Introduction
Bladder urothelial carcinoma (BUC) is the most common genitourinary malignancy with 500,000 new cases and 200,000 deaths per year worldwide [
1]. BUC can present as non-muscle-invasive bladder cancer (NMIBC) accounting for near 80% patients diagnosed with BUC, muscle-invasive bladder cancer (MIBC) with higher aggression or as a metastatic disease [
2]. Despite the 5-year OS of NMIBC is greater than 85%, it has not significantly improved for a good while, and the frequent recurrence also put a heavy load on the quality of life (QOL) [
2‐
4]. Representing the remaining 20% of localized disease, MIBC get the higher disease-specific mortality and the worse life expectancy, with approximately 50% 5-year OS [
1].
Although surgery, chemotherapy and immunotherapy have been widely applied for BUC, few survival improvements have been achieved until an emerging body of next-generation sequencing help us better understand the genetic variations and molecular alterations, identify actionable therapeutic targets, and predict patient prognosis [
5,
6]. Besides, the clear cellular geography and the acknowledge of various cell types allow us improve the awareness of genetic background better understand a considerable variety and heterogeneity of the tumour [
7]. Recently, intense efforts are being made to clarify the genome‐wide association of BUC and identify more valuable candidate genes for diagnostic markers, and therapeutic targets [
5]. The variants of aldehyde dehydrogenase (ALDH2) enzyme were demonstrated to be closely associated with the higher recurrence rate of BUC [
8]. CD44 polymorphisms probably responding for the susceptibility of BUC were potential for a molecular prognostic marker [
9]. Additionally, the identification of some mutated genes such as FGFR3 [
10], TP53 [
11] and ERCC2 [
12,
13], led to a resurgent interest in the realm of targeted therapy. An emerging body of studies at the genetic level are discovering more attractive and viable targets.
Tumour angiogenesis, a highly dynamic and complex pathological process of new vessel formation in the primary site or metastatic site, has been identified as an independent prognostic indicator in many cancers [
14,
15]. By supplying abundant nutrition and natural migration pathway, angiogenesis promotes tumour progression and regulates tumour microenvironment. Therefore, antiangiogenetic targeted therapy combined with anti-tumour cells approaches seems to be an alternative way for cancer therapy [
16]. Additionally, identifying some promising angiogenetic markers has also been shown as a viable strategy for diagnosis and prognosis estimation, but is still in its infancy, especially for BUC [
17,
18].
Long non-coding RNAs (lncRNAs), a group of non-coding RNAs that are more than 200 base pairs in length, are dynamically expressed in variety of biological activities including tumour angiogenesis [
19,
20]. LncRNAs affect angiogenesis by regulating various angiogenetic molecules, endothelial cell behaviors and tube formation. Besides, a cascade of lncRNAs have been found to participate in the angiogenesis-related pathways, such as vascular endothelial growth factor (VEGF) [
21,
22] and Notch [
23]. Therefore, angiogenesis-related lncRNAs (ARlncR) as a kind of potential candidate, merit further discovery and attention in the field of antiangiogenetic strategies.
Materials and methods
Clinical sample collection
Tumour tissues and adjacent normal tissues of 138 BUC patients who underwent tumour excision or tissue biopsy in the First Affiliated Hospital of Chongqing Medical University between March 2019 and February 2021 were collected. (Table
1) Patients with severe underlying diseases or other primary cancers were excluded. The collected clinical tissues were utilized to analyze the expression of lncRNAs and percentage of endothelial cells (ECs). All patients included in this study provided written informed consent, and this study was approved by the Medical Ethics Committee of the First Affiliated Hospital of Chongqing Medical University (IRB:2021-085). All clinical data were reviewed according to medical records.
Table 1
Relationship between AC005625.1 and AC008760.1 expression and clinicopathologic factors of UBC patients
Gender | 0.361 |
Male | 115 | 60 | 55 |
Female | 23 | 9 | 14 |
Age (year) | 0.305 |
< 65 | 75 | 34 | 41 |
≥ 65 | 63 | 35 | 28 |
ECs percentage (%) | < 0.001 |
< 25 | 69 | 18 | 51 |
≥ 25 | 69 | 51 | 18 |
Tumor size (cm) | 0.003 |
< 2 | 58 | 20 | 38 |
≥ 2 | 80 | 49 | 31 |
Muscle invasion status | 0.022 |
Negative | 52 | 19 | 33 |
Positive | 86 | 50 | 36 |
Lymph node status | 0.208 |
Negative | 132 | 64 | 68 |
Positive | 6 | 5 | 1 |
Distant metastasis status | 0.098 |
Negative | 123 | 58 | 65 |
Positive | 15 | 11 | 4 |
Nidus number |
Single | 126 | 64 | 62 | 0.764 |
Multiple | 12 | 5 | 7 |
Cell culture
SV-HUC-1, BUC cell lines (T24, UM-UC-3, 5637, J82 and TCC-SUP) and HUVEC were purchased from the American Type Culture Collection (Manassas, Virginia, USA). Cells were cultured in DMEM (SV-HUC-1, UM-UC-3, T24 and HUVEC), McCoy’s 5A (J82) and RPMI-1640 (5637 and TCC-SUP) basal medium (Gibco, Gaithersburg, MD, USA), which were supplemented with 10% fetal bovine serum (FBS, MilliporeSigma, Burlington, MA, USA), 100 U/ml penicillin and 0.1 mg/ml streptomycin (Beyotime, Beijing, China). Cells were incubated at 37 °C in 5% CO2 incubator. The medium was changed every 1–3 days.
Tissue processing
Bladder specimens were obtained fresh from the operating field where grossly apparent tumour tissue or adjacent tissue not grossly affected by tumour (Par-cancer tissue). These tissues were transported at room temperature immersed in the RPMI-1640 medium (Gibco, Gaithersburg, MD, USA) with 10% FBS (MilliporeSigma, Burlington, MA, USA). Once received, tumour tissues were divided into two parts, one of which was cut into approximately 1 mm3 pieces and enzymatically digested to single cell suspensions using MACS tumor dissociation kit (Miltenyi Biotec) for 1 h on a rotor at 37 °C for further flow cytometry/FACS analysis, another part of tumour tissues and all par-cancer tissues were frozen in liquid nitrogen immediately and then stored at − 80 °C until lncRNA extraction.
ECs percentage detection by flow cytometry/FACS
The single cell suspensions were filtered with screen cloth and cell surface staining was performed in FACS buffer containing CD31 antibody (Cat# 303102, BioLegend, USA) on ice for 1 h. Following washing twice with FACS buffer, the percentages of EC subtype (CD31 positive) in these single cell suspensions were detected using a FACS flow cytometry system (Cytoflex, Beckman Coulter, USA).
Cell transfection
The siRNAs of AC005625.1 and AC008760.1 were used to silence the expression of AC005625.1 and AC008760.1. The sequences used were: si-AC005625.1 (sense: 5′-GCUUCACAGCCACCAUCUATT-3′, antisense: 5′-UAGAUGGUGGCUGUGAAGCT T-3′); si-AC008760.1 (sense: 5′-GACAGGUAGUCACGACUAUTT-3′, antisense: 5′-AUAGUC GUGACUACCUGUCTT-3′). For transient transfection, T24 cells were added into 6-well plate (1 × 105 cells per well). When cells grew to 50–60% confluence, cells were transfected with 10 μl siRNAs (20 nM) using 5 μl Lipofectamine 3000 (Invitrogen, USA) for 48 h according to the manufacturer. Finally, we used RT-qPCR to evaluate the expression levels of lncRNAs.
Real-time quantitative PCR
We used Trizol (Takara) to extract total lncRNAs from tissues and cell lines under various experimental conditions. cDNA Synthesis Kit (Takara) combined with lncRNAs (1 μg) was utilized to reverse transcribed cDNA. The quantitative polymerase chain reaction (qPCR) was performed on an ABI 7500 real-time PCR system (Applied Biosystems) by SYBR-Green method (Takara). The values of Ct were calculated with the 2
−ΔΔCt method and normalized to the expression levels of β-actin. The expression levels of lncRNAs were relative to the fold change of their controls which were defined as 1. The primer sequences were shown in Table
2. Three assays were conducted per cDNA sample.
Table 2
The primer sequences of AC005625.1, AC008760.1 and β-actin
AC005625.1 | F primer (5′–3′) | TTGTTTGTTGTTCGCCACC |
R primer (5′–3′) | CGCTGCCCAATCCCTTCA |
AC008760.1 | F primer (5′–3′) | TCCTGAGATGAAGCTGGAAATCAA |
R primer (5′–3′) | AGTTTCTACGGTGGAGGGGT |
β-Actin | F primer (5′–3′) | AAACGTGCTGCTGACCGAG |
R primer (5′–3′) | TAGCACAGCCTGGATAGCAAC |
100 μl ice‐cold Matrigel was added into a well of a 48‐wells plate for the HUVEC cells tube formation assay. 1 h later, 1 × 105 HUVEC cells resuspended in 100 μl DMEM medium were added into the 48‐wells plate. After incubating at 37 °C in 5% CO2 incubator for 4 h, the tube formation status was photographed by light microscopy. The numbers of branch points were counted and analyzed by image J. 5 fields (200×) per chamber were observed for counting invaded cell numbers.
Transwell assay
For the migration assay, 1 × 105 HUVEC cells were suspended in 100 μl medium without FBS and seeded into an upper chamber (Corning, USA). Then, 800 μl complete DMEM medium containing 10% FBS was added to the lower chamber. For the invasion assay, Diluted Matrigel (1:5 dilution with the DMEM medium) was added into the cell culture inserts. Four hours later, 1 × 105 HUVEC cells in 100 μl non-FBS DMEM medium were added into the upper chamber, while the lower chamber was filled with 800 μl of DMEM medium with 10% FBS. After culturing 24 h for migration test and 48 h for invasion test, the cells culture inserts were washed by PBS and stained with 4% paraformaldehyde. Then inserts were dyed by 0.1% crystal violet solution for 20 min. The dyed cells were photographed by light microscopy. 5 fields (200×) per chamber were observed for counting invaded cell numbers.
Immunohistochemistry assay
Immunohistochemistry (IHC) analysis was performed as described previously [
24]. IHC was performed using antibodies against CD31 (Cat# ab9498, Abcam, UK). Images were scanned using Pannoramic SCAN.
BUC transcriptome data downloading and preprocessing
Transcriptome RNA-sequencing data of 414 BUC tumour tissues and 19 normal tissues were downloaded and extracted from The Cancer Genome Atlas (TCGA) data portal (
https://portal.gdc.cancer.gov/). We excluded patients whose OS ≤ 30 days from this study because they might die of unpredictable factors such as hemorrhage and infection. The data utilized in the study were updated in March 21, 2021. Raw data of BUC patients were collected for further analyses. Transcriptome RNA-sequencing results and clinical data of BUC patients were combined into a matrix file by a merge script in the Perl language (
http://www.perl.org/).
Identification of angiogenesis-related long non-coding RNAs (ARLNRs) and the survival-related ARLNRs (sARLNRs)
Angiogenesis-related genes (ARGs) were extracted from The Molecular Signatures Database v4.0 (ANGIOGENESIS M14493 and WP_ANGIOGENESIS M39556,
http://www.broadinstitute.org/gsea/msigdb/index.jsp). Then the angiogenetic scores of these ARGs were calculated according to their expression levels in BUC tissues. To further identify the ARLNRs, we conducted the Pearson correlation analysis to clarify the correlation between angiogenetic score and the expression of lncRNA in BUC tissue. A standard of |r| > 0.6 and
P < 0.05 was used to screen the ARLNRs. Besides, we selected the sARLNRs by univariate COX analysis and survival packages of R software (
P < 0.01). sARLNRs were further divided into deleterious and protective portions by the Hazard ratio (HR).
Through multivariate COX regression analysis, we established the ARRSM based on the selected sARLNRs. The score in the ARRSM was calculated based on the expression of sARLNRs together with the Cox regression coefficients. The formula was as followed, [Expression levels of KIRREL1-IT1 * (0.266525)] + [Expression levels of AC005625.1 * (− 0.135165)] + [Expression levels of AC018809.1 * (− 0.170812)] + [Expression levels of AC008760.1 * (− 0.133273)] + [Expression levels of AC083862.2 * (− 0.221852)]. BUC patients were separated into the high-risk group and the low-risk group according to the median score.
Receiver operating characteristic (ROC) curves were used to assess the sensitivity and specificity of the ARRSM and drawn by survival ROC package of R software. Gene set enrichment analysis (GSEA) was used to detect the different pathways of ARRSM. We evaluated the survival probabilities of patients in different risk groups by Kaplan–Meier survival curves. We conducted the univariate and multivariate Cox regression analyses to verify the independent prognostic factor of BUC. Nomograms were drawn to predict the survival probabilities of BUC patients by the rms package of R software.
Statistical analysis
Statistical analysis was conducted by SPSS21.0 software (SPSS Inc, Chicago, IL) and GraphPad Prism8 (GraphPad Software Inc, La Jolla, CA). Data were expressed as means ± SD. The correlations between average expression of sARLNRs and clinicopathological characteristics of patients were evaluated using Fisher’s exact probability method. Student T-test, ANOVA and post-hoc test (Bonferroni method) were used for difference comparison of two or more groups. Pearson correlation analysis was utilized to analyze the correlation. P < 0.05 was considered a significantly statistical difference.
Discussion
Increasing evidence has unraveled that angiogenesis is crucial for tumour progression and is highly dependent on VEGF expressed by most malignant tumours [
25‐
27]. Additionally, FRS2-mediated signals were validated to promote tumour angiogenesis and predict poor prognosis in prostate carcinoma, high-grade serous ovarian cancer and liposarcoma [
28‐
30]. The finding of recurrent ADGRG6 enhancer mutations also facilitated our knowledge of underlying molecular mechanisms of pathological angiogenesis in the highly vascularized cancers [
31]. Hypoxia-inducible factor 1 (HIF1) as a heterodimeric transcription factor composed of HIF1α and HIF1β subunits, is also regarded as a major angiogenetic regulator in the tumour microenvironment [
32]. Recently, a phase II trial illuminated that ramucirumab (a VEGF receptor‑2 antibody) combined with second-line docetaxel, seemed to show the beneficial outcomes [
33]. However, anti-angiogenesis has not yet been verified as a therapy strategy with higher priority in urothelial carcinoma. Besides, much less is known about the potential roles of angiogenesis-related biomarkers.
Recent studies have demonstrated that lncRNAs regulated the various processes involved in angiogenesis directly or indirectly by targeting different angiogenetic molecules [
34]. Because of the influential roles, lncRNAs are rapidly emerging as a type of promising drug target and candidate. Lin et al. reported that lncRNA UBE2CP3 augmented hepatocellular carcinoma cell secretion of VEGFA and promoted angiogenesis by activating ERK1/2/HIF1α/VEGFA axis [
35]. LncRNA PAXIP1-AS1 was identified to boost migration and angiogenesis of glioma by upregulating ETS1-midiated KIF14 expression [
36]. Aside from the pro-angiogenetic potential, Chang et al. found lncRNA LINC00320 suppressed tumourigenicity of glioma and angiogenesis through reduction of NFKB1-regulated AQP9 [
37]. A growing body of ARlncRs not only provided therapeutic targets, but were also promising for diagnosis and prognosis evaluation. For example, lncRNA PANTR1 was related to poor prognosis and promoted angiogenesis and apoptosis in clear cell renal cell cancer [
38].
In this study, we identified five ARlncRs with prominent clinical significance of BUC. Following the establishment of ARRSM based on the five ARlncRs, BUC patients could be divided into the high-risk group and the low-risk group by scores reflecting the different OS. Besides, through the in vitro experiments, we not only found the lower expression of AC005625.1 and AC008760.1 in BUC cells and tumour tissues, but also validated the negative correlation with T stage, tumour size and muscle invasion status. More importantly, we found that AC005625.1 and AC008760.1 expression was negatively related to ECs percentage in tumour tissues. Besides, the angiogenesis-inhibited roles and underlying mechanisms of AC005625.1 and AC008760.1 were further validated in the co-culture models of HUVEC cells and T24 cells.
Identified as an autophagy-related lncRNA, AC008760.1 was demonstrated to be potential for predicting poor prognosis of colorectal cancer [
39], but few studies reported the roles of KIRREL1-IT1, AC005625.1, AC018809.1, AC008760.1 and AC083862.2 in the realm of angiogenesis. It is clear that tumour vascularization, as a hallmark feature of cancer, is not a just innocent bystander, but in many cases regulate crucial process of tumour progression. Therefore, identifying more promising angiogenetic targets merit further attention. Here, we established an ARRSM based on five sARLNRs, which not only provided more therapeutic targets, but also better evaluate prognosis of BUC patients from the perspective of tumour vascularization.
Although we elucidated the potential of ARRSM for prognosis assessment of BUC patients and validated clinical significances and angiogenetic correlation of sARLNRs through a series of in vitro experiments based on cell lines and clinical samples, some limitations remain to be further strengthened in future study. First, proteomics and metabonomics assays should be implemented to reveal wider and deeper perspectives on tumour angiogenesis. Next, the more underlying mechanisms of these sARLNRs of ARRSM should be explored through a chain of in vivo and in vitro experiments in subsequent study.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit
http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.