered in H1299 cells [
47]. In several cancers, such as breast, colorectal and gastric cancers, the mis-localization of RUNX3 to the cytoplasm is thought to result in tumor progression; however, in other cancers including NSCLC, it was found that the loss of RUNX3 expression through posttranslational modification leads to tumor progression [
44]. RUNX3 is known to be a downstream effector of the transforming growth factor-β (TGF-β) signaling pathway, which is involved in apoptosis, angiogenesis, EMT, cell migration, and invasion [
43].
In this study, we found that the inactivation of RUNX3 occurs through ubiquitylation by MEX3C. This in turn causes a higher expression of Suv39H1, one of the RUNX3 target genes. The ubiquitination of proteins is a multistep process that is regulated by proteins that belong to enzyme families E1, E2, and E3 [
49]. Erroneous ubiquitylation often leads to the progression of proliferation and metastasis in NSCLC [
36]. Ubiquitylation by upregulated MEX3C is involved in the progression of hepatocellular carcinoma [
50]. According to the findings of our studies, MEX3C promotes tumorigenesis in LUAD by the ubiquitylation and subsequent degradation of RUNX3. Notably, a similar mechanism of tumorigenesis regulation via ubiquitylation has been reported for MEX3A in glioblastoma [
51]. This recent study demonstrated that MEX3A induces the ubiquitylation and proteasomal degradation of the tumor suppressor RIG-I in glioblastoma, resulting in increased cell growth. Given the parallels with our findings, therapeutically targeting ubiquitylation enzymes like MEX3C and MEX3A may hold promise as an innovative strategy to suppress tumorigenesis in cancers where they play an oncogenic role.
Our research indicates that RUNX3 is a MEX3C target and that the loss of RUNX3 expression leads to a higher expression of Suv39H1. Suv39H1 is a protein lysine methyltransferase that is implicated in several cancers, including NSCLC [
30], and is also involved in EMT [
52]. The inhibition of Suv39H1 can prevent EMT in breast cancer through the depletion of H3K9me3 in the promoter region of E-cadherin [
53]. A similar mechanism could occur in our study when Suv39H1 is suppressed by RUNX3.
Our study also has some limitations. To minimize the use of animals, a low sample size was used to determine the level of significance obtained with in vivo studies. However, these experiments were conducted primarily to establish whether the proliferation of tumors and metastasis could occur in vivo.