Background
Bladder cancer is the ninth most common malignancy worldwide [
1]. About 151297 newly diagnosed bladder cancer cases and 52395 bladder cancer deaths were appeared in Europe in 2014 [
2]. Although in the past years there are some progresses in clinical treatment for bladder cancer, the overall survival (OS) time of bladder cancer patients has not been improved dramatically, and the 5-year survival rate for patients with bladder cancer remains at only 50–60 % [
3‐
5]. Because the prognosis of bladder cancer is closely related to the stage of disease at diagnosis, novel diagnostic markers for early stage are urgently needed [
6‐
9].
The long non-coding RNAs (lncRNAs) are important new members of the ncRNA family, which are longer than 200 nucleotides [
10]. The rapid development of cancer genomics has highlighted the role of lncRNAs in human cancers [
11‐
13]. Recently more and more evidences showed that lncRNAs play crucial regulatory roles in diverse biological processes, such as transcriptional regulation, cell growth and tumorigenesis [
14,
15]. However, the clinical significance and molecular mechanism of lncRNAs in bladder cancer remain largely elusive. PANDAR (promoter of CDKN1A antisense DNA damage activated RNA) is a novel lncRNA that was localized at 6p21.2.
Hung et al. reported that lncRNA PANDAR was induced in a p53-dependent manner and interacts with the transcription factor NF-YA to limit the expression of pro-apoptotic genes [
16]. Recently, lncRNA PANDAR originally was identified as biomarkers and was involved in development of multiple cancers [
17,
18]. However, the biological function and underlying mechanism of action of lncRNA PANDAR in bladder cancer is completely unknown.
In this study, we found that lncRNA PANDAR was significantly up-regulated in bladder cancer tissue compared with paired-adjacent nontumorous tissues in a cohort of 55 bladder cancer patients. Furthermore, increased PANDAR expression was positively correlated with higher histological grade (P < 0.05) and advanced TNM stage (P < 0.05). We demonstrated that silencing PANDAR significantly inhibited proliferation/migration and induced apoptosis of the bladder cancer cells. Moreover, over expression of PANDAR in bladder cancer cells promoted the proliferation/migration and suppressed apoptosis. Our data suggest that PANDAR was a powerful tumor biomarker, which highlighted its potential clinical utility as a promising prognostic biomarker and therapeutic target.
Discussion
Bladder cancer is one of the most common malignancies in human populations [
19]. Because at the early stage of bladder cancer there are no specific symptoms for these patents, most bladder cancers are found at advanced-stage, when treatments are less effective [
20,
21]. The prognosis of bladder cancer remains quite poor, therefore, finding new prognostic biomarker and therapeutic target has enormous potential to improve the clinical strategies and outcomes of bladder cancer [
22,
23].
The lncRNAs are important new members of the RNA family, which are longer than 200 nucleotides and not translated into a protein [
24,
25]. Recently, numerous pieces of evidences indicate that lncRNAs play a crucial role in cancer occurrence and progression [
26,
27]. As a new indentified lncRNA localized at the chromosome 6, PANDAR is 1506 nucleotides in length [
28]. LncRNA PANDAR was previously reported to be up-regulated in gastric cancer. PANDAR interacts with polycomb repressive complexes (PRC1 and PRC2) and the transcription factor NF-YA to repress the transcription of senescence-promoting genes in cancer cells. However, we know nothing about the relationship between lncRNA PANDAR and bladder cancer.
To our knowledge, this is the first report of lncRNA PANDAR being involved in the development of bladder cancer. In the present study, we found that lncRNA PANDAR was significantly up-regulated in bladder cancer tissues than that in corresponding non-tumor bladder tissues. These results suggest that lncRNA PANDAR may emerge as a novel player in the state of bladder cancer. In order to understand the biological functions of lncRNA PANDAR, we detected the cell proliferation, apoptosis and migration by silencing and overexpressing lncRNA PANDAR in the related bladder cancer cell lines. Inhibited cell proliferation/migration and induced cell apoptosis by silencing PANDAR were observed in bladder cancer cells. Furthermore, overexpressing lncRNA PANDAR promoted proliferation/migration and suppressed apoptosis of the bladder cancer cells. These findings demonstrate that lncRNA PANDAR may play key roles in the progression and development in bladder cancer.
Methods
Patients and clinical samples collection
A total of 55 patients with urothelial carcinoma of the bladder who received partial or radical cystectomy were included in this study. Bladder cancer tissue and matched normal bladder tissue from each patient were snap-frozen in liquid nitrogen immediately after resection. Written informed consent was also obtained from all the patients. The study was approved by the Institutional Review Board of Shenzhen Second People’s Hospital, Shenzhen, China and Peking University First Hospital, Beijing, China.
Cell lines and cell culture
Bladder cancer 5637, SW780, UMUC3, T24 and SV-HUC-1 cells used in this study were purchased from the Institute of Cell Research, Chinese Academy of Sciences, Shanghai, China. The 5637 cells and SW780 cells were cultured in RPMI-1640 Medium (Invitrogen, Carlsbad, CA, USA) plus 10 % fetal bovine serum. The UMUC3, T24 and SV-HUC-1 cells were cultured in Dulbecco’s Modified Eagle Medium (Invitrogen, Carlsbad, CA, USA) plus 10 % fetal bovine serum. Plates were then placed at 37 °C with an humidified atmosphere of 5 % CO2 in incubator.
siRNA and pcDNA transfection
The specific small interfering RNA that targeted PANDAR (si-PANDAR) and a scrambled negative control (si-NC) were purchased from GenePharma, Shanghai, China. The expression vector (pcDNA) that express PANDAR (pcDNA-PANDAR) and a scrambled negative control (pcDNA-NC) were also purchased from GenePharma, Shanghai, China. The target sequence of si-PANDAR was 5′- GCAATCTACAACCTGTCTT -3′. The cells were cultured 24 h prior to transfection. Then, the cells were transiently transfected with corresponding si-RNA or pcDNA using Lipofectamine 2000 Transfection Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. After 48 h, cells transfected with siRNA or pcDNA were harvested for qRT-PCR.
RNA extraction and quantitative real-time PCR
The total RNA of the tissue samples or the transfected cells were extracted using the Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the instructions. The concentration and purity of the total RNA were analyzed with UV spectrophotometer analysis at 260 nm and the electrophoresis detection showed good quality of purified RNA. cDNA was converted from total RNA by using SuperScript III® (Invitrogen) according to the manufacturer’s protocol. The primer sequences were as follows: PANDAR primers [
8] forward: 5′- CTGTTAAGGTGGTGGCATTG -3′, reverse: 5′- GGAGGCTCATACTGGCTGAT -3′; GAPDH primers forward: 5′- CGCTCTCTGCTCCTCCTGTTC -3′, reverse: 5′- ATCCGTTGACTCCGACCTTCAC -3′. Quantitative real-time PCR was performed by using the ABI PRISM 7000 Fluorescent Quantitative PCR System (Applied Biosystems, Foster City, CA, USA) according to the instructions. The average value in each triplicate was used to calculate the relative amount of PANDAR using 2^−ΔΔCt methods. Experiments were repeated at least three times.
Cell counting Kit-8 assay
Cell proliferation was determined using Cell Counting Kit-8 (Beyotime Inst Biotech, China) according to instructions. Briefly, 5 × 103 cells/well were seeded in a 96-well flat-bottomed plate for 24 h, then transfected with corresponding si-RNA or pc-DNA and cultured in normal medium. At 0, 24, 48 and 72 h after transfection, 10 μl of CCK-8 (5 mg/ml) was added to each well and the cells were cultured for 1 h then determined the absorbance at a wavelength of 450 nm using an microplate reader (Bio-Rad, Hercules, CA, USA). Experiments were repeated at least three times.
Ethynyl-2-deoxyuridine (EdU) incorporation assay
Cell proliferation was also determined by Ethynyl-2-deoxyuridine incorporation assay using an EdU Apollo DNA in vitro kit (RIBOBIO,Guangzhou, China) following the manufacturer’s instructions. Briefly, cells were incubated with 100 μl of 50 μM EdU per well for 2 h at 37 °C, at 48 h after transfected with corresponding si-RNA or pc-DNA, respectively. Then, the cells were fixed for 30 min at room temperature using 100 μl of fixing buffer (4 % polyformaldehyde containing PBS). Subsequently, the cells were incubated with 50 μl of 2 mg/ml glycine for 5 min followed by washing with 100 μl of PBS. After permeabilization with 0.5 % TritonX, the cells were reacted with 1X Apollo solution for 30 min at room temperature in the dark. After that, cells were incubated with 100 μl of 1X Hoechst 33342 solution for 30 min at room temperature in the dark followed by washing with 100 μl of PBS. The cells were then visualized under a fluorescence microscopy. Experiments were repeated at least three times.
Cleaved Caspase-3 ELISA assay
Cell apoptosis was determined by ELISA assay. Briefly, 5 × 105 cells/well were seeded in a 6-well plate for 24 h, then transfected with corresponding si-RNA or pc-DNA, respectively. At 48 h after transfection, Cell cleaved caspase-3 activity was measured using the Caspase-3 Colorimetric Assay kit (Abcam, Cambridge, UK) according to the manufacturer’s protocol. Experiments were repeated at least three times in duplicates.
Hoechst 33342 staining assay
Cell apoptosis was also determined by Hoechst 33258 staining assay. At 48 h after transfection with corresponding si-RNA or pc-DNA, apoptotic cells were also observed by using the Hoechst 33258 staining kit (Life, Eugene, OR, USA) according to the manufacturer’s instructions. Experiments were repeated at least three times.
Flow cytometry analysis of cell apoptosis
Cells were cultured in normal medium and transfected with corresponding si-RNA or pc-DNA. Cells were collected after transfection for 48 h, and the translocation of phosphatidylserine in treated cells was detected using the Annexin-V-FLUOS staining kit (Roche Applied Science, Mannheim, Germany). Briefly, after being labeled with 5 μl of annexin V-FITC and 2 μl propidium iodide (PI), cells were suspended in 500 μl of binding buffer and incubated at room temperature in the dark for 15 min. Cell apoptosis was then determined by using flow cytometry (EPICS, XL-4, Beckman, CA, USA). Experiments were repeated at least three times.
Transwell assay
The cell motility assay were also performed using a transwell insert (8 μm, Corning). Cells were cultured in normal medium and transfected with corresponding si-RNA or pc-DNA. 24 h after transfection, 5x104 cells were first starved in 200 ml serumfree medium and then placed in the uncoated dishes. The lower chamber was filled with 500 ml of complete medium. The cells were incubated for 48 h at 37 °C, and then the cells that had migrated to the bottom surface of the filter membrane were stained with 0.5 % crystal violet solution and photographed in five preset fields per insert. Then the absorbance were determined at a wavelength of 570 nm using an microplate reader (Bio-Rad, Hercules, CA, USA). The results represented the average of three independent experiments.
Statistical analyses
All experimental data from three independent experiments were analyzed by χ2 test or Student’s t-test and results were expressed as mean ± standard deviation. P-values of less than 0.05 were considered to be statistically significant. All statistical tests were conducted by SPSS version 19.0 software (SPSS Inc. Chicago, IL, USA).
Acknowledgments
The authors are indebted to all the donors whose names were not included in the author list, but who participated in our study. This work was supported by the National Key Basic Research Program of China (973 Program) (2014CB745201), the Chinese High-Tech (863) Program (2014AA020607),The National Science Foundation Projects of Guangdong Province (2014A030313717), National Natural Science Foundation of China [81402103], International S&T Cooperation program of China (ISTCP) (2014DFA31050), the Shenzhen Municipal Government of China (ZDSYS201504301722174, JCYJ20150330102720130, GJHZ20150316154912494), and Special Support Funds of Shenzhen for Introduced High-Level Medical Team.