Zinc finger protein ZBTB20 expression is increased in hepatocellular carcinoma and associated with poor prognosis

Primary HCC tissue sample (n = 152) were randomly obtained from patients who underwent routine curative surgery at the Eastern Hepatobiliary Surgery Hospital between 2001 and 2007. The patients were not pretreated with radiotherapy or chemotherapy prior to surgery. Among them, 102 tissue samples were fixed in 10% formalin and embedded in paraffin for immunohistochemical analysis. The other 50 tissue samples were immediately frozen in liquid nitrogen and stored at -80°C after hepatectomy for western blotting and real-time RT-PCR. Table 1 shows the clinicopathological features of these patients. Additionally, normal liver specimens were obtained from 20 patients with hemangiomas of liver who underwent surgery. The 20 cirrhotic liver specimens were obtained from patients who underwent liver biopsy. The diagnoses were confirmed by histopathologic study. Tumor stage was determined according to the 2002 International Union Against Cancer TNM classification system [40]. Tumor differentiation was graded by the Edmondson grading system. Written informed consent was obtained from these patients, and the protocol for this study was approved by the Ethics Committee of the Eastern Hepatobiliary Surgery Hospital.

L02, QSG7701, PLC/PRF/5, SMMC7721, HepG2, SK-Hep-1, WRL68, Hep3B, Huh7, HCCCLM3, and HCCC97L cell lines were obtained from American Type Culture Collection (Manassas, VA) or Cell bank of Chinese Academy of Sciences (Shanghai, China). All cells were cultured in DMEM (GiBco BRL, Life Technologies) with 10% fetal bovine serum at 37°C in a humidified 5% CO₂ atmosphere.

Histological diagnoses of tumourous and non-tumourous formalin-fixed and paraffin-embedded tissues were confirmed on haematoxylin and eosin-stained sections. The tissue sections (3-μm thick) were dewaxed, rehydrated and then immersed in methanol containing 0.3% hydrogen peroxide for 30 min to block endogenous peroxidase activity. Subsequently, the sections were heated in a pressure cooker filled with 10 mM ethylenediaminetetracetic acid (EDTA) buffer (pH 8.0) for 2 min. After cooling, the sections were incubated in 1% blocking serum for 30 min to reduce nonspecific binding. Primary anti-ZBTB20 polyclonal antibodies[39] were diluted 1:350 and incubated with the sections at 4°C overnight. Following incubation with biotinylated secondary antisera, the streptavidin-biotin complex/horseradish peroxidase was applied. Finally, the visualization signal was developed with diaminobenzidine (DAB) and the slides were counterstained in hematoxylin.

Stained sections were evaluated in a blinded manner without prior knowledge of the clinical information using the German immunoreactive score, Immuno-Reactive-Score (IRS). Briefly, the IRS assigns sub-scores for immunoreactive distribution (0-4) and intensity (0-3), then multiplies them to yield the IRS score. The percent positivity was scored as "0" (<5%), "1" (5-25%), "2" (25-50%), "3" (50-75%,), "4" (>75%). The staining intensity was score as "0" (no staining), "1" (weakly stained), "2" (moderately stained), and "3" (strongly stained). The final ZBTB20 expression score was calculated with the value of percent positivity score plus staining intensity score, which ranged from 0 to 12 (Figure 1). We estimated IRS by averaging the values in eight fields at ×400 magnification for each specimen. Intratumoral/peritumoral ZBTB20 expression was defined as follows: low expression (score 0-6/0-3) and high expression (score > 6/4-6). Immunohistochemical analysis and scoring were performed by 2 independent investigators.

Total RNA was extracted from frozen tissue specimens (50-100 mg) using Trizol reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer's protocol. The RNA was reverse transcribed using RT-PCR kits (Applied Biosystems, Foster City, CA, USA) with an oligo d (T) primer under standard conditions. Real-time ZBTB20 PCR amplification was performed in 1× Universal Master Mix (Applied Biosystems) with gene-specific primers and probe on the ABI Prism 7300 Sequence Detection System, according to the manufacturer's instructions. The 18s rRNA levels were quantified as internal control to normalize the expression of each gene. Each reaction was repeated independently at least three times. The following primers were used: ZBTB20, sense 5'- ATGCTAGAACGGAAGAAACCCA -3', antisense 5'-TGTGAGCGTGAGAGTTTGTCA -3';18s, sense 5'-GGGAGGTAGTGACGAAAAA T-3' and antisense 5'-ACCAACAAAATAGAACCGCG-3'. Relative expression levels of genes were calculated and expressed as 2^ΔCt.

Western blotting was performed as previously described [41]. In brief, the tissues or cells were lysed in RIPA buffer, sonicated, and protein concentrations calculated by Bicinchoninic acid (BCA) (Sigma). About 60 μg protein samples were run on a 12% SDS-PAGE gel and transferred to a polyvinylidine difluoride membrane. Membranes were blocked for 1 h in Tris-buffered saline with 0.05% Tween 20 (TBST) containing 5% skim milk. The membrane was probed with ZBTB20 antibody (dilution, 1:2000) overnight followed by washing triplely with TBST for 5 min and incubated with an IRDye 800CW-conjugated secondary antibody. After being washed three times, the membrane was detected with LI-COR imaging system (LI-COR Biosciences). Mouse anti-human β-actin antibody (dilution, 1:1000; Santa Cruz) was applied as an internal control. The signal intensity of each band on scanned autoradiograms was analysed using LI-COR imaging system. We normalised each sample to the intensity of the β-actin band, and then estimated the value as an expression index.

Follow-up data were obtained for all the 102 patients with immunohistochemical analysis. The follow-up period was defined as the interval from the date of operation to the date of death or the last follow-up. Deaths from other causes were treated as censored cases. Recurrence and metastasis were diagnosed by clinical examination, AFP measurement, liver ultrasonography, and computed tomography (CT) scan. All patients were observed until December 2009, ranged from 29 to 103 months (median, 73 months). Overall survival (OS) was defined as the interval between the dates of surgery and death. Disease-free survival (DFS) was defined as the interval between the dates of surgery and recurrence; if recurrence was not diagnosed, patients were censored on the date of death or the last follow-up.

To determine factors influencing survival after operation, 13 conventional variables together with ZBTB20 expression were tested in 102 patients: age (≤50 years vs >50 years), gender, tumor size (≤50 mm vs >50 mm), serum AFP level (≤20 ng/mL vs >20 ng/mL), HBsAg (positive vs negative), Edmondson-Steiner grade (I-II vs III-IV), liver cirrhosis (yes vs no), tumor encapsulation (complete vs uncomplete vs no), vein invasion (yes vs no), tumour multiplicity (solitary vs multiple), TNM stage (I-II vs III), recurrence (yes vs no), metastasis (yes vs no), and ZBTB20 intratumoral/peritumoral protein expression level (high vs low).

Our previous work showed that ZBTB20 was developmentally up-regulated in liver and was a key repressor governing AFP gene transcription in postpartum liver, and may play an essential role in liver intrinsic functions by regulating genes such as P450 family members, glucose metabolism and the regulation of the somatotropic hormonal axis. To investigate the expression of ZBTB20 and its possible role in HCC, we first detected the protein expression in three human normal liver cell line (L02, QSG7701, WRL68) and 8 HCC cell lines (PLC/PRF/5, SMMC7721, HepG2, SK-Hep-1, Hep3B, Huh7, HCCCLM3, and HCCC97L). ZBTB20 was high expressed in most of the cells (Figure 2A, the whole image was shown in additional file 1). We further performed real-time RT-PCR for the transcriptional level of ZBTB20 from 50 frozen paired samples derived from patients who had undergone hepatectomy for histologically proven HCC. The mRNA level of ZBTB20 was significantly higher in 38 (76%) HCC tissues (tumour; T) compared with the pair-matched non-tumor tissues (NT). We calculated the copy number ratio of ZBTB20 mRNA/18s mRNA. This ratio was significantly higher in tumor samples than in NT samples (4.47 ± 2.71 versus 2.32 ± 0.64, P = 0.006) (Figure 2B).

Next, the protein level of ZBTB20 in T and NT specimens of 50 HCC cases was analyzed by western blot analysis. ZBTB20 signal was found to be positive in all T samples, and in 78% of NT samples. The intensity of each protein band was normalised against the expression of β-actin in each sample, and this ratio was treated as an expression index. Consistent with mRNA expression, the protein level of ZBTB20 in HCC tumor tissues was also significantly higher than that in NT samples (1.81-fold on average, P < 0.001) (Figure 2C).

To investigate the effect and the prognostic value of ZBTB20, immunohistochemistry was used to assess the expression of ZBTB20 in the HCC tissues sections. It was showed that ZBTB20 staining was mainly in the nucleus of tumor cells, partly in the cytoplasm. ZBTB20 expression in normal hepatocytes from para-tumoral tissue of hemangiomas of liver and cirrhotic liver were negative or weakly positive (Figure 3A,B), while mainly moderate or strong positive in HCC tumors (Figure 3C). Overall, 42 of the 102 (41.2%) cases showed high expression (IRS over 6) ZBTB20 in the tumorous tissues, while 60 (58.8%) of the cases showed low expression (IRS 0-6). Generally, ZBTB20 density was significantly higher in intratumoral tissues than in peritumoral tissues (6.37 ± 3.17 versus 2.73 ± 1.68, P < 0.001) (Table 2). Additionally, a sharp contrast was often observed between infiltrative tumorous areas of positive staining and the adjacent nontumorous area of negative staining (Figure 3D).

We analysed the relationship between ZBTB20 protein expression and clinical features of HCC by establishing two groups with high and low ZBTB20 expression respectively based on the results of immunohistochemistry analysis. As shown in Table 3, intratumoral ZBTB20 density were positively correlated with vein invasion, recurrence and metastasis. Meanwhile, patients with high peritumoral ZBTB20 density were prone to recurrence. There was no significant association between ZBTB20 expression and the other clinical features, such as age, gender, tumor size, serum AFP level, HBsAg, Edmondson-Steiner grade, liver cirrhosis, tumor encapsulation, tumour multiplicity or TNM stage.

Our past work showed that ZBTB20 negatively regulated AFP [38]. However, in this work, no correlation between serum AFP level and tissue ZBTB20 protein expression was found. Considering the possible discrepancy of serum and liver tissue AFP level, we examined possible relationship between tissue AFP staining level and ZBTB20 expression level in HCCs, adopting Spearman's correlation analysis. In 102 samples, 61.8% cases (63/102) showed high IRS of ZBTB20 with low IRS of AFP; 29.4% cases (30/102) showed low IRS of ZBTB20 with high IRS of AFP; and 8.8% cases (9/102) showed almost the same level of IRS. As shown in Figure 4, the ZBTB20 level was negatively correlated with the staining degree of AFP in HCCs (r = -0.33, P = 0.001), while the serum AFP level had no significant correlation with the tissue AFP IRS (P= 0.538).

At the time of the last follow-up, 74 patients had tumor recurrence, and 59 patients had died. The 1-, 3-, and 5-year OS rates were 77.5%, 53.5%, and 45.9%, respectively; and the 1-, 3-, and 5-year DFS rates were 52.8%, 33.4%, and 26.5%, respectively. The median OS and DFS time were 18 months (95%CI, 1.06 months to 34.94 months) and 6 months (95%CI, 3.98 months to 8.01 months), respectively, for patients with high intratumoral ZBTB20 density (IRS over 6, as described in Materials and methods) and were statistically shorter than the median OS and DFS time for patients with low peritumoral ZBTB20 density [67 months (95%CI, 52.53 months to 81.47 months) and 31 months (95%CI, 13.89 months to 48.12 months), respectively (P = 0.001 and P<0.001, respectively; Figure 5A and 5B)]. Besides, patients with high peritumoral ZBTB20 had poor DFS (9 months vs 22 months, P = 0.002; Figure 5D), whereas peritumoral ZBTB20 was not associated with OS (P = 0.225; Figure 5C)

Univariate Cox regression analyses determined that tumor size, serum AFP, TNM stage, tumor number, tumor encapsulation, vein invasion and intratumoral ZBTB20 expression were significantly associated with OS; while tumor size, HBsAg positive, TNM stage, tumor number, vein invasion and intratumoral/peritumoral ZBTB20 expression were associated with DFS. Furthermore, multivariate Cox regression analyses revealed that high intratumoral ZBTB20 was independent risk factor for OS (relative risk [RR] = 1.952, P = 0.016) and DFS (RR = 2.094, P = 0.003) (Table 4). Besides, tumor size large than 50 mm and vein invasion were also independent predictors for the OS of HCC patients (P = 0.006 and 0.086, respectively; Table 4), while the others failed to show this independence.

Using 12 months as the cutoff value, all of the recurrences were divided into early recurrence, which is mainly from intrahepatic metastasis, and late recurrence, which is usually a result of a multicentric new tumor [42]. Patients with higher intratumoral ZBTB20 density were prone to have an early recurrence compared with patients with low intratumoral ZBTB20 (7.72 ± 2.9 vs 5.01 ± 2.86, P<0.001) (Table 5).