Skip to main content
Erschienen in: Journal of Translational Medicine 1/2022

Open Access 01.12.2022 | Research

A feedback loop between GATA2-AS1 and GATA2 promotes colorectal cancer cell proliferation, invasion, epithelial-mesenchymal transition and stemness via recruiting DDX3X

Erschienen in: Journal of Translational Medicine | Ausgabe 1/2022

Abstract

Background

Colorectal cancer (CRC) is a common malignant tumor with a high risk of metastasis. Long non-coding RNAs (lncRNAs) have been reported to be implicated in cancer progression via regulating its nearby gene. Herein, we investigated the function of GATA binding protein 2 (GATA2) and lncRNA GATA2 antisense RNA 1 (GATA2-AS1) in CRC and the mechanism underlying their interaction.

Methods

Colony formation assay, flow cytometry analysis and transwell assay were implemented to detect cell proliferation, apoptosis and invasion. Western blot analysis and sphere formation assay were conducted to assess epithelial-mesenchymal transition (EMT) and cancer stemness of CRC cells. RNA pull down, RNA-binding protein immunoprecipitation (RIP), chromatin immunoprecipitation (ChIP) and luciferase reporter assays were implemented to investigate the regulatory mechanism between GATA2-AS1 and GATA2.

Results

GATA2-AS1 and GATA2 were highly expressed in CRC cells. Knockdown of GATA2-AS1 and GATA2 impeded CRC cell proliferation, invasion, EMT and cancer stemness, and induced cell apoptosis. GATA2-AS1 expression was positively correlated with GATA2. GATA2-AS1 recruited DEAD-box helicase 3 X-linked (DDX3X) to stabilize GATA2 mRNA. GATA2 combined with GATA2-AS1 promoter to enhance GATA2-AS1 expression.

Conclusion

Our study confirmed that a feedback loop between GATA2-AS1 and GATA2 promotes CRC progression, which might offer novel targets for CRC treatment.
Hinweise

Supplementary Information

The online version contains supplementary material available at https://​doi.​org/​10.​1186/​s12967-022-03483-8.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Abkürzungen
lncRNAs
Long non-coding RNAs
CRC
Colorectal cancer
GATA2-AS1
GATA binding protein 2 antisense RNA 1
GATA2
GATA binding protein 2
DDX3X
DEAD-box helicase 3 X-linked
RBPs
RNA-binding proteins
EMT
Epithelial-mesenchymal transition
RT-qPCR
Quantitative real-time polymerase chain reaction
RIP
RNA-binding protein immunoprecipitation
ChIP
Chromatin immunoprecipitation
TUNEL
Terminal-deoxynucleoitidyl Transferase Mediated Nick End labeling
FISH
Fluorescent in situ hybridization
IHC
Immunohistochemical
GAPDH
Glyceraldehyde-3-phosphate dehydrogenase
SD
Standard deviation
EdU
5-Ethynyl-2’-deoxyuridine

Background

Colorectal cancer (CRC) is a common and severe disease which poses a threat to human health [1]. In 2022, there will be approximately 592,232 new cases of CRC in China, 160,248 new cases in the United States and 309,114 deaths from CRC in China, 56,693 deaths in the United States [2]. In patients with early CRC, the five-year survival rate is about 90%. However, this rate declines to < 10% in advanced-stage patients with distant metastases [3]. Great advances have been achieved in early screening and treatment for CRC, but the survival rate of CRC remains unchanged [4]. This disease is associated with low detection efficiency and high death rate due to the lack of symptoms in CRC patients at early stage and metastasis at advanced stage [5]. Metastasis is a process which involves cancer cell invasion, epithelial mesenchymal transition (EMT) and microenvironment changes [6]. Hence, it is vitally important to explore the molecular mechanisms underlying CRC progression.
With the development of next-generation sequencing technologies, long non-coding RNAs (lncRNAs) have been brought into focus [7]. LncRNAs are defined as a type of RNAs longer than 200 nucleotides and incapable of coding proteins [8]. Initially, lncRNA was considered as transcriptional “noise” due to its non-coding characteristic. Nowadays, a growing number of studies have suggested that lncRNA plays a crucial role in a variety of biological processes via regulating gene expression [9]. LncRNAs regulate gene expression in multiple ways: they could impact on transcription by guiding the chromatin-modifying complexes and transcription factors, or by acting as scaffolds of protein–protein interactions; moreover, they could act as microRNA (miRNA) sponges sequestering endogenous miRNAs [10]. Dysregulation of lncRNAs exert tumor-promoting or tumor-suppressing functions to affect the biological processes [11]. Notably, some certain lncRNAs could be considered as potential therapeutic targets or prognostic molecules for cancers [12].
RNA binding proteins (RBPs) are important regulators in many cellular processes including RNA splicing, modifications, localization, stability, degradation as well as translation [13]. They modulate gene expression post-transcriptionally and are implicated in multiple cellular phenotypes [14]. Abnormal expression of RBPs can affect tumorigenesis via controlling RNA or protein homeostasis [15]. Accumulating evidence supports that lncRNAs participate in the development of cancers via interacting with RBPs to mediate the stability of mRNA. A study proposed by Yang Lan and his colleague has manifested that OCC-1 negatively modulates CRC cell growth via destabilization of ELAVL1 protein [16]. Besides, TRPM2-AS facilitates CRC cell proliferation via recruiting TAF15 to regulate the mRNA stability of TRPM2 [17].
Transcription factors are previously defined as “undruggable” targets for the exception of ligand-inducible nuclear receptors [18]. The deeper knowledge of these transcription factors, such as their structure and function including expression, degradation, their ability to interact with co-factors, has changed this hypothesis [19]. Transcription factors are involved in the progression of cancers for their potential oncogenic functions, which paves the way for potential therapies targeted against transcription factors [20].
GATA binding protein 2 (GATA2) and GATA binding protein 2 antisense RNA 1 (GATA2-AS1) have shown to be implicated in tumorigenesis. For instance, GATA2 enhances aggressiveness and resistance to standard therapies against prostate cancer [21]. GATA2-AS1 represses non-small cell lung cancer growth via regulating GATA2 [22]. In this research, we investigated the impacts of GATA2-AS1 and GATA2 on the progression of CRC in vitro and in vivo. Further, we probed into the regulation mechanism between GATA2-AS1 and GATA2 in CRC cells. Our study might provide promising targets for CRC treatment.

Methods

Cell lines

CRC cell lines used in this research included DiFi, SW620, DLD-1, HT-29, SW480 and HCT116. DiFi cell line and human normal colonic epithelial cells (HCoEpiC) were supplied by Shanghai Qincheng Biological Technology Co., Ltd. (Shanghai, China); the others were provided by ATCC (Manassas, VA). SW620 and SW480 cell lines were maintained in Leibovitz's L-15 Medium, HT-29 and HCT116 cell lines in McCoy's 5A Medium, and DiFi, DLD-1 and HCoEpiC cells in RPMI-1640 Medium. SW620, HT-29, HCT116 and DLD-1 cells were cultured in the medium containing 10% FBS with the supplementation of 1% penicillin/streptomycin in a humid incubator at 37 °C with 5% CO2.

Quantitative real-time polymerase chain reaction (RT-qPCR)

TRIzol Reagent (Invitrogen; Carlsbad, CA) was used for RNA isolation. Then, the extracted RNA was subjected to reverse transcription for cDNA synthesis using PrimeScript RT Reagent Kit (Takara Bio, Japan). SYBR® Premix Ex Taq™ II (Takara Bio) was used for qPCR. Meanwhile, GAPDH was used as endogenous control. The calculation of gene expression level was based on the 2−∆∆Ct method [23] and experimental data were displayed as mean ± standard deviation (SD). The experiment was repeated three times. Primer sequences were reported in Table 1.
Table 1
Primer sequences
Gene
primer sequence
GATA2-AS1
F:CCGGGCAGCTTACGATTCTT
R:GCGGTGTCTTTCAGAGGGTC
GATA2
F:AGTCTGTCTATTGCCTGCCGC
R: TGCAGACGGCAACGGC
GATA2-AS1 promoter
F:CAACGGGCCCAATTGCC
R:ACACGAACCATAGAGCCGAT
F: forward primer; reverse primer

Cell transfection

For stably silencing GATA2-AS1, GATA2 or DDX3X expression, the specific short hairpin RNAs (shRNAs) to GATA2-AS1 or GATA2 or DDX3X and shRNA of negative control (sh-NC) were designed and supplied by GenePharma (Shanghai, China). The full-length cDNA sequence of GATA2 was inserted into the pcDNA3.1 vectors (Invitrogen), using empty vectors as control. These vectors were transfected into cells for 48 h using Lipofectamine 3000 (Invitrogen).

Colony formation assay

CRC cells (600 cells each well) were plated in 6-well plates and incubated for 12 days at 37 °C. Subsequently, cells were washed with phosphate buffered saline (PBS), and fixed by 4% paraformaldehyde for 15 min, followed by staining with 0.5% violet crystal for 10 min and colony counting by the manual method. The experiment was performed in triplicate.

5-Ethynyl-2’-deoxyuridine (EdU)

CRC cells were plated in 24-well plates. We added 10 μM EdU into each well for incubation. Then, cells were fixed, washed, and added with Click-iT EdU Kit. DAPI was used for nuclear counterstain. Images were observed using a fluorescence microscope (Olympus). The experiment was carried out in triplicate.

Flow cytometry analysis

Flow cytometry analysis was done for measuring the apoptosis of CRC cells. Transfected cells were collected, washed and then re-suspended in binding buffer (50 mL). Next, cell suspensions were added with staining solution containing Annexin V-FITC (1/500, BioVision, Milpitas, CA) and PI (1/500, Beyotime), followed by analysis utilizing a BD Biosciences FACSCalibur™ Flow Cytometer (San Diego, CA). The experiment was performed in triplicate.

Terminal-deoxynucleoitidyl transferase mediated nick end labeling (TUNEL)

Transfected cells were washed, fixed and then permeabilized, followed by TUNEL assays utilizing In Situ Cell Death Detection Kit (Roche) based on the supplier’s protocols. Briefly, cells were incubated in terminal dexynucleotidyl transferase (TdT) reaction cocktail (2 μL), and then treated with Click-iT reaction cocktail (50 μL). DAPI (1/2000) was used to counterstain the nuclei. The experiment was performed in triplicate.
Besides, apoptosis of mouse xenografts was evaluated by tissue TUNEL assay, which was performed as per the instructions for the TUNEL assay kit (KeyGen, Nanjing, China).

Transwell invasion assay

Cells (2 × 105) were put into the upper chamber using an 8-mm pore size of transwell coated with Matrigel (50 μg/well, BD Biosciences). The medium with no serum was supplemented to the upper chamber. Complete medium (500 μL) with 20% FBS was utilized to treat the lower chamber. Subsequent to 24 h of incubation, we slightly wiped the cells on the surface of the upper membrane. The invaded cells into the lower chamber were subjected to 10-min fixation in 4% paraformaldehyde (PFA) and 30-min staining by crystal violet (500 μL). The invaded cells in 5 randomly selected fields were observed and imaged using an inverted microscope. The experiment was performed in triplicate.

Western blot

Proteins were extracted utilizing RIPA lysis buffer (Thermo Fisher Scientific) and quantified by a BCA Protein Assay Kit (Abcam, Cambridge, MA). Subsequently, 1% SDS-PAGE was utilized for protein separation. Then, protein samples were transferred onto PVDF membranes (Millipore), which were sealed with 5% defatted milk in TBST, followed by overnight incubation with primary antibodies (Abcam) at 4 °C. In this assay, we used primary antibodies as follows: Anti-GATA2 (1/1000), Anti-E-cadherin (1/1000), Anti-N-cadherin (1/1000), Anti-Vimentin (1/1000), Anti-Nanog (1/1000), Anti-OCT4 (1/1000), Anti-DDX3X (1/1000), Anti-Ki-67 (1/1000), Anti-PCNA (1 µg/ml) and Anti-GAPDH (1/1000). Next, the membranes were subjected to 1 h of incubation with secondary antibodies (Abcam) at room temperature. Lastly, protein bands were visualized using ECL western blotting substrate (Invitrogen). The experiment was performed in triplicate.

Sphere formation

Post transfection, CRC cells were plated on the Corning ultra-low attachment plates (Corning, NY) in medium with no serum, added with 20 ng/mL EGF, 20 ng/mL FGF, 4 mg/mL heparin and 2% B27 (Invitrogen) for 14 days of incubation, followed by analysis of the number and size of spheres. The experiment was performed in triplicate.

Subcellular fractionation

Nuclear and cytoplasmic fractions of cells were separated using PARIS kit (Life Technologies, Thermo Fisher Scientific) in the light of supplier’s requirements. The expression level of GATA2-AS1 in nuclear or cytoplasmic fraction was determined by RT-qPCR analysis. In this assay, U6 or GAPDH served as a positive control for nuclear/cytoplasmic fraction. The experiment was done in triplicate.

Fluorescent in situ hybridization (FISH)

To determine the subcellular distribution of GATA2-AS1 in CRC cells, FISH assay was carried out utilizing FISH Tag™ RNA Red Kit (F32952, Invitrogen) as per the user guide. Cells were fixed and washed, followed by incubation with FISH probe specific for GATA2-AS1 (5 μL; RiboBio, Guangzhou, China) in hybridization buffer. Nuclear counterstain was done utilizing DAPI. The slides were observed with a fluorescence microscope. The experiment was done in triplicate.

Actinomycin D (ActD) assay

ActD (Abcam) at a final concentration of 4 μM was used to treat cells. ActD was added to cells at 0 h, 4 h, or 8 h. RT-qPCR was used to quantify mRNA levels. The experiment was done in triplicate.

RNA pull down assay

RNA pull down assay was conducted utilizing Pierce Magnetic RNA–Protein Pull-Down Kit (Thermo Fisher Scientific, Waltham, MA) as per the supplier’s protocols. The protein lysates were mixed with GATA2-AS1 or GATA2-AS1 AS or GATA2 or GATA2 AS, followed by addition of magnetic beads. RNA–protein mixture was analyzed using western blot. The experiment was carried out in triplicate.

RNA-binding protein immunoprecipitation (RIP)

Magna RIP RNA-Binding Protein Immunoprecipitation Kit (Millipore, Bedford, MA) was utilized for RIP conforming to the supplier’s protocols. Cells were subjected to lysis with RIP lysis buffer. Subsequently, cell lysates were subjected to incubation with RIPA buffer containing magnetic beads conjugated with anti-DDX3X antibody or anti-IgG. The RNA extracted from the immunoprecipitates was purified for RT-qPCR analysis. The experiment was implemented in triplicate.

Chromatin immunoprecipitation (ChIP)

ChIP assay was conducted via a ChIP Assay Kit (Beyotime) following the guidelines of the supplier. Cells were cross-linked with 1% PFA for 10 min and then sonicated into 200–1000 bp fragments. Next, chromatin was immunoprecipitated with anti-GATA2 or IgG antibodies, followed by RT-qPCR. Each experiment was independently performed in triplicate.

Luciferase reporter assay

The sequence of GATA2-AS1 promoter was amplified from CRC cells. Then, the fragments of Full length, Site 1-MUT, Site 2-MUT and Site 1 + 2 MUT were inserted into the pGL3 luciferase vector (Promega, Madison, WI) to construct reporter vectors. Then, these vectors were co-transfected with pcDNA3.1/GATA2 or sh-GATA2#1/2 into cells. After 48 h of transfection, luciferase activities were determined using Luciferase Assay Kit (Promega). The experiment was performed in triplicate.

In vivo xenograft experiments

A total of 20 BALB/c nude mice (five-week-old, male) were selected and randomly divided into 4 groups (5 mice for each group), two test groups and two control groups. Each mouse in test groups was injected with stably sh-GATA2-AS1#1-transfected HCT116 or SW480 cells (5 × 106) while same amount of stably sh-NC HCT116 or SW480 cells were injected into each mouse in control groups. We used vernier caliper to measure the volume of xenografts in mice every 4 days. Finally, mice were sacrificed and then tumor tissues were extracted and used for subsequent analyses. Xenografted tumors were weighed by electronic scale. Animal study was approved by the Ethics Committee of the Third Xiangya Hospital of Central South University (2019-S336). Three independent assays were requested.

Immunohistochemical (IHC) assay

IHC staining was performed on 4-μm thick paraffin-embedded sections. Slides were dewaxed and antigen retrieval, and then incubated with primary antibodies (Abcam) including Anti-Ki-67 (0.1–5 µg/mL), Anti-PCNA (1/10,000–1/30,000), Anti-E-cadherin (1/500), Anti-N-cadherin (1 µg/mL), Anti-Nanog (1/100–1/250) and Anti-OCT4 (1/1000) overnight. Afterwards, secondary antibodies (1/200–1/2000, Abcam) were added for incubation at room temperature. Next, DAB Stain Kit (ZSBio, Beijing, China) was treated into slides and then counterstained by DAPI. The experiment was done in triplicate.

Bioinformatics analysis

GEPIA (http://​gepia2.​cancer-pku.​cn) was used to analyze GATA2-AS1 expression in colon adenocarcinoma (COAD) samples (n = 275) and normal samples (n = 349). RNA-seq of GATA2-AS1 in 27 different normal tissues was analyzed by NCBI database (https://​www.​ncbi.​nlm.​nih.​gov). Potential miRNAs of either GATA2-AS1 or GATA2 were predicted by ENCORI (https://​rna.​sysu.​edu.​cn/​encori/​). In addition, UCSC database (http://​genome.​ucsc.​edu/​) was used to predict transcription factors of GATA2-AS1. JASPAR (http://​jaspar.​genereg.​net/​) was used to predict GATA2-binding sites on the sequence of GATA2-AS1 promoter.

Statistical analysis

The data were presented as mean ± SD for three independent experiments. GraphPad PRISM 6 was used for statistical analysis. Student’s t-test or analysis of variance (ANOVA) was used for comparison of group differences; Dunnett’s test or Tukey’s test was used following the ANOVA. P value < 0.05 was considered as statistical significance.

Results

GATA2-AS1 and GATA2 are highly expressed in CRC cells

To explore the expression profile of GATA2-AS1 in CRC, we used GEPIA2 (http://​gepia2.​cancer-pku.​cn) to analyze GATA2-AS1 expression in colon adenocarcinoma (COAD). Relative to 349 cases of normal tissues, GATA2-AS1 was significantly highly expressed in 275 cases of COAD tissues (Fig. 1A). GATA2-AS1 was lowexpressed in normal colon tissues according to the NCBI database (https://​www.​ncbi.​nlm.​nih.​gov) (Additional file 1: Fig. S1). The above data confirmed the aberrant elevation of GATA2-AS1 expression in CRC tissues. Moreover, RT-qPCR suggested that GATA2-AS1 expression was markedly increased in six CRC cell lines relative to that in human normal HCoEpiC (Fig. 1B). Intriguingly, we found that the expression of GATA2, nearby gene of GATA2-AS1, was also apparently elevated in CRC cell lines versus that in normal cell line (Fig. 1C). In particular, SW480 and HCT116 cell lines exhibited a relatively higher expression of GATA2-AS1 and GATA2 than other CRC cells did, so they were selected for follow-up experiments.
Besides, it has been suggested that some lncRNAs could modulate the expression of nearby genes [24]. Then, we investigated the regulatory relationship of GATA2-AS1 and GATA2 in CRC cells. Before that, two specific shRNAs for GATA2-AS1 were transfected into SW480 and HCT116 cells to silence GATA2-AS1 expression (Additional file 2: Fig. S2A). GATA2 mRNA and protein levels were overtly reduced when GATA2-AS1 was knocked down (Fig. 1D). Likewise, we also silenced GATA2 expression via transfection of sh-GATA2 plasmids (Additional file 2: Fig. S2B). It was found that GATA2 depletion obviously decreased the expression of GATA2-AS1 (Fig. 1E). These results suggested that GATA2-AS1 and GATA2 are expressed in CRC cells at high level and that their both expression is tightly regulated.

GATA2-AS1 and GATA2 promote CRC cell proliferation while represses cell apoptosis

Next, we explored the impact of GATA2-AS1 or GATA2 on CRC cell proliferation and apoptosis. It was found that deficiency of GATA2-AS1 or GATA2 markedly hampered the proliferation capacity of CRC cells (Fig. 2A, B). The apoptosis of CRC cells was elevated in GATA2-AS1-silenced or GATA2-silenced SW480 and HCT116 cells (Fig. 2C, D). Altogether, both GATA2-AS1 and GATA2 promote CRC cell proliferation and repress cell apoptosis.

GATA2-AS1 and GATA2 promote CRC cell invasion, EMT and stemness

Moreover, we investigated the impacts of GATA2-AS1 and GATA2 on CRC cell invasion, EMT and stemness. Transwell assays showed that the number of invading cells was obviously reduced after the depletion of GATA2-AS1 or GATA2 (Fig. 3A). Besides, we analyzed the protein levels of EMT markers in GATA2-AS1-inhibited or GATA2-inhibited SW480 and HCT116 cells via western blot. Down-regulation of GATA2-AS1 or GATA2 led to an obvious elevation in the protein level of epithelial marker (E-cadherin) and a distinct reduction in those of mesenchymal markers (N-cadherin and Vimentin) (Fig. 3B). In addition, the data from western blot analysis and sphere formation assay disclosed that the protein levels of stem cell markers (Nanog and OCT4) and the number and size of spheres were overtly reduced after GATA2-AS1 or GATA2 knockdown (Fig. 3C, D). All above data indicated that GATA2-AS1 and GATA2 promote CRC cell invasion, EMT and stemness.

GATA2-AS1 recruits DDX3X to control the stability of GATA2 mRNA

Furthermore, we investigated the regulatory mechanism between GATA2-AS1 and GATA2. The subcellular distribution of lncRNA is associated with its mechanism [25]. GATA2-AS1 was verified to be primarily localized in the cytoplasm of CRC cells (Fig. 4A, B), which implied the potential of GATA2-AS1 to post-transcriptionally regulate GATA2 expression. Notably, competing endogenous RNA (ceRNA) is a common post-transcriptional regulation mechanism functioning in the development of cancers [26]. Given that, we next explored miRNAs binding with GATA2-AS1 or GATA2; potential miRNAs were predicted by ENCORI (https://​rna.​sysu.​edu.​cn/​encori/​). However, there was no appropriate miRNA binding to both GATA2-AS1 and GATA2 (Additional file 2: Fig. S2C), which excluded ceRNA regulation mechanism. Subsequently, ActD was used to inhibit protein synthesis in the analysis of GATA2 mRNA stability. The results showed that GATA2-AS1 silencing obviously decreased GATA2 mRNA level in ActD-treated CRC cells (Fig. 4C). LncRNAs could recruit some proteins to stabilize mRNA [27]. Hence we carried out RNA pull down assay to explore potential RBPs of GATA2-AS1. A ~ 73 kDa protein was pulled down by GATA2-AS1 and identified as DDX3X via mass spectrometry (Fig. 4D). RNA pull down and RIP assays further confirmed the interaction between GATA2-AS1 and DDX3X (Fig. 4E, F). Also, it was found that DDX3X protein was pulled down by GATA2 (Fig. 4G); GATA2 was highly enriched in anti-DDX3X bound precipitates (Fig. 4H), indicating the binding between GATA2 and DDX3X. We next investigated the impact of DDX3X on the stability of GATA2 mRNA in CRC cells. We silenced the expression of DDX3X by transfection of sh-DDX3X#1/2 (Additional file 2: Fig. S2D). GATA2 mRNA and protein levels were significantly reduced after DDX3X depletion (Fig. 4I). Therefore, we hypothesized whether GATA2-AS1 regulates DDX3X to affect the expression of GATA2. GATA2-AS1 deletion had no marked effect on DDX3X expression at mRNA and protein levels (Additional file 2: Fig. S2E, F). Whereupon, we speculated that GATA2-AS1 might recruit DDX3X to regulate the stability of GATA2. GATA2 mRNA level was significantly decreased in ActD-treated cells after DDX3X silencing (Fig. 4J), indicating that DDX3X promotes the stability of GATA2 mRNA. All these data revealed that GATA2-AS1 recruits DDX3X to regulate the stability of GATA2 mRNA, affecting the expression of GATA2.

GATA2 transcriptionally activates GATA2-AS1 expression

Based on the analysis of UCSC database (http://​genome.​ucsc.​edu/​), we obtained a list of putative transcription factors of GATA2-AS1 (Additional file 3: Fig. S3). Notably, GATA2 was one of the listed transcription factors. Thereby, we probed into the impact of GATA2 as a transcription factor on GATA2-AS1 expression at the transcriptional level. GATA2 was successfully overexpressed via transfection of pcDNA3.1/GATA2 (Fig. 5A). RT-qPCR showed that GATA2-AS1 expression was obviously elevated when GATA2 was overexpressed (Fig. 5B). With the help of JASPAR (http://​jaspar.​genereg.​net/​), we found two potential GATA2-binding sites on the sequence of GATA2-AS1 promoter (Fig. 5C, D). Site 1 or/and Site 2 mutations were performed for subsequent luciferase reporter assays. The luciferase activity of full length GATA2-AS1 promoter (Full length) or mutant GATA2-AS1 promoter (Site 1-MUT and Site 2-MUT) was significantly enhanced by GATA2 overexpression, while that of mutant GATA2-AS1 promoter (Site 1 + 2-MUT) was barely affected (Fig. 5E). Also, GATA2 silencing caused a decrease in the luciferase activity of GATA2-AS1 promoter (Full length) and mutant GATA2-AS1 promoter (Site 1-MUT and Site 2-MUT), but caused no marked change in that of mutant one (Site 1 + 2-MUT) (Fig. 5F). The above data indicated that both Site 1 and Site 2 are GATA2-binding sites in GATA2-AS1 promoter. Additionally, ChIP assay further confirmed the binding between GATA2-AS1 promoter and GATA2, as GATA2-AS1 promoter was overtly abundant in anti-GATA2 bound precipitates (Fig. 5G, H). Taken together, GATA2 transcriptionally activates GATA2-AS1 expression.

GATA2-AS1 affects CRC cell proliferation and apoptosis via regulating GATA2 expression

Besides in vitro assays, we established xenograft tumor models to verify the role of GATA2-AS1 in CRC tumorigenesis. Stably sh-GATA2-AS1#1 or sh-NC transfected CRC cells were subcutaneously injected into nude mice to construct mouse xenograft models. The tumor volume and tumor weight were significantly declined when GATA2-AS1 was knocked down (Fig. 6A, B; Additional file 4: Fig. S4A, B). Besides, IHC staining revealed that the expression of proliferative markers (Ki-67 and PCNA) was significantly inhibited in sh-GATA2-AS1#1 group compared to sh-NC group; TUNEL staining revealed that GATA2-AS1 inhibition promotes the apoptosis of xenograft tumors (Fig. 6C; Additional file 4: Fig. S4C). Moreover, the RNA levels of GATA2-AS1 and GATA2 were decreased in GATA2-AS1-inhibited group; the protein levels of GATA2, Ki-67 and PCNA were reduced when GATA2-AS1 was silenced (Fig. 6D; Additional file 4: Fig. S4D). Meanwhile, EMT and stemness were also repressed when GATA2-AS1 was knocked down (Fig. 6E; Additional file 4: Fig. S4E). All these data suggested that knockdown of GATA2-AS1 inhibits tumor growth, EMT and stemness in CRC.
Additionally, we performed rescue experiments to validate the impact of GATA2-AS1-GATA2 interaction on CRC cell proliferation and apoptosis. GATA2 overexpression reversed the inhibited proliferation ability of GATA2-AS1-silenced CRC cells (Fig. 6F, G). Besides, the increased apoptosis caused by GATA2-AS1 depletion was counteracted by GATA2 overexpression (Fig. 6H, I). In sum, GATA2-AS1 regulates CRC cell proliferation and apoptosis through the modulation of GATA2 expression.

GATA2-AS1 facilitates CRC cell invasion, EMT and stemness via modulating GATA2 expression

Moreover, we conducted rescue experiments to verify the impacts of GATA2-AS1-GATA2 interaction on CRC cell invasion, EMT and stemness. As evidenced by transwell assays, GATA2 overexpression countervailed the repression of GATA2-AS1 depletion on CRC cell migration (Fig. 7A). Western blot revealed that the inhibition of GATA2-AS1 silencing on EMT was offset by GATA2 overexpression (Fig. 7B). In addition, the declined protein levels of Nanog and OCT4 and the reduced number and size of spheres in GATA2-AS1-silenced CRC cells were altered by up-regulation of GATA2 (Fig. 7C, D). Collectively, GATA2-AS1 facilitates CRC cell migration, EMT and stemness via up-regulating GATA2 expression.

Discussion

Previous studies have highlighted the critical role of biological and molecular markers in the diagnosis, prognosis, and treatment of malignant tumors and CRC [2831]. Here, the present study demonstrated a novel regulation mechanism that GATA2-activated GATA2-AS1 up-regulation facilitates CRC cell proliferation, invasion, EMT and stemness through interaction with RBP DDX3X, which might be helpful to explore new targets for CRC treatment (Additional file 5: Fig. S5).
LncRNAs can modulate the expression of nearby genes to involve in cancer development. As reported previously, MAPKAPK5-AS1 facilitates CRC progression via sponging let-7f-1-3p to cis-regulate its nearby gene MK5 [32]. TRPM2-AS increases CRC cell proliferation via TRPM2; TRPM2-AS directly interacts with TAF15 protein to maintain the mRNA stability of TRPM2 [17]. Consistent with these reports, the present study explored the interaction of GATA2-AS1 and its nearby gene GATA2 in CRC. GATA2 has been identified to be high-expressed in CRC and its high expression is associated with recurrence of CRC, which suggests that GATA2 is a useful prognostic indicator of CRC treatment [33]. In our study, we verified that GATA2-AS1 and GATA2 exhibited high expression levels in CRC cell lines. Functionally, silencing of GATA2-AS1 and GATA2 represses CRC cell proliferation, invasion and stemness and induces cell apoptosis. EMT is an important biological process and plays crucial roles in regulating embryonic development, chronic inflammation, tissue reconstruction as well as tumor metastasis [34]. During EMT, cells are involved in the loss of epithelial characteristics such as epithelial marker (E-cadherin) and the acquisition of mesenchymal phenotype such as mesenchymal markers (N-cadherin and Vimentin) [35]. Increasing reports have demonstrated that lncRNAs positively regulate the EMT process in CRC [36]. Similarly, our study confirmed that depletion of GATA2-AS1 or GATA2 obviously inhibits EMT process in CRC. All above data implied the cancer-promoting role of GATA2-AS1 in CRC, which unveiled that GATA2-AS1 might be a novel target for CRC treatment.
It has been reported that GATA2-AS1 regulates GATA2 to impair non-small cell lung cancer cell proliferation via interacting with GATA1 protein at GATA2 promoter region and then blocks its transcription [22]. Unlike with that report, our study found that GATA2-AS1 positively regulates GATA2 expression at the post-transcriptional level. In recent years, ceRNA networks generated by lncRNA-miRNA-mRNA interactions have been shown to exert function in various biological processes in CRC [37, 38]. However, our study found that there was no common miRNA binding with both GATA2-AS1 and GATA2 through database analysis. Thereby, we turned to explore RBP mechanism of GATA2-AS1-mediated regulation in CRC. Previous study has suggested that DDX3X serves as a RBP to regulate the half-life of Zc3h12a mRNA [39]. In addition, DDX3X has been suggested to exhibit oncogenic function in multiple cancers, such as breast cancer [40] and glioma [41]. Of note, DDX3X, highly expressed in CRC, is regarded as a promising therapeutic target for CRC [42]. In this research, we further validated that GATA2-AS1 interacts with DDX3X to control the stability of GATA2 mRNA regulating its expression.
Moreover, GATA transcription factors are necessary in mammalian cell lineage determination and play a significant role in cancer development [43]. GATA2 is a member of GATA family and serves as a transcription factor expressed in early progenitor cells; GATA2 is implicated in modulating the fate of hematopoietic stem cells and progenitor cells [44]. GATA2 interacts with androgen receptor to modulate gene transcription in prostate cancer cells [45]. In this study, we found that GATA2 combines with GATA2-AS1 promoter to enhance GATA2-AS1 expression. In addition, we validated the oncogenic effect of GATA2-AS1 on tumor growth, EMT and stemness through in vivo experiments. Furthermore, this study further validated that GATA2-AS1 promotes CRC cell proliferation, invasion, EMT and stemness via up-regulating GATA2 expression.

Conclusion

In conclusion, our study identifies a feedback loop between GATA2-AS1 and GATA2. GATA2 is able to interact with the promoter of GATA2-AS1 inducing its expression. In turn, GATA2-AS1 recruits DDX3X on the 3’UTR of GATA2 regulating its expression post-transcriptionally. This mechanism promotes the progression of CRC, controlling proliferation, invasion, EMT processes and stemness, and might supply a novel sight for CRC treatment. Intriguingly, GATA2 is a downstream transcription factor of the p38 and JNK pathways in CRC [46], and our study will further investigate the interaction of GATA2 and signaling pathways.

Acknowledgements

Thank you for all your assistance.

Declarations

The ethics committee is the Third Xiangya Hospital of Central South University.
Not applicable.

Competing interests

The authors declare that they have no competing interests.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://​creativecommons.​org/​licenses/​by/​4.​0/​. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Literatur
2.
Zurück zum Zitat Xia C, Dong X, Li H, Cao M, Sun D, He S, Yang F, Yan X, Zhang S, Li N, Chen W. Cancer statistics in China and United States, 2022: profiles, trends, and determinants. Chin Med J. 2022;135:584–90.PubMedPubMedCentralCrossRef Xia C, Dong X, Li H, Cao M, Sun D, He S, Yang F, Yan X, Zhang S, Li N, Chen W. Cancer statistics in China and United States, 2022: profiles, trends, and determinants. Chin Med J. 2022;135:584–90.PubMedPubMedCentralCrossRef
3.
Zurück zum Zitat He J, Wu F, Han Z, Hu M, Lin W, Li Y, Cao M. Biomarkers (mRNAs and Non-Coding RNAs) for the diagnosis and prognosis of colorectal cancer-from the body fluid to tissue level. Front Oncol. 2021;11:632834.PubMedPubMedCentralCrossRef He J, Wu F, Han Z, Hu M, Lin W, Li Y, Cao M. Biomarkers (mRNAs and Non-Coding RNAs) for the diagnosis and prognosis of colorectal cancer-from the body fluid to tissue level. Front Oncol. 2021;11:632834.PubMedPubMedCentralCrossRef
4.
Zurück zum Zitat Favoriti P, Carbone G, Greco M, Pirozzi F, Pirozzi RE, Corcione F. Worldwide burden of colorectal cancer: a review. Updates Surg. 2016;68:7–11.PubMedCrossRef Favoriti P, Carbone G, Greco M, Pirozzi F, Pirozzi RE, Corcione F. Worldwide burden of colorectal cancer: a review. Updates Surg. 2016;68:7–11.PubMedCrossRef
5.
Zurück zum Zitat Xiao Y, Zhong J, Zhong B, Huang J, Jiang L, Jiang Y, Yuan J, Sun J, Dai L, Yang C, et al. Exosomes as potential sources of biomarkers in colorectal cancer. Cancer Lett. 2020;476:13–22.PubMedCrossRef Xiao Y, Zhong J, Zhong B, Huang J, Jiang L, Jiang Y, Yuan J, Sun J, Dai L, Yang C, et al. Exosomes as potential sources of biomarkers in colorectal cancer. Cancer Lett. 2020;476:13–22.PubMedCrossRef
6.
Zurück zum Zitat Cao H, Xu E, Liu H, Wan L, Lai M. Epithelial-mesenchymal transition in colorectal cancer metastasis: A system review. Pathol Res Pract. 2015;211:557–69.PubMedCrossRef Cao H, Xu E, Liu H, Wan L, Lai M. Epithelial-mesenchymal transition in colorectal cancer metastasis: A system review. Pathol Res Pract. 2015;211:557–69.PubMedCrossRef
7.
Zurück zum Zitat Qian X, Zhao J, Yeung PY, Zhang QC, Kwok CK. Revealing lncRNA structures and interactions by sequencing-based approaches. Trends Biochem Sci. 2019;44:33–52.PubMedCrossRef Qian X, Zhao J, Yeung PY, Zhang QC, Kwok CK. Revealing lncRNA structures and interactions by sequencing-based approaches. Trends Biochem Sci. 2019;44:33–52.PubMedCrossRef
9.
Zurück zum Zitat Jathar S, Kumar V, Srivastava J, Tripathi V. Technological developments in lncRNA biology. Adv Exp Med Biol. 2017;1008:283–323.PubMedCrossRef Jathar S, Kumar V, Srivastava J, Tripathi V. Technological developments in lncRNA biology. Adv Exp Med Biol. 2017;1008:283–323.PubMedCrossRef
11.
Zurück zum Zitat Xu Y, Zhang X, Hu X, Zhou W, Zhang P, Zhang J, Yang S, Liu Y. The effects of lncRNA MALAT1 on proliferation, invasion and migration in colorectal cancer through regulating SOX9. Mol Med. 2018;24:52.PubMedPubMedCentralCrossRef Xu Y, Zhang X, Hu X, Zhou W, Zhang P, Zhang J, Yang S, Liu Y. The effects of lncRNA MALAT1 on proliferation, invasion and migration in colorectal cancer through regulating SOX9. Mol Med. 2018;24:52.PubMedPubMedCentralCrossRef
12.
Zurück zum Zitat Wang L, Cho KB, Li Y, Tao G, Xie Z, Guo B. Long noncoding RNA (lncRNA)-mediated competing endogenous RNA networks provide novel potential biomarkers and therapeutic targets for colorectal cancer. Int J Mol Sci. 2019;20:5758.PubMedCentralCrossRef Wang L, Cho KB, Li Y, Tao G, Xie Z, Guo B. Long noncoding RNA (lncRNA)-mediated competing endogenous RNA networks provide novel potential biomarkers and therapeutic targets for colorectal cancer. Int J Mol Sci. 2019;20:5758.PubMedCentralCrossRef
13.
14.
Zurück zum Zitat Köster T, Marondedze C, Meyer K, Staiger D. RNA-binding proteins revisited-the emerging arabidopsis mRNA interactome. Trends Plant Sci. 2017;22:512–26.PubMedCrossRef Köster T, Marondedze C, Meyer K, Staiger D. RNA-binding proteins revisited-the emerging arabidopsis mRNA interactome. Trends Plant Sci. 2017;22:512–26.PubMedCrossRef
15.
Zurück zum Zitat Pereira B, Billaud M, Almeida R. RNA-binding proteins in cancer: old players and new actors. Trends Cancer. 2017;3:506–28.PubMedCrossRef Pereira B, Billaud M, Almeida R. RNA-binding proteins in cancer: old players and new actors. Trends Cancer. 2017;3:506–28.PubMedCrossRef
16.
Zurück zum Zitat Lan Y, Xiao X, He Z, Luo Y, Wu C, Li L, Song X. Long noncoding RNA OCC-1 suppresses cell growth through destabilizing HuR protein in colorectal cancer. Nucleic Acids Res. 2018;46:5809–21.PubMedPubMedCentralCrossRef Lan Y, Xiao X, He Z, Luo Y, Wu C, Li L, Song X. Long noncoding RNA OCC-1 suppresses cell growth through destabilizing HuR protein in colorectal cancer. Nucleic Acids Res. 2018;46:5809–21.PubMedPubMedCentralCrossRef
17.
Zurück zum Zitat Pan L, Li Y, Jin L, Li J, Xu A. TRPM2-AS promotes cancer cell proliferation through control of TAF15. Int J Biochem Cell Biol. 2020;120:105683.PubMedCrossRef Pan L, Li Y, Jin L, Li J, Xu A. TRPM2-AS promotes cancer cell proliferation through control of TAF15. Int J Biochem Cell Biol. 2020;120:105683.PubMedCrossRef
18.
Zurück zum Zitat Lambert SA, Jolma A, Campitelli LF, Das PK, Yin Y, Albu M, Chen X, Taipale J, Hughes TR, Weirauch MT. The human transcription factors. Cell. 2018;172:650–65.PubMedCrossRef Lambert SA, Jolma A, Campitelli LF, Das PK, Yin Y, Albu M, Chen X, Taipale J, Hughes TR, Weirauch MT. The human transcription factors. Cell. 2018;172:650–65.PubMedCrossRef
19.
Zurück zum Zitat Huilgol D, Venkataramani P, Nandi S, Bhattacharjee S. Transcription factors that govern development and disease: an achilles heel in cancer. Genes. 2019;10:794.PubMedCentralCrossRef Huilgol D, Venkataramani P, Nandi S, Bhattacharjee S. Transcription factors that govern development and disease: an achilles heel in cancer. Genes. 2019;10:794.PubMedCentralCrossRef
20.
Zurück zum Zitat Vaquerizas JM, Kummerfeld SK, Teichmann SA, Luscombe NM. A census of human transcription factors: function, expression and evolution. Nat Rev Genet. 2009;10:252–63.PubMedCrossRef Vaquerizas JM, Kummerfeld SK, Teichmann SA, Luscombe NM. A census of human transcription factors: function, expression and evolution. Nat Rev Genet. 2009;10:252–63.PubMedCrossRef
21.
Zurück zum Zitat Rodriguez-Bravo V, Carceles-Cordon M, Hoshida Y, Cordon-Cardo C, Galsky MD, Domingo-Domenech J. The role of GATA2 in lethal prostate cancer aggressiveness. Nat Rev Urol. 2017;14:38–48.PubMedCrossRef Rodriguez-Bravo V, Carceles-Cordon M, Hoshida Y, Cordon-Cardo C, Galsky MD, Domingo-Domenech J. The role of GATA2 in lethal prostate cancer aggressiveness. Nat Rev Urol. 2017;14:38–48.PubMedCrossRef
22.
Zurück zum Zitat Zhang L, Gao L, Shao M, Sun GY. A MYC target long non-coding RNA GATA2-AS1 regulates non-small cell lung cancer growth. Neoplasma. 2019;66:954–62.PubMedCrossRef Zhang L, Gao L, Shao M, Sun GY. A MYC target long non-coding RNA GATA2-AS1 regulates non-small cell lung cancer growth. Neoplasma. 2019;66:954–62.PubMedCrossRef
23.
Zurück zum Zitat Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25:402–8.PubMedCrossRef Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25:402–8.PubMedCrossRef
24.
Zurück zum Zitat Engreitz JM, Haines JE, Perez EM, Munson G, Chen J, Kane M, McDonel PE, Guttman M, Lander ES. Local regulation of gene expression by lncRNA promoters, transcription and splicing. Nature. 2016;539:452–5.PubMedPubMedCentralCrossRef Engreitz JM, Haines JE, Perez EM, Munson G, Chen J, Kane M, McDonel PE, Guttman M, Lander ES. Local regulation of gene expression by lncRNA promoters, transcription and splicing. Nature. 2016;539:452–5.PubMedPubMedCentralCrossRef
25.
Zurück zum Zitat Chen LL. Linking long noncoding RNA localization and function. Trends Biochem Sci. 2016;41:761–72.PubMedCrossRef Chen LL. Linking long noncoding RNA localization and function. Trends Biochem Sci. 2016;41:761–72.PubMedCrossRef
26.
Zurück zum Zitat Smillie CL, Sirey T, Ponting CP. Complexities of post-transcriptional regulation and the modeling of ceRNA crosstalk. Crit Rev Biochem Mol Biol. 2018;53:231–45.PubMedPubMedCentralCrossRef Smillie CL, Sirey T, Ponting CP. Complexities of post-transcriptional regulation and the modeling of ceRNA crosstalk. Crit Rev Biochem Mol Biol. 2018;53:231–45.PubMedPubMedCentralCrossRef
27.
Zurück zum Zitat Ferrè F, Colantoni A, Helmer-Citterich M. Revealing protein-lncRNA interaction. Brief Bioinform. 2016;17:106–16.PubMedCrossRef Ferrè F, Colantoni A, Helmer-Citterich M. Revealing protein-lncRNA interaction. Brief Bioinform. 2016;17:106–16.PubMedCrossRef
28.
Zurück zum Zitat Abdel Ghafar MT, El-Rashidy MA, Gharib F, Al-Ashmawy GM. Impact of XRCC1 genetic variants on its tissue expression and breast cancer risk: a case-control study. Environ Mol Mutagen. 2021;62:399–408.PubMedCrossRef Abdel Ghafar MT, El-Rashidy MA, Gharib F, Al-Ashmawy GM. Impact of XRCC1 genetic variants on its tissue expression and breast cancer risk: a case-control study. Environ Mol Mutagen. 2021;62:399–408.PubMedCrossRef
29.
Zurück zum Zitat Abdel Ghafar MT, Elkhouly RA, Elnaggar MH, Mabrouk MM, Darwish SA, Younis RL, Elkholy RA. Utility of serum neuropilin-1 and angiopoietin-2 as markers of hepatocellular carcinoma. J Investig Med. 2021;69:1222–9.PubMedCrossRef Abdel Ghafar MT, Elkhouly RA, Elnaggar MH, Mabrouk MM, Darwish SA, Younis RL, Elkholy RA. Utility of serum neuropilin-1 and angiopoietin-2 as markers of hepatocellular carcinoma. J Investig Med. 2021;69:1222–9.PubMedCrossRef
30.
Zurück zum Zitat Habib EM, Nosiar NA, Eid MA, Taha AM, Sherief DE, Hassan AE, Abdel Ghafar MT. MiR-150 expression in chronic myeloid leukemia: relation to imatinib response. Lab Med. 2022;53:58–64.PubMedCrossRef Habib EM, Nosiar NA, Eid MA, Taha AM, Sherief DE, Hassan AE, Abdel Ghafar MT. MiR-150 expression in chronic myeloid leukemia: relation to imatinib response. Lab Med. 2022;53:58–64.PubMedCrossRef
31.
Zurück zum Zitat Abdel Ghafar MT, Soliman NA. Metadherin (AEG-1/MTDH/LYRIC) expression: significance in malignancy and crucial role in colorectal cancer. Adv Clin Chem. 2022;106:235–80.PubMedCrossRef Abdel Ghafar MT, Soliman NA. Metadherin (AEG-1/MTDH/LYRIC) expression: significance in malignancy and crucial role in colorectal cancer. Adv Clin Chem. 2022;106:235–80.PubMedCrossRef
32.
Zurück zum Zitat Yang T, Chen WC, Shi PC, Liu MR, Jiang T, Song H, Wang JQ, Fan RZ, Pei DS, Song J. Long noncoding RNA MAPKAPK5-AS1 promotes colorectal cancer progression by cis-regulating the nearby gene MK5 and acting as a let-7f-1-3p sponge. J Exp Clin Cancer Res. 2020;39:139.PubMedPubMedCentralCrossRef Yang T, Chen WC, Shi PC, Liu MR, Jiang T, Song H, Wang JQ, Fan RZ, Pei DS, Song J. Long noncoding RNA MAPKAPK5-AS1 promotes colorectal cancer progression by cis-regulating the nearby gene MK5 and acting as a let-7f-1-3p sponge. J Exp Clin Cancer Res. 2020;39:139.PubMedPubMedCentralCrossRef
33.
Zurück zum Zitat Chen L, Jiang B, Wang Z, Liu M, Ma Y, Yang H, Xing J, Zhang C, Yao Z, Zhang N, et al. Expression and prognostic significance of GATA-binding protein 2 in colorectal cancer. Med Oncol. 2013;30:498.PubMedCrossRef Chen L, Jiang B, Wang Z, Liu M, Ma Y, Yang H, Xing J, Zhang C, Yao Z, Zhang N, et al. Expression and prognostic significance of GATA-binding protein 2 in colorectal cancer. Med Oncol. 2013;30:498.PubMedCrossRef
34.
Zurück zum Zitat Liu X, Fan D. The epithelial-mesenchymal transition and cancer stem cells: functional and mechanistic links. Curr Pharm Des. 2015;21:1279–91.PubMedCrossRef Liu X, Fan D. The epithelial-mesenchymal transition and cancer stem cells: functional and mechanistic links. Curr Pharm Des. 2015;21:1279–91.PubMedCrossRef
35.
Zurück zum Zitat Liao TT, Yang MH. Revisiting epithelial-mesenchymal transition in cancer metastasis: the connection between epithelial plasticity and stemness. Mol Oncol. 2017;11:792–804.PubMedPubMedCentralCrossRef Liao TT, Yang MH. Revisiting epithelial-mesenchymal transition in cancer metastasis: the connection between epithelial plasticity and stemness. Mol Oncol. 2017;11:792–804.PubMedPubMedCentralCrossRef
36.
Zurück zum Zitat Liu A, Liu L, Lu H. LncRNA XIST facilitates proliferation and epithelial-mesenchymal transition of colorectal cancer cells through targeting miR-486-5p and promoting neuropilin-2. J Cell Physiol. 2019;234:13747–61.PubMedCrossRef Liu A, Liu L, Lu H. LncRNA XIST facilitates proliferation and epithelial-mesenchymal transition of colorectal cancer cells through targeting miR-486-5p and promoting neuropilin-2. J Cell Physiol. 2019;234:13747–61.PubMedCrossRef
37.
Zurück zum Zitat Li C, Liu T, Zhang Y, Li Q, Jin LK. LncRNA-ZDHHC8P1 promotes the progression and metastasis of colorectal cancer by targeting miR-34a. Eur Rev Med Pharmacol Sci. 2019;23:1476–86.PubMed Li C, Liu T, Zhang Y, Li Q, Jin LK. LncRNA-ZDHHC8P1 promotes the progression and metastasis of colorectal cancer by targeting miR-34a. Eur Rev Med Pharmacol Sci. 2019;23:1476–86.PubMed
38.
Zurück zum Zitat Bai J, Xu J, Zhao J, Zhang R. LncRNA NBR2 suppresses migration and invasion of colorectal cancer cells by downregulating miRNA-21. Hum Cell. 2020;33:98–103.PubMedCrossRef Bai J, Xu J, Zhao J, Zhang R. LncRNA NBR2 suppresses migration and invasion of colorectal cancer cells by downregulating miRNA-21. Hum Cell. 2020;33:98–103.PubMedCrossRef
39.
Zurück zum Zitat Somma D, Mastrovito P, Grieco M, Lavorgna A, Pignalosa A, Formisano L, Salzano AM, Scaloni A, Pacifico F, Siebenlist U, Leonardi A. CIKS/DDX3X interaction controls the stability of the Zc3h12a mRNA induced by IL-17. J Immunol. 2015;194:3286–94.PubMedCrossRef Somma D, Mastrovito P, Grieco M, Lavorgna A, Pignalosa A, Formisano L, Salzano AM, Scaloni A, Pacifico F, Siebenlist U, Leonardi A. CIKS/DDX3X interaction controls the stability of the Zc3h12a mRNA induced by IL-17. J Immunol. 2015;194:3286–94.PubMedCrossRef
40.
Zurück zum Zitat Cannizzaro E, Bannister AJ, Han N, Alendar A, Kouzarides T. DDX3X RNA helicase affects breast cancer cell cycle progression by regulating expression of KLF4. FEBS Lett. 2018;592:2308–22.PubMedPubMedCentralCrossRef Cannizzaro E, Bannister AJ, Han N, Alendar A, Kouzarides T. DDX3X RNA helicase affects breast cancer cell cycle progression by regulating expression of KLF4. FEBS Lett. 2018;592:2308–22.PubMedPubMedCentralCrossRef
41.
Zurück zum Zitat Hueng DY, Tsai WC, Chiou HY, Feng SW, Lin C, Li YF, Huang LC, Lin MH. DDX3X biomarker correlates with poor survival in human gliomas. Int J Mol Sci. 2015;16:15578–91.PubMedPubMedCentralCrossRef Hueng DY, Tsai WC, Chiou HY, Feng SW, Lin C, Li YF, Huang LC, Lin MH. DDX3X biomarker correlates with poor survival in human gliomas. Int J Mol Sci. 2015;16:15578–91.PubMedPubMedCentralCrossRef
42.
Zurück zum Zitat van Heerma Voss MR, Vesuna F, Trumpi K, Brilliant J, Berlinicke C, de Leng W, Kranenburg O, Offerhaus GJ, Bürger H, van der Wall E, et al. Identification of the DEAD box RNA helicase DDX3 as a therapeutic target in colorectal cancer. Oncotarget. 2015;6:28312–26.CrossRef van Heerma Voss MR, Vesuna F, Trumpi K, Brilliant J, Berlinicke C, de Leng W, Kranenburg O, Offerhaus GJ, Bürger H, van der Wall E, et al. Identification of the DEAD box RNA helicase DDX3 as a therapeutic target in colorectal cancer. Oncotarget. 2015;6:28312–26.CrossRef
43.
Zurück zum Zitat Vicente C, Conchillo A, García-Sánchez MA, Odero MD. The role of the GATA2 transcription factor in normal and malignant hematopoiesis. Crit Rev Oncol Hematol. 2012;82:1–17.PubMedCrossRef Vicente C, Conchillo A, García-Sánchez MA, Odero MD. The role of the GATA2 transcription factor in normal and malignant hematopoiesis. Crit Rev Oncol Hematol. 2012;82:1–17.PubMedCrossRef
44.
Zurück zum Zitat Tsuzuki S, Kitajima K, Nakano T, Glasow A, Zelent A, Enver T. Cross talk between retinoic acid signaling and transcription factor GATA-2. Mol Cell Biol. 2004;24:6824–36.PubMedPubMedCentralCrossRef Tsuzuki S, Kitajima K, Nakano T, Glasow A, Zelent A, Enver T. Cross talk between retinoic acid signaling and transcription factor GATA-2. Mol Cell Biol. 2004;24:6824–36.PubMedPubMedCentralCrossRef
45.
Zurück zum Zitat Xiao L, Feng Q, Zhang Z, Wang F, Lydon JP, Ittmann MM, Xin L, Mitsiades N, He B. The essential role of GATA transcription factors in adult murine prostate. Oncotarget. 2016;7:47891–903.PubMedPubMedCentralCrossRef Xiao L, Feng Q, Zhang Z, Wang F, Lydon JP, Ittmann MM, Xin L, Mitsiades N, He B. The essential role of GATA transcription factors in adult murine prostate. Oncotarget. 2016;7:47891–903.PubMedPubMedCentralCrossRef
46.
Zurück zum Zitat Zhong L, Simoneau B, Huot J, Simard MJ. p38 and JNK pathways control E-selectin-dependent extravasation of colon cancer cells by modulating miR-31 transcription. Oncotarget. 2017;8:1678–87.PubMedCrossRef Zhong L, Simoneau B, Huot J, Simard MJ. p38 and JNK pathways control E-selectin-dependent extravasation of colon cancer cells by modulating miR-31 transcription. Oncotarget. 2017;8:1678–87.PubMedCrossRef
Metadaten
Titel
A feedback loop between GATA2-AS1 and GATA2 promotes colorectal cancer cell proliferation, invasion, epithelial-mesenchymal transition and stemness via recruiting DDX3X
Publikationsdatum
01.12.2022
Erschienen in
Journal of Translational Medicine / Ausgabe 1/2022
Elektronische ISSN: 1479-5876
DOI
https://doi.org/10.1186/s12967-022-03483-8

Weitere Artikel der Ausgabe 1/2022

Journal of Translational Medicine 1/2022 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Die „Zehn Gebote“ des Endokarditis-Managements

30.04.2024 Endokarditis Leitlinie kompakt

Worauf kommt es beim Management von Personen mit infektiöser Endokarditis an? Eine Kardiologin und ein Kardiologe fassen die zehn wichtigsten Punkte der neuen ESC-Leitlinie zusammen.

Strenge Blutdruckeinstellung lohnt auch im Alter noch

30.04.2024 Arterielle Hypertonie Nachrichten

Ältere Frauen, die von chronischen Erkrankungen weitgehend verschont sind, haben offenbar die besten Chancen, ihren 90. Geburtstag zu erleben, wenn ihr systolischer Blutdruck < 130 mmHg liegt. Das scheint selbst für 80-Jährige noch zu gelten.

Frauen bekommen seltener eine intensive Statintherapie

30.04.2024 Statine Nachrichten

Frauen in den Niederlanden erhalten bei vergleichbarem kardiovaskulärem Risiko seltener eine intensive Statintherapie als Männer. Ihre LDL-Zielwerte erreichen sie aber fast ähnlich oft.

Reizdarmsyndrom: Diäten wirksamer als Medikamente

29.04.2024 Reizdarmsyndrom Nachrichten

Bei Reizdarmsyndrom scheinen Diäten, wie etwa die FODMAP-arme oder die kohlenhydratreduzierte Ernährung, effektiver als eine medikamentöse Therapie zu sein. Das hat eine Studie aus Schweden ergeben, die die drei Therapieoptionen im direkten Vergleich analysierte.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.