Background
Methods
Oocytes, embryos and other tissue collections
Pig and cattle
Human
RNA and cDNA preparation and analysis
Total RNA preparation
Complementary DNA (cDNA) synthesis
Cloning of porcine and bovine ZAR1 cDNA variants and sequence analysis
Coordinate relative to ZAR1 coding sequences and exon position | |||||
---|---|---|---|---|---|
primer | sequence (5'-3')GB acc: | bovine DQ231456 | porcine DQ231444 | human AY191416 | exon |
S1 | ccagccgagcaaggagcg | Bt (813) | 1 | ||
S2 | tacactgatggctgccctg | Bt (-8) | 1 | ||
S3 | tataacccttaccgagtggagg | Bt (976) | Hs (1096) | 3 | |
S4 | ctcgtaccggtacccataccc | Hs (60) | 1 | ||
S5 | acgaggtgctggacggttaca | Ss (17) | 1 | ||
S6 | cctgcgcttccagttcttaga | Bt (831) | Ss (840) | Hs (952) | 1 |
S7 | tgccgaacatgccagaag | Bt (955) | 1 | ||
S8 | aacccgttccgcgacgtat | Bt (319) | 1 | ||
S9 | tgtctcggtgcagtgctcgtt | Ss (342) | 1 | ||
S10 | aacccttatcgcgtggaggata | Ss (988) | 3 | ||
S11 | tgcccagtaaaacttcgcca | Ss(1045) | 4 | ||
AS1 | tttgaagctgaaagtgctgtcac | Bt (1143) | Ss (1152) | Hs (1263) | 4 |
AS2 | tcttcctcgccgactcctct | Ss (691) | 1 | ||
AS3 | agagggagaaaggagaagagca | Ss(1261) | 4 | ||
AS4 | gacagctttgtcaaatacagcc | Ss(1307) | 4 | ||
AS5 | acaaatcttgacggaggggcct | Bt (1090) | 4 | ||
AS6 | gaagctgaaagtgctatcacag | Bt (1140) | 4 | ||
AS7 | ggcgacgatctctcgccagcggtgtcc | Bt (803) | 1 | ||
AS8 | ataggcgtttgcctttgcatc | Bt (1117) | Ss (1124) | 4 | |
AS9 | ctggaagcgcaggcgctcct | Bt (843) | 1 | ||
AS10 | tcacaggataggcgtttgc | Bt (1124) | 4 | ||
AS11 | ttcacagcgggacctcagtt | Bt (1203) | 4 |
Northern blot
Virtual northern blot
RT- PCR analysis of ZAR1 expression in oocytes, embryos and tissues
Comparative RT- PCR analysis of ZAR1 messengers in pig, cattle and human oocytes and testis
Real-Time PCR
In situ hybridization (ISH)
Porcine and bovine genomic DNA extraction and analysis
Southern blot hybridization of genomic DNA in porcine and bovine
Regional assignment of Sus scrofa ZAR1 gene
Results
Cloning and comparison of ZAR1 cDNA from porcine and bovine oocytes
Palindrome repeats length (nt) | Starting positions of repeats relative to coding ZAR1 region | Calculated e-value of repeat** | |
---|---|---|---|
Sus scrofa
| |||
15 | 135 | 475 | 1.60e-02 |
12 | 77 | 102 | 8.18e-01 |
12 | 79 | 202 | 8.18e-01 |
12 | 268 | 584 | 8.18e-01 |
10 | 269 | 605 | 3.63e-01 |
12 | 539 | 789 | 8.18e-01 |
10 | 266 | 463 | 3.63e-01 |
Bos Taurus
| |||
18 | 203 | 423 | 7.52e-03 |
15 | 41 | 451 | 3.30e-01 |
15 | 75 | 212 | 3.30e-01 |
13 | 206 | 631 | 2.18e-01 |
11 | 137 | 751 | 8.95e-02 |
10 | 117 | 560 | 3.58e-01 |
10 | 137 | 277 | 3.58e-01 |
10 | 267 | 636 | 3.58e-01 |
ZAR1 gene characterization and mapping in pig and cattle
Sus scrofa
|
Bos taurus
|
Homo sapiens
| |||||||
---|---|---|---|---|---|---|---|---|---|
exon/intron | coordinates relative to coding sequence | exon length (nt) | intron length (nt) | coordinates relative to coding sequence | exon length (nt) | intron length (nt) | coordinates relative to coding sequence | exon length (nt) | intron length (nt) |
1 | 1–852 | >852 | 1466 | 1–850 | >850 | 1467 | 1–963 | >963 | 1512 |
2 | 853–945 | 92 | 82 | 851–943 | 92 | 83 | 964–1057 | 92 | 80 |
3 | 946–1020 | 74 | 1292 | 944–1018 | 74 | 1099 | 1058–1132 | 74 | 1089 |
4 | 1021- 1164 | >143 | 1019- 1155 | >136 | 1133–1275 | >142 |