1 Introduction
Renal cell carcinoma (RCC) is the most common type of renal malignancy, accounting for 90–95% of all renal cancers and 2–3% of all cancers [
1]. Over the last 10 years, there has been an increase of approximately 20% in the incidence of RCC, especially in industrialized countries [
2]. Clear cell renal cell carcinoma (ccRCC), originating from proximal tubule cells, is the most common histologic subtype of RCC, especially advanced RCC (accounting for 60–70% and 90% of cases, respectively) [
3]. Due to its largely asymptomatic nature and distinguishable clinicopathological risk factors, ccRCC is rarely detected in the early stage [
4]. In addition, up to one-third of patients with ccRCC develop metastasis or present with metastasis at the time of diagnosis [
5]. Unfortunately, the disease at this stage is almost always fatal. Although steady progress has been made in delineating the molecular characteristics to explain the initiation and progression of this lethal disease [
6], it is an urgent need to mine ccRCC datasets to identify novel potential molecules that can be used to detect ccRCC in early stages.
Classical zinc finger proteins (ZNFs), constituting a large family of sequence-specific transcription factors, are encoded by 2% of human genes [
7]. Over the last few decades, it has been reported that aberrant expression of ZNFs is involved in the initiation and progression of tumors in various malignancies [
8‐
10]. ZNF692, located on chromosome 1q44, is a key transcription factor that binds to the promoter regions of key genes regulating tumor progression [
11]. Recent reports have shown that ZNF692 is linked to the recurrence of Wilms’ tumor [
12]
, the prognosis and proliferation of ccRCC [
13,
14], and the aggressiveness of lung adenocarcinoma (LUAD) [
15] and that it promotes the proliferation and invasion of cervical cancer cells [
16]. In addition, ZNF692 may serve as a potential biomarker associated with immune infiltration in hepatocellular carcinoma [
17]. Though, Wang et al reported that ZNF692 promoted the proliferation of ccRCC cells by targets IRF4 and FLT4 [
14], however, the role of ZNF692 in ccRCC is largely unknown.
In this study, we found that ZNF692 was upregulated in ccRCC and that its expression was increased in a stage-specific manner. The expression of ZNF692 was associated with poor overall survival. In addition, ZNF692 promoted the proliferation and migration of ccRCC cells by targeting G3BP2 and TM9SF2. Moreover, ZNF692 was expressed mainly in proximal tubule cells, collecting duct cells, and T and B cells in normal kidney tissue. However, upon exposure to immune checkpoint blockade (ICB) agents, a portion of ZNF692-positive tumor cells (referred to as tumor program 1 cluster (TP1) cells) in advanced ccRCC patients responded to ICB therapy. These data indicate that ZNF692 might be involved in the migration and ICB response of ccRCC cells.
2 Materials/patients and methods
2.1 Patient and tumor samples
Fifty-eight paraffin-embedded cancer and paracancerous samples were collected between January 2019 and December 2022 at The MengChao Hepatobiliary Hospital of Fujian Medical University. The samples were collected based on specific inclusion and exclusion criteria. The inclusion criteria consisted of primary clear cell renal cell carcinoma (ccRCC) cases that had not undergone any treatment prior to surgery. Conversely, the exclusion criteria encompassed other types of kidney carcinoma, non-primary ccRCC cases, and individuals who had received any form of interventional therapy, such as radiotherapy or chemotherapy. All patient is still alive at the time of writing the manuscript. All samples were obtained from patients with primary ccRCC aged 32 to 84 years. The TNM stage of the patients ranged from 1 to 4, with stage 2 being the most common stage (Table SI). The study was approved by the Institutional Review Board of MengChao Hepatobiliary Hospital of Fujian Medical University for the use of patient samples. Informed consent form was received from all participants before surgery in this study. Pathologic and clinical diagnoses of ccRCC were made using the diagnostic criteria of the International Society of Urological Pathology (ISUP) consensus. All methods were performed in accordance with the relevant guidelines and regulations of the Institutional Review Board of MengChao Hepatobiliary Hospital of Fujian Medical University.
2.2 Gene expression analysis
To explore the expression profile of ZNF692 in ccRCC, we queried The University of Alabama at Birmingham Cancer data analysis Portal (UALCAN,
http://ualcan.path.uab.edu/analysis.html) to assess the expression levels of ZNF692 in ccRCC in a dataset from The Cancer Genome Atlas (TCGA) using normal kidney tissue as a control [
18].The input gene symbol "ZNF692" was utilized to query its expression within the TCGA dataset "Kidney renal clear cell carcinoma (KIRC)". To compare the expression of ZNF692 between paired tumor and adjacent normal tissues, we queried the Tumor Node Metastasis (TNM) plotter (
https://www.tnmplot.com) website [
19]. Using “ZNF692” as keyword, we obtained mRNA expression data for ZNF692 in tumor and adjacent normal tissues and those data were analyzed by the Mann‒Whitney test.
2.3 Single-cell RNA sequencing data analysis
To identify the expression pattern of ZNF692 in normal kidney tissue, we queried the scRNA section of the Human Protein Atlas website (
https://www.proteinatlas.org) using ZNF692 as keyword [
20]. To explore the role of ZNF692 in ccRCC, we queried Single Cell Portal (
https://singlecell.broadinstitute.org/single_cell) using keywords “kidney” and “cancer” to search related studies. After identified the studies, we explored the expression pattern of ZNF692 in different cell types exposed to ICB agents using the dataset from the study by Kevin Bi et al [
21] using “gene explore” tools and “ZNF692” as keyword.
2.4 Overall survival analysis
To determine the prognostic value of ZNF692 expression in ccRCC, the web tool Gene Expression Profiling Interactive Analysis (GEPIA, https://
http://gepia.cancer-pku.cn/detail.php) was used to visualize the correlation between ZNF692 expression and the overall survival (OS) of ccRCC patients, with the median expression level as the final stratification cutoff [
22]. We evaluated the potential prognostic value of ZNF692 using the least absolute shrinkage and selection operator (LASSO)–Cox regression method. The receiver operating characteristic (ROC) curve was plotted using the “survival” package in R.
2.5 Gene Ontology and pathway analyses
To explore the possible functional mechanism of ZNF693 in ccRCC, we analyzed genes coexpressed with ZNF692 and performed Gene Ontology (GO) enrichment analysis using LinkedOmics (
http://www.linkedomics.org) [
23]. The gene associated with ZNF692 was obtained using RNA-seq data from the "sample cohort: TCGA_KIRC" by employing the "LinkFinder" tools. Subsequently, GO analysis was conducted using the ZNF692 associated genes as input through the utilization of GSEA tools. To explore the function of ZNF692 in patients treated with ICB agents, we performed correlation analysis using the “corrr” package in R to identify genes that were coexpressed with ZNF692 in tumor cells with or without exposure to ICB agents. GO enrichment analysis was performed using Metascape (
http://metascape.org/gp/index.html#/main/step1) [
24].
2.6 Tissue microarray and immunohistochemical (IHC) staining
The tissue microarray, containing 29 pairs of primary ccRCC and paracancerous samples, was constructed in house. Briefly, small punches from 29 paraffin-embedded (donor) tissue blocks were obtained with a manual tissue arrayer, and those tissue cores were transferred into a positionally encoded array in a recipient paraffin block. After being sealed with paraffin, the tissue blocks were fixed on a tissue slicer and were sliced into serial sections with a 5 μm thickness. After deparaffinization, IHC staining was performed using an anti-ZNF692 antibody (Bioss, Beijing, China, Cat: bs-4360R) and horseradishperoxidase (HRP) conjugated second antibody (Beyotime, Beijing, China, Cat: A0208). After IHC staining, the sections were scanned and imaged using a scanner (Motic, Xiamen, China). The first sample in the tissue microarray was used as a reference for normalization among sections. The IHCF results were presented as two parameters: the signal intensity (scored from 0 to 4) and the percent of positively stained cells (positively stained cells/total cells per field of view, scored from 0 to 4. A score of 0 indicated the absence of staining, 1 indicated that the percentage of positively stained cells was less than 25%, 2 indicated that the percentage of positively stained cells was between 25 and 50%, 3 indicated that the percentage of positively stained cells was between 50 and 75% and 4 indicated that the percentage of positively stained cells was more than 75%). The total IHC score was calculated by summing the scores of the signal intensity score and the percentage of positively stained cells.
2.7 Cell culture and transfection
The ccRCC cell lines Caki-1 and 786–0 were gifts from Professor Hongbo Zhao (Kunming Medical University). The cell lines were maintained in Dulbecco’s modified Eagle’s medium (DMEM, HyClone, Utah, USA) supplemented with 10% fetal bovine serum (PAN-biotech, Adenbach, Germany), 100 U/ml penicillin and 100 µg/ml streptomycin (Gibco, New York, USA) at 37 ℃ with 5% CO2. All those cell lines were mycoplasma free as tested by PCR methods. For transfection, 2 × 105 cells per well were seeded in a 6-well plate and cultured for 12–18 h. When the cells were 50–70% confluent (for siRNA transfection) or 80–90% confluent (for ZNF692 overexpression), the transfection procedure was performed using Lipofectamine 3000 (Thermo, Massachusetts, USA) according to the manufacturer's instructions.
2.8 siRNA and plasmid construction
The ZNF692 siRNAs were designed and synthesized by GenePharma (Shanghai, China). A total of three siRNAs were used to knock down ZNF692 expression. The sequences of the targeted siRNAs (si1 to si3) and the negative control siRNA (NC) were as follows: si1-sense: GGAAGUCUUUCAACUUUAAGATT, si2-sense: GGAUGAGGACACUGCACAAAUTT, si3-sense: GGAGCUUGCAGAUUUGGAAUCTT, NC-sense: UUCUCCGAACGUGUCACGUTT. The ZNF692plasmid containing a flag tag was constructed by Sunya (Fuzhou, China) using a gene synthesis method. The cDNA sequence of ZNF692 was synthesized according to CDS sequences of NCBI Reference Sequence: NM_001136036.3 and was inserted into pcDNA3.1-flag backbone by biosune company (
http://www.biosune.com/).
2.9 Quantitative real-time PCR (qPCR) assay
1 μg total RNA was extracted using TransZol Up kit (Transgen, Beijing, China), and reverse-transcribed into cDNA using EasyScript® One-Step gDNA Removal and cDNA Synthesis SuperMix (transgen, Beijing, China) cDNA synthesis kit. Briefly, 1 μg total RNA and 1 nmol random hexamers primers were mixed and incubated at 65 ℃ for 5 min. After incubation, the RNA and primers mixture were put on ice immediately. Then, enzyme and buffer were added to the RNA mixture and ddH
2O was added to makeup total volume to 20 μl. The cDNAs were synthesized at 42 ℃ for 30 min and the enzyme was then inactivated at 85 ℃ for 5 s. cDNAs were quantified using Taq Pro Universal SYBR qPCR Master Mix (Vazyme, Nanjing, Chian) and a QuantStudio 3 Real-Time PCR System (ABI, California, USA) with the beta-actin (ACTB) as the reference. Gene-specific primer for qPCR were designed using NCBI “pink primer” program under default parameters with two changes: (1) primer mast span one exon-exon junction; (2) PCR product size 80 bp-300 bp. The sequences of the primer pairs were listed in Table
1. The qPCR program as following: 95 ℃ for 3min; 40 temperature cycles: 95 ℃ for 30 s,60 ℃ for 20 s,72 ℃ for 20 s; 25 ℃ to 95 ℃ by 0.1 ℃/sec for melting curve. The fluorescence signal was collected at 72 ℃ at temperature cycles stage and consecutive collected at melting curve stage.
Table 1
The qPCR primer pairs used in this study
ACTB | NM_001101.5 | CACAGAGCCTCGCCTTTGC | CCATCACGCCCTGGTGC |
ZNF692 | NM_001136036.3 | TACCAGCACATCCACCAGAA | CGCAGAACTCACAGATGTAGTC |
CDK3 | NM_001258.4 | TCGCTGCTCAAGGAACTGAAGC | GTCCTGGCTGAGGAACTCAAAC |
G3BP2 | NM_203505.3 (all isoforms) | GAGCTGAAACCACAAGTGGAGG | GGTCACTGAAGCCCAGGAGAAA |
TM9SF2 | NM_004800.3 | CCTCCAAGAAAAGGGATGCTGC | ACAGGACCACAGCACACGTCAT |
2.10 Western blot (WB) assay
The cells were lysed with Radio immunoprecipitation assay lysis buffer (RIPA) (Pierce, 89,900), supplemented with a protease inhibitor ‘cocktail’ (Beyotime, Beijing, China). Bicinchoninic acid assay (Pierce, Illinois, USA) was used to measure protein concentrations. The protein was separated on 10% polyacrylamide gel (PAGE) and transferred to 0.45 μm nitrocellulose (NC) filter membrane (Millipore, Massachusetts, USA). Then the NC membrane was blocked with 10% nonfat powered milk (Amresco, Washington, USA) 1 h at room temperature and then hybridized with primary antibodies (ZNF692, Bioss, Beijing, China, Cat: bs-4360R; GAPDH, Beyotime, Beijing, China, Cat: AG0122) for overnight at 4 ℃ in blocking buffer. The protein-antibody complexes were incubated with peroxidase-conjugated secondary antibodies (Beyotime, Beijing, China, Cat: A0208) and were detected using enhanced chemiluminescence (Pierce, Illinois, USA).
2.11 Cell proliferation and migration assays
ccRCC cells were cultured and transfected as described above. Forty-eight hours after transfection, cell proliferation, apoptosis, and migration assays were performed. For the cell proliferation assay, transfected cells were seeded into a 96-well plate at 10,000 cells per well, with 8 wells for each condition (siRNA vs. NC). After 24 h, a CCK8 assay was used to test cell proliferation. Cell migration was tested using a wound healing assay and a transwell assay. For the wound healing assay, 1.5 × 105 cells were seeded into a 24-well plate and cultured for 12–18 h. A wound was made using a white Corning pipette tip, and the wells were washed with PBS to remove cell debris and maintained with DMEM without FBS. Twenty-four hours later, the wound was photographed with a CCD camera connected to an inverted microscope (Motic, Xiamen, China), and the wound area was analyzed by ImageJ. The transwell assay was performed using transwell inserts (Corning, 3422, New York, USA). A total of 50,000 cells were seeded into the upper inserts in 100 μl DMEM plus 1% bovine serum albumin (BSA). The cells in the inserts were cultured in 24-well plates containing 600 μl DMEM supplemented with 10% fetal bovine serum (PAN-biotech, Adenbach, Germany), 100 U/ml penicillin and 100 µg/ml streptomycin. After 24 h of incubation, the inserts were washed two times with PBS, and the attached cells were fixed with 100% methanol for 10 min. Then, the inserts were washed three times with PBS, and the cells were stained using 0.1% crystal violet for at least 1 h at room temperature. Then, the inserts were photographed with a CCD camera connected to an inverted microscope, and the cells were counted using ImageJ.
2.12 Statistical analysis
Statistical analysis of tumor gene expression levels across clinicopathological feature subgroups was carried out using the UALCAN web tool. Comparisons of gene expression levels and IHC staining between tumor and adjacent normal tissues were performed using a paired t-test, otherwise unpaired t-tests were used. One-way ANOVA followed by a Turkey test was used to perform multiple comparison. p < 0.05 was set as the criterion for statistical significance. Additionally, KM survival plots with log-rank p values, hazard ratios (HRs), and 95% confidence intervals (CIs) were generated using the GEPIA web tool. p <0.05 indicated a statistically significant difference in OS.
4 Discussion
ccRCC is highly treatable if diagnosed at an early stage. Unfortunately, approximately 30% of patients are diagnosed with renal carcinoma in a later stage with a poor prognosis and limited treatment options [
25]. Thus, there is a need to identify new markers that can be used to diagnose ccRCC as early as possible. ZNF692 is linked to the recurrence of Wilms’ tumor [
12]
, and promotes the proliferation and invasion of cervical cancer cells [
16]. ZNF692 associates with the prognosis and proliferation of ccRCC [
13,
14]. In addition, ZNF692 may serve as a potential biomarker associated with immune infiltration in hepatocellular carcinoma [
17]. However, the role of ZNF692 in ccRCC is largely unknown. In this study, we found that ZNF692 was significantly upregulated in tumor tissues compared with adjacent normal tissues (Fig.
2), with stage 2, 3, and 4 tissues having higher ZNF692 expression levels than stage 1 tissues. Consistent with the findings of Xu et al. [
13,
14], higher mRNA expression of ZNF692 was linked with poor overall survival in ccRCC patients (Fig.
1B).
786-0 is a ccRCC cell line derived from a primary clear cell adenocarcinoma (
https://www.atcc.org/products/crl-1932) and Caki-1 derived from a primary clear cell adenocarcinoma with metastasis (
https://www.atcc.org/products/htb-46#detailed-product-information). So, we used those two cells to study the role of ZNF692 in the migration of ccRCC cells. Our wound healing and Transwell assay showed that the migration potential of Caki-1 was higher than that of 786-0. In vitro cells experiment shown that ZNF692 promoted the proliferation and migration of ccRCC cells (Fig.
3). However, due to the limitation of experimental conditions, we unable to perform in vivo experiments to confirm the function of ZNF692 in ccRCC. This is a limitation of this study. T cells, B cells, proximal tubular cells, and collecting tubule cells are the dominant cell types in normal kidney tissue where ZNF692 is expressed. In addition, the expression of ZNF692 in tumor program 1 (TP1) tumor-like cells dramatically changed after patients received ICB therapy, with loss of ZNF692 expression in TP1 cells. These data strongly suggest that ZNF692 could function as an oncogene and that ZNF692 may serve as an indicator of the response to ICB therapy.
Due to the limited data on ZNF692 target genes, we firstly explored the genes co-expressed with ZNF692 and performed GSEA to analyze the function of ZNF692 in ccRCC (Figure S2). Genes positively coexpressed with ZNF692 were involved in pathways such as energy metabolism and mitochondrial regulation. Renal cell carcinoma (RCC) is essentially a metabolic disease characterized by a reprogramming of energetic metabolism [
26‐
29]. The metabolic reprogramming covers different processes such as fatty acid metabolism [
30,
31] and glycolysis with partitioned metabolic flux through glycolysis and impaired mitochondrial bioenergetics and OXPhox [
32‐
35]. The co-expression analysis and GSEA results showed that the top 3 pathways were mitochondrial respiratory chain complex assembly, NADH dehydrogenase complex assembly, and mitochondrial gene expression, suggesting that the target genes of ZNF692 may be involved in the regulation of metabolic homeostasis.
However, the genes negatively coexpressed with ZNF692 were involved in pathways such as the immune response, cytokine production, and T and B cell activation. In the last few years, several studies have showed that the activation of specific metabolic pathway have a role in regulating angiogenesis and inflammatory signatures to reprogram tumor microenvironment [
36,
37]. Our results suggests that ZNF692 may govern immune homeostasis in the tumor microenvironment of ccRCC.
The Chip-seq and qPCR data showed that ZNF692 may target G3BP2 and TM9SF2 to function in ccRCC cell. ZNF692 KD increased the expression of negatively associated genes G3BP2 and TM9SF2 (Fig.
4E, F). In addition, the expression of G3BP2 and TM9SF2 were lower in ccRCC compared with normal tissues. G3BP2 was first identified as an androgen-responsive gene, core components that contributes to stress granules (SGs) assembly and RNA metabolism [
38]. Increased G3BP2 promoted the growth of cancer cells and high expression level of G3BP2 was associated with poor prognostic in Head and Neck squamous cell carcinoma, prostate cancer, breast, and lung cancer [
39‐
42]. However, we found that the high expression level G3BP2 was associated with better prognostic in ccRCC. TM9SF2 is a member of the TM9SF family which has four reported members in mammals (TM9SF1-4) with characteristic of nine transmembrane domains [
43]. TM9SF2 may regulate the biosynthesis of glycosphingolipids by regulates the subcellular localization of globotriaosylceramide synthase [
43].TM9SF2 may be an oncogene and a prognostic marker with high expression associated with poor prognostic in pancreatic adenocarcinoma and colorectal cancer [
44,
45]. But we found that in TCGA ccRCC cohort TM9SF2 was associated with good prognostic. This suggests the difference of the role of the same gene in different cancer type and large clinical samples are needed to confirm the role of G3BP2 and TM9SF2 in ccRCC.
Single-cell RNA sequencing is capable of resolving the complexity of tissue and tracing cell lineage differentiation. Since ZNF692 is involved in both energy metabolism and immune regulation in ccRCC, we next explored single-cell RNA-seq data to analyze the expression pattern of ZNF692. ZNF692 was expressed in both kidney-resident immune cells and kidney tissue cells. Specifically, B cells and T cells are the main immune cells that express ZNF692, and proximal tubular cells and collecting tubule cells are the main kidney tissue cells that express ZNF692. The IHC results showed similar patterns of ZNF692 expression in kidney-resident immune cells and kidney tissue cells identified by mRNA expression analysis. The expression pattern of ZNF692 in normal kidney tissue was consistent with the GSEA results in ccRCC cells, suggesting that ZNF692 is involved in the immune response and mitochondrial regulation.
Abundant infiltration of immune cells, particularly T cells, is one of the characteristics of the ccRCC tumor microenvironment [
46‐
49]. Features of the tumor microenvironment heavily affect disease biology and may affect responses to systemic therapy especially immunotherapy [
50‐
53]. In this context, immunotherapy for ccRCC has progressed considerably over the past decade, with new options ranging from cytokine treatments [
54] to targeted therapies such as ICB and VEGF tyrosine kinase inhibitors (TKIs) [
55,
56]. Upon treatment with PD-1 inhibitors, the 4-1BB-Lo progenitor exhaustion signature of CD8
+ T cells was found to be highly enriched, but the other subtype of CD8
+ T cells was largely unchanged [
21]. Considering the expression of ZNF692 in T and B cells in normal kidney tissue, we hypothesized the immunotherapeutic role of ZNF692 in ccRCC.
The tumor-like cell population was composed of two subtypes of cells, TP1 and TP2 [
20]. The TP1 subtype, which exhibited robust upregulation of nectin-2 after treatment, expressed a signature associated with improved survival, while the TP2 subtype expressed several checkpoint molecules. Cluster analysis showed that the main cell type with high ZNF692 expression was the TP1 subtype (Fig.
6C). Our GO analysis using the correlated genes differentially expressed in TP1 cells also showed that ZNF692 was involved in the activity of T and B cells and type I interferon production (Figure S1 and Figure S2). Collectively, these data suggest that tumor cells with high ZNF692 expression may be the primary responders to ICB therapy, but further experimental and clinical verification is needed.
In summary, ZNF692, a member of the Krüppel C2H2‑type zinc finger protein family, is differentially expressed in several tumors. In ccRCC, the expression of ZNF692 was significantly higher in tumor tissue than in adjacent normal tissue, and the expression of this gene was associated with more advanced cancer stage and poor prognosis. In ccRCC cell lines, 786-0 and Caki-1, ZNF692 promoted the cells' proliferation and migration by target G3BP2 and TM9SF2. In addition, ZNF692 was expressed in T cells, B cells, and renal tubular cells. However, the expression pattern of ZNF692 in tumor-like cells was dramatically altered after ICB therapy. Therefore, ZNF692 may represent a predictive risk factor for oncogenesis and a biomarker for the response to immunotherapy in ccRCC, although additional large-scale validation is required. Given that the transcriptional targets and regulators of ZNF692 are largely unknown, comprehensive analysis and validation are needed to confirm the targets of ZNF692, particularly in ccRCC.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.