Background
Colorectal cancer (CRC) is a common and severe disease which poses a threat to human health [
1]. In 2022, there will be approximately 592,232 new cases of CRC in China, 160,248 new cases in the United States and 309,114 deaths from CRC in China, 56,693 deaths in the United States [
2]. In patients with early CRC, the five-year survival rate is about 90%. However, this rate declines to < 10% in advanced-stage patients with distant metastases [
3]. Great advances have been achieved in early screening and treatment for CRC, but the survival rate of CRC remains unchanged [
4]. This disease is associated with low detection efficiency and high death rate due to the lack of symptoms in CRC patients at early stage and metastasis at advanced stage [
5]. Metastasis is a process which involves cancer cell invasion, epithelial mesenchymal transition (EMT) and microenvironment changes [
6]. Hence, it is vitally important to explore the molecular mechanisms underlying CRC progression.
With the development of next-generation sequencing technologies, long non-coding RNAs (lncRNAs) have been brought into focus [
7]. LncRNAs are defined as a type of RNAs longer than 200 nucleotides and incapable of coding proteins [
8]. Initially, lncRNA was considered as transcriptional “noise” due to its non-coding characteristic. Nowadays, a growing number of studies have suggested that lncRNA plays a crucial role in a variety of biological processes via regulating gene expression [
9]. LncRNAs regulate gene expression in multiple ways: they could impact on transcription by guiding the chromatin-modifying complexes and transcription factors, or by acting as scaffolds of protein–protein interactions; moreover, they could act as microRNA (miRNA) sponges sequestering endogenous miRNAs [
10]. Dysregulation of lncRNAs exert tumor-promoting or tumor-suppressing functions to affect the biological processes [
11]. Notably, some certain lncRNAs could be considered as potential therapeutic targets or prognostic molecules for cancers [
12].
RNA binding proteins (RBPs) are important regulators in many cellular processes including RNA splicing, modifications, localization, stability, degradation as well as translation [
13]. They modulate gene expression post-transcriptionally and are implicated in multiple cellular phenotypes [
14]. Abnormal expression of RBPs can affect tumorigenesis via controlling RNA or protein homeostasis [
15]. Accumulating evidence supports that lncRNAs participate in the development of cancers via interacting with RBPs to mediate the stability of mRNA. A study proposed by Yang Lan and his colleague has manifested that OCC-1 negatively modulates CRC cell growth via destabilization of ELAVL1 protein [
16]. Besides, TRPM2-AS facilitates CRC cell proliferation via recruiting TAF15 to regulate the mRNA stability of TRPM2 [
17].
Transcription factors are previously defined as “undruggable” targets for the exception of ligand-inducible nuclear receptors [
18]. The deeper knowledge of these transcription factors, such as their structure and function including expression, degradation, their ability to interact with co-factors, has changed this hypothesis [
19]. Transcription factors are involved in the progression of cancers for their potential oncogenic functions, which paves the way for potential therapies targeted against transcription factors [
20].
GATA binding protein 2 (GATA2) and GATA binding protein 2 antisense RNA 1 (GATA2-AS1) have shown to be implicated in tumorigenesis. For instance, GATA2 enhances aggressiveness and resistance to standard therapies against prostate cancer [
21]. GATA2-AS1 represses non-small cell lung cancer growth via regulating GATA2 [
22]. In this research, we investigated the impacts of GATA2-AS1 and GATA2 on the progression of CRC in vitro and in vivo. Further, we probed into the regulation mechanism between GATA2-AS1 and GATA2 in CRC cells. Our study might provide promising targets for CRC treatment.
Methods
Cell lines
CRC cell lines used in this research included DiFi, SW620, DLD-1, HT-29, SW480 and HCT116. DiFi cell line and human normal colonic epithelial cells (HCoEpiC) were supplied by Shanghai Qincheng Biological Technology Co., Ltd. (Shanghai, China); the others were provided by ATCC (Manassas, VA). SW620 and SW480 cell lines were maintained in Leibovitz's L-15 Medium, HT-29 and HCT116 cell lines in McCoy's 5A Medium, and DiFi, DLD-1 and HCoEpiC cells in RPMI-1640 Medium. SW620, HT-29, HCT116 and DLD-1 cells were cultured in the medium containing 10% FBS with the supplementation of 1% penicillin/streptomycin in a humid incubator at 37 °C with 5% CO2.
Quantitative real-time polymerase chain reaction (RT-qPCR)
TRIzol Reagent (Invitrogen; Carlsbad, CA) was used for RNA isolation. Then, the extracted RNA was subjected to reverse transcription for cDNA synthesis using PrimeScript RT Reagent Kit (Takara Bio, Japan). SYBR
® Premix Ex Taq™ II (Takara Bio) was used for qPCR. Meanwhile, GAPDH was used as endogenous control. The calculation of gene expression level was based on the 2
−∆∆Ct method [
23] and experimental data were displayed as mean ± standard deviation (SD). The experiment was repeated three times. Primer sequences were reported in Table
1.
GATA2-AS1 | F:CCGGGCAGCTTACGATTCTT R:GCGGTGTCTTTCAGAGGGTC |
GATA2 | F:AGTCTGTCTATTGCCTGCCGC R: TGCAGACGGCAACGGC |
GATA2-AS1 promoter | F:CAACGGGCCCAATTGCC R:ACACGAACCATAGAGCCGAT |
Cell transfection
For stably silencing GATA2-AS1, GATA2 or DDX3X expression, the specific short hairpin RNAs (shRNAs) to GATA2-AS1 or GATA2 or DDX3X and shRNA of negative control (sh-NC) were designed and supplied by GenePharma (Shanghai, China). The full-length cDNA sequence of GATA2 was inserted into the pcDNA3.1 vectors (Invitrogen), using empty vectors as control. These vectors were transfected into cells for 48 h using Lipofectamine 3000 (Invitrogen).
CRC cells (600 cells each well) were plated in 6-well plates and incubated for 12 days at 37 °C. Subsequently, cells were washed with phosphate buffered saline (PBS), and fixed by 4% paraformaldehyde for 15 min, followed by staining with 0.5% violet crystal for 10 min and colony counting by the manual method. The experiment was performed in triplicate.
5-Ethynyl-2’-deoxyuridine (EdU)
CRC cells were plated in 24-well plates. We added 10 μM EdU into each well for incubation. Then, cells were fixed, washed, and added with Click-iT EdU Kit. DAPI was used for nuclear counterstain. Images were observed using a fluorescence microscope (Olympus). The experiment was carried out in triplicate.
Flow cytometry analysis
Flow cytometry analysis was done for measuring the apoptosis of CRC cells. Transfected cells were collected, washed and then re-suspended in binding buffer (50 mL). Next, cell suspensions were added with staining solution containing Annexin V-FITC (1/500, BioVision, Milpitas, CA) and PI (1/500, Beyotime), followed by analysis utilizing a BD Biosciences FACSCalibur™ Flow Cytometer (San Diego, CA). The experiment was performed in triplicate.
Terminal-deoxynucleoitidyl transferase mediated nick end labeling (TUNEL)
Transfected cells were washed, fixed and then permeabilized, followed by TUNEL assays utilizing In Situ Cell Death Detection Kit (Roche) based on the supplier’s protocols. Briefly, cells were incubated in terminal dexynucleotidyl transferase (TdT) reaction cocktail (2 μL), and then treated with Click-iT reaction cocktail (50 μL). DAPI (1/2000) was used to counterstain the nuclei. The experiment was performed in triplicate.
Besides, apoptosis of mouse xenografts was evaluated by tissue TUNEL assay, which was performed as per the instructions for the TUNEL assay kit (KeyGen, Nanjing, China).
Transwell invasion assay
Cells (2 × 105) were put into the upper chamber using an 8-mm pore size of transwell coated with Matrigel (50 μg/well, BD Biosciences). The medium with no serum was supplemented to the upper chamber. Complete medium (500 μL) with 20% FBS was utilized to treat the lower chamber. Subsequent to 24 h of incubation, we slightly wiped the cells on the surface of the upper membrane. The invaded cells into the lower chamber were subjected to 10-min fixation in 4% paraformaldehyde (PFA) and 30-min staining by crystal violet (500 μL). The invaded cells in 5 randomly selected fields were observed and imaged using an inverted microscope. The experiment was performed in triplicate.
Western blot
Proteins were extracted utilizing RIPA lysis buffer (Thermo Fisher Scientific) and quantified by a BCA Protein Assay Kit (Abcam, Cambridge, MA). Subsequently, 1% SDS-PAGE was utilized for protein separation. Then, protein samples were transferred onto PVDF membranes (Millipore), which were sealed with 5% defatted milk in TBST, followed by overnight incubation with primary antibodies (Abcam) at 4 °C. In this assay, we used primary antibodies as follows: Anti-GATA2 (1/1000), Anti-E-cadherin (1/1000), Anti-N-cadherin (1/1000), Anti-Vimentin (1/1000), Anti-Nanog (1/1000), Anti-OCT4 (1/1000), Anti-DDX3X (1/1000), Anti-Ki-67 (1/1000), Anti-PCNA (1 µg/ml) and Anti-GAPDH (1/1000). Next, the membranes were subjected to 1 h of incubation with secondary antibodies (Abcam) at room temperature. Lastly, protein bands were visualized using ECL western blotting substrate (Invitrogen). The experiment was performed in triplicate.
Post transfection, CRC cells were plated on the Corning ultra-low attachment plates (Corning, NY) in medium with no serum, added with 20 ng/mL EGF, 20 ng/mL FGF, 4 mg/mL heparin and 2% B27 (Invitrogen) for 14 days of incubation, followed by analysis of the number and size of spheres. The experiment was performed in triplicate.
Subcellular fractionation
Nuclear and cytoplasmic fractions of cells were separated using PARIS kit (Life Technologies, Thermo Fisher Scientific) in the light of supplier’s requirements. The expression level of GATA2-AS1 in nuclear or cytoplasmic fraction was determined by RT-qPCR analysis. In this assay, U6 or GAPDH served as a positive control for nuclear/cytoplasmic fraction. The experiment was done in triplicate.
Fluorescent in situ hybridization (FISH)
To determine the subcellular distribution of GATA2-AS1 in CRC cells, FISH assay was carried out utilizing FISH Tag™ RNA Red Kit (F32952, Invitrogen) as per the user guide. Cells were fixed and washed, followed by incubation with FISH probe specific for GATA2-AS1 (5 μL; RiboBio, Guangzhou, China) in hybridization buffer. Nuclear counterstain was done utilizing DAPI. The slides were observed with a fluorescence microscope. The experiment was done in triplicate.
Actinomycin D (ActD) assay
ActD (Abcam) at a final concentration of 4 μM was used to treat cells. ActD was added to cells at 0 h, 4 h, or 8 h. RT-qPCR was used to quantify mRNA levels. The experiment was done in triplicate.
RNA pull down assay
RNA pull down assay was conducted utilizing Pierce Magnetic RNA–Protein Pull-Down Kit (Thermo Fisher Scientific, Waltham, MA) as per the supplier’s protocols. The protein lysates were mixed with GATA2-AS1 or GATA2-AS1 AS or GATA2 or GATA2 AS, followed by addition of magnetic beads. RNA–protein mixture was analyzed using western blot. The experiment was carried out in triplicate.
RNA-binding protein immunoprecipitation (RIP)
Magna RIP RNA-Binding Protein Immunoprecipitation Kit (Millipore, Bedford, MA) was utilized for RIP conforming to the supplier’s protocols. Cells were subjected to lysis with RIP lysis buffer. Subsequently, cell lysates were subjected to incubation with RIPA buffer containing magnetic beads conjugated with anti-DDX3X antibody or anti-IgG. The RNA extracted from the immunoprecipitates was purified for RT-qPCR analysis. The experiment was implemented in triplicate.
Chromatin immunoprecipitation (ChIP)
ChIP assay was conducted via a ChIP Assay Kit (Beyotime) following the guidelines of the supplier. Cells were cross-linked with 1% PFA for 10 min and then sonicated into 200–1000 bp fragments. Next, chromatin was immunoprecipitated with anti-GATA2 or IgG antibodies, followed by RT-qPCR. Each experiment was independently performed in triplicate.
Luciferase reporter assay
The sequence of GATA2-AS1 promoter was amplified from CRC cells. Then, the fragments of Full length, Site 1-MUT, Site 2-MUT and Site 1 + 2 MUT were inserted into the pGL3 luciferase vector (Promega, Madison, WI) to construct reporter vectors. Then, these vectors were co-transfected with pcDNA3.1/GATA2 or sh-GATA2#1/2 into cells. After 48 h of transfection, luciferase activities were determined using Luciferase Assay Kit (Promega). The experiment was performed in triplicate.
In vivo xenograft experiments
A total of 20 BALB/c nude mice (five-week-old, male) were selected and randomly divided into 4 groups (5 mice for each group), two test groups and two control groups. Each mouse in test groups was injected with stably sh-GATA2-AS1#1-transfected HCT116 or SW480 cells (5 × 106) while same amount of stably sh-NC HCT116 or SW480 cells were injected into each mouse in control groups. We used vernier caliper to measure the volume of xenografts in mice every 4 days. Finally, mice were sacrificed and then tumor tissues were extracted and used for subsequent analyses. Xenografted tumors were weighed by electronic scale. Animal study was approved by the Ethics Committee of the Third Xiangya Hospital of Central South University (2019-S336). Three independent assays were requested.
Immunohistochemical (IHC) assay
IHC staining was performed on 4-μm thick paraffin-embedded sections. Slides were dewaxed and antigen retrieval, and then incubated with primary antibodies (Abcam) including Anti-Ki-67 (0.1–5 µg/mL), Anti-PCNA (1/10,000–1/30,000), Anti-E-cadherin (1/500), Anti-N-cadherin (1 µg/mL), Anti-Nanog (1/100–1/250) and Anti-OCT4 (1/1000) overnight. Afterwards, secondary antibodies (1/200–1/2000, Abcam) were added for incubation at room temperature. Next, DAB Stain Kit (ZSBio, Beijing, China) was treated into slides and then counterstained by DAPI. The experiment was done in triplicate.
Discussion
Previous studies have highlighted the critical role of biological and molecular markers in the diagnosis, prognosis, and treatment of malignant tumors and CRC [
28‐
31]. Here, the present study demonstrated a novel regulation mechanism that GATA2-activated GATA2-AS1 up-regulation facilitates CRC cell proliferation, invasion, EMT and stemness through interaction with RBP DDX3X, which might be helpful to explore new targets for CRC treatment (Additional file
5: Fig. S5).
LncRNAs can modulate the expression of nearby genes to involve in cancer development. As reported previously, MAPKAPK5-AS1 facilitates CRC progression via sponging let-7f-1-3p to cis-regulate its nearby gene MK5 [
32]. TRPM2-AS increases CRC cell proliferation via TRPM2; TRPM2-AS directly interacts with TAF15 protein to maintain the mRNA stability of TRPM2 [
17]. Consistent with these reports, the present study explored the interaction of GATA2-AS1 and its nearby gene GATA2 in CRC. GATA2 has been identified to be high-expressed in CRC and its high expression is associated with recurrence of CRC, which suggests that GATA2 is a useful prognostic indicator of CRC treatment [
33]. In our study, we verified that GATA2-AS1 and GATA2 exhibited high expression levels in CRC cell lines. Functionally, silencing of GATA2-AS1 and GATA2 represses CRC cell proliferation, invasion and stemness and induces cell apoptosis. EMT is an important biological process and plays crucial roles in regulating embryonic development, chronic inflammation, tissue reconstruction as well as tumor metastasis [
34]. During EMT, cells are involved in the loss of epithelial characteristics such as epithelial marker (E-cadherin) and the acquisition of mesenchymal phenotype such as mesenchymal markers (N-cadherin and Vimentin) [
35]. Increasing reports have demonstrated that lncRNAs positively regulate the EMT process in CRC [
36]. Similarly, our study confirmed that depletion of GATA2-AS1 or GATA2 obviously inhibits EMT process in CRC. All above data implied the cancer-promoting role of GATA2-AS1 in CRC, which unveiled that GATA2-AS1 might be a novel target for CRC treatment.
It has been reported that GATA2-AS1 regulates GATA2 to impair non-small cell lung cancer cell proliferation via interacting with GATA1 protein at GATA2 promoter region and then blocks its transcription [
22]. Unlike with that report, our study found that GATA2-AS1 positively regulates GATA2 expression at the post-transcriptional level. In recent years, ceRNA networks generated by lncRNA-miRNA-mRNA interactions have been shown to exert function in various biological processes in CRC [
37,
38]. However, our study found that there was no common miRNA binding with both GATA2-AS1 and GATA2 through database analysis. Thereby, we turned to explore RBP mechanism of GATA2-AS1-mediated regulation in CRC. Previous study has suggested that DDX3X serves as a RBP to regulate the half-life of Zc3h12a mRNA [
39]. In addition, DDX3X has been suggested to exhibit oncogenic function in multiple cancers, such as breast cancer [
40] and glioma [
41]. Of note, DDX3X, highly expressed in CRC, is regarded as a promising therapeutic target for CRC [
42]. In this research, we further validated that GATA2-AS1 interacts with DDX3X to control the stability of GATA2 mRNA regulating its expression.
Moreover, GATA transcription factors are necessary in mammalian cell lineage determination and play a significant role in cancer development [
43]. GATA2 is a member of GATA family and serves as a transcription factor expressed in early progenitor cells; GATA2 is implicated in modulating the fate of hematopoietic stem cells and progenitor cells [
44]. GATA2 interacts with androgen receptor to modulate gene transcription in prostate cancer cells [
45]. In this study, we found that GATA2 combines with GATA2-AS1 promoter to enhance GATA2-AS1 expression. In addition, we validated the oncogenic effect of GATA2-AS1 on tumor growth, EMT and stemness through in vivo experiments. Furthermore, this study further validated that GATA2-AS1 promotes CRC cell proliferation, invasion, EMT and stemness via up-regulating GATA2 expression.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.