Up-regulation of Orai1 expression and store operated Ca²⁺ entry following activation of membrane androgen receptors in MCF-7 breast tumor cells

MCF-7 mammary adenocarcinoma cells, provided from ATCC were cultured in DMEM high glucose medium (Gibco) containing 10 % FBS and 1 % penicillin/streptomycin in a humidified atmosphere of 5 % CO₂. Based on previous titration experiments [2, 7, 10] for mAR stimulation, we have used throughout this study the non-permeable androgen derivative testosterone-BSA (TAC, Sigma-Aldrich) in a concentration of 100 nM. In some experiments, the anti-androgen drug flutamide (1μM, Sigma), the Rac1 inhibitor NSC23766 (50 μM) or the actin cytoskeleton-disrupting agent cytochalasin B (1μM, Sigma-Aldrich) were used as indicated.

For actin, Orai1 and Na⁺K⁺ATPase staining, 7 × 10⁴ MCF-7 cells were cultured for 24 h on glass cover slips and treated or not with TAC-BSA (100 nM, Sigma), cytochalasin B (1μM, AppliChem) and Rac1 inhibitor NSC23766 (50 μM) for different time periods as indicated in the figure legends. After washing twice with PBS, cells were fixed with 4 % PFA for 15 min and then blocked with 3 % BSA in PBS for 1 h at room temperature. Then, the cells were exposed to anti-Orai1 primary antibody (1:200, Abcam #ab 59330) or/and anti- Na⁺K⁺ATPase (Sigma, USA) at 4 °C overnight. The cells were rinsed three times with PBS and incubated with secondary antibody for Orai1 CF™ 488A-labeled anti–rabbit (1:250, Sigma, USA) and for Na⁺K⁺ATPase CF™ 555-labeled anti-mouse antibody (1:250, Sigma, USA) for 1 h at room temperature. Additional cells were incubated with rhodamine-phalloidin (1:200, Life Technologies, USA) for F-actin and with DRAQ-5 dye (1:3000, Biostatus, Leicestershire, UK) for nuclei staining for 30 min in the dark. All slides were mounted with ProLong Gold antifade reagent (Life Technologies, USA). Images were subsequently taken on a Zeiss LSM 5 EXCITER confocal laser scanning microscope (Carl Zeiss, Germany) with a water immersion Plan-Neofluar 63/1.3 NA DIC [60, 61]. The mean fluorescence from six related cells of each picture was quantified by ZEN software (Carl Zeiss, Germany).

To determine Orai1 gene expression, MCF7 cells were washed twice with PBS, and lysed with 1ml TriFast Reagent (Peqlab, Erlangen, Germany). The RNA was isolated according to the manufacturer’s protocol. 2.5 μg of the RNA were transcribed to cDNA using the GoScript™ Reverse Transcription System (Promega Corporation, Madison, USA) and oligo-dT primers. Quantitative real-time PCR was performed on the CFX96 cycler (Bio-Rad) in a total volume of 20 μl using 2 μl of cDNA, and 2x GoTaq® qPCR Master Mix (Promega Corporation, Madison, USA). Cycling conditions were initial denaturation at 95 °C for 5 min, followed by 40 cycles of 95 °C for 15 s, 59 °C for 30 s and 72 °C for 30 s.

The following primers were used (5′- > 3′orientation):

ORAI1 forward primer: AGCCTCAACGAGCATCCCAT

ORAI1 forward reverse primer: CTGATCATGAGCGCAAACAGG

GAPDH forward primer: TGAGTACGTCGTGGAGTCCACTG

GAPDH reverse primer: CACCACCAACTGCTTAGCACC

Relative quantification of the gene expression was achieved using the ∆∆Ct method and GAPDH as housekeeping gene.

Cells were incubated with with TAC-BSA (100 nM, Sigma) for the indicated time periods, washed twice with ice-cold PBS and suspended in ice-cold lysis buffer (50 mM Tris/HCl, 1 % TritonX-100 pH 7.4, 1 % sodium deoxycholate, 0.1 % SDS, 0.15 % NaCl, 1 mM EDTA, 1 mM sodium orthovanadate) containing a protease inhibitor cocktail (Sigma). The protein concentration was determined using the Bradford assay (BioRad). 40 μg of total proteins were boiled with Roti-Load sample buffer (Carl Roth, Germany) for 5 min at 95 °C and separated in 10 % SDS-PAGE. Proteins were transferred to a PVDF-membrane (Thermo Fisher Scientific, USA) and blocked for 1 h at room temperature with 5 % BSA (Carl Roth, Germany) in TBST. For immunostaining membranes were incubated overnight at 4 °C with anti-Orai1 (1:1000, Cell Signaling) and GAPDH (1:3000, Cell Signaling, USA) antibodies. To detect the specific proteins membranes were incubated for 1h at RT with a 1:2000 dilution of anti-rabbit IgG conjugated to horseradish peroxidase (Cell Signaling, USA). After washing, bands were visualized using the ECL western blotting detection reagent (GE Healthcare, USA) and quantified by Quantity One Software (ChemiDoc XRS, Bio-Rad, USA).

Rac1 activity was determined utilizing affinity precipitation with GST-PBD as described previously [62]. In brief, cells, treated or not with TAC (100 nM) in the presence or absence of the specific Rac1 inhibitor NSC23766 (50 μM) were lysed in Mg²⁺ lysis buffer (Upstate Biotechnology, Inc.) and incubated with 200 μl of binding buffer composed of (all in mM) 25 Tris–HCl (pH 7.5), 1 DTT, 30 MgCl₂, 40 NaCl, and with added 0.5 % Nonidet P-40, and 5 μl glutathione-Sepharose 4B beads at 4 °C. The bead pellet was then washed 3 times with a buffer composed of (in mM) 25 Tris–HCl (pH 7.5), 1 DTT, 30 MgCl₂, 40 NaCl, with or without added 1 % Nonidet P-40. The bead pellet was finally suspended in 20 μl of Laemmli sample buffer. Proteins were separated by 11 % SDS-PAGE, transferred onto nitro-cellulose membrane, and immunoblotted with anti-Rac1 antibody (1:1000, Cell Signaling, USA).

Orai1 surface expression was analyzed by flow cytometry. To this end, the cells were detached, washed three times with phosphate-buffered saline (PBS) and fixed with 4 % paraformaldehyde for 15 min on ice without (for surface protein) or with (for total protein) permeabilization with 0.1 % Triton X-100 for 5 min. Then the cells were incubated for 60 min (37 °C) with anti-Orai1 primary antibody (1:200, Abcam), washed once in PBS, and stained in 1:250 diluted CF™ 488A-labeled anti–rabbit secondary antibody (Sigma, USA) for 30 min (37 °C). Samples were immediately analyzed on a FACS Calibur flow cytometer (BD Biosciences).

Fura-2 fluorescence was utilized to determine intracellular Ca²⁺ activity [63]. Cells were loaded with Fura-2/AM (2 μM, Invitrogen, Goettingen, Germany) for 20 min at 37 °C. Cells were excited alternatively at 340 nm and 380 nm through an objective (Fluor 40×/1.30 oil) built in an inverted phase-contrast microscope (Axiovert 100, Zeiss, Oberkochen, Germany). Emitted fluorescence intensity was recorded at 505 nm. Data were acquired using specialized computer software (Metafluor, Universal Imaging, Downingtown, USA). Cytosolic Ca²⁺ activity was estimated from the 340 nm/380 nm ratio. SOCE was determined by extracellular Ca²⁺ removal and subsequent Ca²⁺ readdition in the presence of thapsigargin (1 μM, Invitrogen) [64]. For quantification of Ca²⁺ entry, the slope (delta ratio/s) and peak (delta ratio) of Ca²⁺-entry were calculated.

Experiments were performed with Ringer solution containing (in mM): 125 NaCl, 5 KCl, 1.2 MgSO₄, 2 CaCl₂, 2 Na₂HPO₄, 32 HEPES, 5 glucose, pH 7.4. To reach nominally Ca²⁺-free conditions, experiments were performed using Ca²⁺-free Ringer solution containing (in mM): 125 NaCl, 5 KCl, 1.2 MgSO₄, 2 Na₂HPO₄, 32 HEPES, 0.5 EGTA, 5 glucose, pH 7.4.

Data are provided as means ± SEM, n represents the number of independent experiments. Data were tested for significance using unpaired student’s t-test or ANOVA as appropriate. Differences were considered statistically significant when p-values were < 0.05. Statistical analysis was performed with GraphPad InStat version 3.00 for Windows 95, GraphPad Software, San Diego California USA, www.​graphpad.​com.