Background
The incidence of zoonotic diseases transmitted to humans from wild or domestic animals has increased noticeably during the past few decades and currently represents at least 70 % of emerging diseases [
1]. Japanese encephalitis virus (JEV), a zoonotic, mosquito-borne
Flavivirus, is considered to be a major cause of viral encephalitis worldwide. Due to rapid changes in climate and demography, vector-transmitted JEV poses an increasing threat to global health and welfare with approximately 67,900 cases reported annually, despite large, effective immunization campaigns [
2‐
4]. The incubation period of JE ranges from 5 to 15 days and JEV infections are lethal in about 25–30 % of cases, mostly in infants, and cause permanent neuropsychiatric sequelae in 50 % of cases [
4]. Accordingly, JE is considered to be more fatal than West Nile (WN) encephalitis, which results in a fatality in 3–5 % of cases (1100 deaths/29,000 symptomatic infections) [
5]. Currently, more than 60 % of the world’s population inhabits JE endemic areas, including eastern and southern Asia, and the virus is spreading to previously unaffected regions, such as Indonesia, Pakistan, and northern Australia [
2,
3].
JE is a neuroinflammation characterized by extensive CNS inflammation and disruption of the blood–brain barrier (BBB) after zoonotic JEV infection. Considerable progress in understanding the kinetics and mechanisms of JEV dissemination and JE pathogenesis has been made in murine models [
6‐
8]. However, the molecular pathogenesis of JE remains elusive. After peripheral introduction of the virus via mosquito bites, JEV initially replicates in primary target cells, such as dendritic cells (DCs) and macrophages, at the periphery and subsequently gains entry into the CNS through the BBB. While JEV infects and kills neurons directly in the CNS, CNS invasion by JEV also drives the stimulation of microglia/glia and infiltrated leukocytes, leading to indirect death of neuron cells via secretion of pro-inflammatory cytokines (such as IL-6 and TNF-α) and soluble mediators [
9,
10]. Therefore, JE is considered an immunopathological disease in which uncontrolled over-activation of innate and adaptive immune cells drives neurological disorders in the CNS such as paralysis. While JEV-specific T cells and virus-neutralizing IgM and IgG are considered to participate in the clearance of virus from both peripheral lymphoid tissues and the CNS [
11], innate immune responses appear to play a more crucial role in the early control of JEV infection, due to delayed establishment of adaptive immunity. The type I IFN (IFN-I; typically IFN-α/β) innate immune response is essential for controlling various viral infections, including JEV [
12‐
15], and IFN-I production is triggered by recognition of viral pathogen-associated molecular patterns (PAMPs) through cytoplasmic helicases (RIG-I, MDA5) and Toll-like receptors (TLRs) [
16‐
20]. In addition, recent data indicate that type II IFN (IFN-II; only member IFN-γ) produced by NK and CD4
+ Th1 cells has a beneficial effect on disease outcomes after JEV infection [
21,
22], although the requirement for IFN-II in recovery from infection with different flaviviruses varies [
21,
23‐
29].
Recently, the debatable role of CD11b
+Ly-6C
hi monocytes in the course of neuroinflammation caused by pathogenic CD4
+ T cells or neurotropic viruses has initiated a new era in the exploration of their differentiation lineage and immunopathological role in the CNS [
30]. These Ly-6C
hi monocytes migrate into the infected CNS, where they differentiate into DCs, macrophages, and arguably microglia to regulate neuroinflammation [
30‐
32]. Despite the conflicting results of studies investigating the role of Ly-6C
hi monocytes in modulating neuroinflammation, CNS infiltration by CD11b
+Ly-6C
hi monocytes is required for the control of neuroinflammation, which supports their protective role during CNS inflammation [
33‐
36]. Notably, the differentiation levels of Ly-6C
hi monocytes that infiltrate into the CNS appear to affect the progression of neuroinflammation caused by various insults [
37‐
39]. However, restraint of CNS infiltration of leukocytes from the periphery, including innate and adaptive immune cells, is also required because hematogenous inflammation causes profound damage if the reaction is excessive or uncontrollable [
40]. Therefore, a clear understanding of the regulation of excessive and uncontrollable immune responses during JE progression is needed to ameliorate the progression of neuroinflammation without tissue damage.
4-1BB (CD137) is a member of the tumor necrosis factor receptor (TNFR) superfamily, and its role as a T cell co-stimulatory molecule has been well defined [
41]. However, 4-1BB molecules are also expressed on a variety of innate immune cells, including NK cells, DCs, monocytes, and neutrophils [
42‐
46]. Stimulation of the 4-1BB signal is believed to enhance protective immune responses against pathogens, because agonistic anti-4-1BB mAbs can enhance the efficacy of vaccines against influenza and poxvirus [
47,
48]. The importance of the 4-1BB receptor-ligand system in viral infection control is further supported by the fact that 4-1BB ligand-deficient mice exhibit impaired immunity against lymphocytic choriomeningitis virus (LCMV) [
49] and a few influenza virus strains [
50,
51]. At the same time, stimulation of the 4-1BB signal pathway with agonistic mAbs also inhibits the development of several autoimmune diseases, including lupus, arthritis, and experimental autoimmune encephalomyelitis [
52‐
54], which indicates that there must be contradictory effects from the stimulation of the 4-1BB receptor-ligand system. Therefore, it is likely that 4-1BB signaling plays different roles depending on the properties of diseases: mild vs. severe forms or pathogenic vs. autoimmunogenic. Despite various and seemingly contradictory roles of the 4-1BB receptor-ligand system in various inflammatory diseases, 4-1BB is still an attractive target for the development of therapeutic strategies for incurable inflammatory diseases. However, no reports have yet shown the regulatory effect of the 4-1BB signaling pathway on neuroinflammation caused by neurotropic viruses such as JEV. In this study, somewhat surprisingly, blocking the 4-1BB signaling pathway ameliorated JE progression, rather than causing detrimental effects. Furthermore, the protective role of blocking the 4-1BB signal against JE was likely mediated by enhanced IFN-I innate immune responses in myeloid-derived and neuron cells, an increased number of IFN-γ-producing NK and CD4
+ Th1 cells, and early and increased infiltration of mature Ly-6C
hi monocytes in the CNS. Therefore, our data provide valuable insight into the regulation of the 4-1BB signaling pathway as a therapeutic target for neuroinflammation caused by infection with flaviviruses such as JEV and West Nile virus (WNV).
Methods
Ethics statement
All animal experiments were conducted at Chonbuk National University according to guidelines set by the Institutional Animal Care and Use Committees (IACUC) of Chonbuk National University (
http://lac.honamlife.com) and were pre-approved by the Ethical Committee for Animal Experiments of Chonbuk National University (Permission code 2013-0028). The animal research protocol in this study followed the guidelines set up by the nationally recognized Korea Association for Laboratory Animal Sciences (KALAS). All experimental protocols requiring biosafety were approved by Institutional Biosafety Committees (IBC) of Chonbuk National University.
Animals, cells, and viruses
C57BL/6 (H-2b) mice (4–5 weeks old) were purchased from Samtako (O-San, Korea). 4-1BB (H-2b) knockout (KO) mice were obtained from Ulsan University. All mice were genotyped and bred in the animal facilities of Chonbuk National University. JEV Beijing-1 strain was obtained from the Green Cross Research Institute (Suwon, Korea) and propagated in the mosquito cell line C6/36 using DMEM supplemented with 2 % FBS, penicillin (100 U/ml), and streptomycin (100 U/ml). C6/36 cultures were infected with JEV Beijing-1 at a multiplicity of infection (MOI) of 0.1 and were incubated in a humidified CO2 incubator for 1 h at 28 °C. After absorption, the inoculum was removed, and 7 ml of a maintenance medium containing 2 % FBS was added. Approximately 6–7 days post-infection (dpi), cultures of host cells showing an 80–90 % cytopathic effect were harvested. Virus stocks were titrated using either a conventional plaque assay or a focus-forming assay and were stored in aliquots at −80 °C until use.
Antibodies and reagents
The following mAbs used for flow cytometric analysis and other experiments were obtained from eBioscience (San Diego, CA, USA) or R&D Systems (Minneapolis, MN, USA): fluorescein isothiocyanate (FITC) conjugated-anti-CD4 (RM4-5), CD8 (53-6.7), CD40 (HM40-3), CD44 (IM7), CD80 (16-10A1), CD86 (GL1), F4/80 (8 M8), MHC I (28-14-8), MHC II (M5/114.15.2), and Ly-6G (1A8); phycoerythrin (PE) conjugated-anti-mouse-CD11b (M1/70), Foxp3 (FJK-16 s), CD154(MR1), CCR2 (475301), CXCR2 (242216), and granzyme B (NGZB); peridinin chlorophyll protein complex (PerCP) conjugate-anti-Ly-6C (HK1.4); PE-Cyanine dye (Cy5.5)-anti-mouse IFN-γ (XMG1.2); PE-Cyanine dye (Cy7)-anti-mouse NK1.1 (PK136); and allophycocyanin (APC) conjugated-anti-mouse-CD25 (PC62.5), Ly-6G (Gr-1), TNF-α (MP6-XT22), and IL-17A (eBio17B7). Peptides of I-A
b-restricted epitopes (JEV NS1
132–145 [TFVVDGPETKECPD] and NS3
563–574 [WCFDGPRTNAIL]) and H-2D
b-restricted epitope (JEV NS4B
215–223 [SAVWNSTTA]) were chemically synthesized at Peptron Inc. (Daejeon, Korea). JEV-specific primers for the detection of viral RNA (JEV10,564-10,583 forward, 5′-CCC TCA GAA CCG TCT CGG AA-3′ and JEV10,862-10,886 reverse, 5′-CTA TTC CCA GGT GTC AAT ATG CTG T-3′) and primers specific for cytokines, type I IFNs (IFN-α/β), and RLRs, IRFs, ISGs (Table
1) were synthesized at Bioneer Corp. (Daejeon, Korea) and used for PCR amplification of target genes.
Table 1
Specific primers for cytokine, type I IFNs, PRRs, IRFs, and ISGs used in real-time qRT-PCR
TNF-α | FP: CGT CGT AGC AAA CCA CCA AG | 438-457 | NM_013693 |
RP: TTG AAG AGA ACC TGG GAG TAG ACA | 564-587 |
IFN-α | FP: TGTCTGATGCAGCAGGTGG | 367-385 | NM_008334.3 |
RP: AAGACAGGGCTCTCCAGAC | 514-532 |
IFN-β | FP: TCCAAGAAAGGACGAACATTCG | 106-121 | NM_010510 |
RP: TGAGGACATCTCCCACGTCAA | 399-419 |
IRF3 | FP: GAT GGA GAG GTC CAC AAG GA | 1170-1189 | NM_016849 |
RP: GAG TGT AGC GTG GGG AGT GT | 1259-1278 |
IRF7 | FP: CCT CTT GCT TCA GGT TCT GC | 980-999 | NM_016850.3 |
RP: GCT GCA TAG GGT TCC TCG TA | 1080-1099 |
RIG-I | FP: CCA CCT ACA TCC TCA GCT ACA TGA | 194-217 | NM_172689 |
RP: TGG GCC CTT GTT GTT CTT CT | 260-279 |
MDA5 | FP: GGC ACC ATG GGA AGT GAT T | 1178-1196 | NM_027835 |
RP: ATT TGG TAA GGC CTG AGC TG | 1247-1266 |
ISG49 | FP: GCC GTT ACA GGG AAA TAC TGG | 919-939 | NM_010501.2 |
RP: CCT CAA CAT CGG GGC TCT | 1126-1143 |
ISG54 | FP: GGG AAA GCA GAG GAA ATC AA | 1918-1937 | NM_008332.3 |
RP: TGA AAG TTG CCA TAC AGA AG | 2005-2024 |
ISG56 | FP: CAG AAG CAC ACA TTG AAG AA | 774-793 | NM_008331.3 |
RP: TGT AAG TAG CCA GAG GAA GG | 911-930 |
β-Actin | FP: TGG AAT CCC TGT GGG ACC ATG AAA C | 885-909 | NM_007393.3 |
RP: TAA AAC GCA GCT CAG TAA CAG TCC G | 1209-1233 |
Quantitative real-time RT-PCR for viral burden and cytokine expression
Viral burden and cytokine (TNF-α, IFN-α, and IFN-β) expression in inflammatory and lymphoid tissues were determined by conducting quantitative SYBR Green-based real-time RT-PCR (real-time qRT-PCR). Mice were infected intraperitoneally (i.p.) with JEV (3.0 × 107 PFU) and tissues including the brain, spinal cord, and spleen were harvested at 2, 4, and 6 dpi following extensive cardiac perfusion with Hanks balanced salt solution (HBSS). Total RNA was extracted from tissues using easyBLUE (iNtRON, INC., Daejeon, Korea) and subjected to real-time qRT-PCR using a CFX96 Real-Time PCR Detection system (Bio-Rad Laboratories, Hercules, CA, USA). Following reverse transcription of total RNA with High-Capacity cDNA Reverse Transcription Kits (Applied Biosystems, Foster, CA, USA), the reaction mixture contained 2 μl of template cDNA, 10 μl of 2× SYBR Primix Ex Taq, and 200 nM primers for a final volume of 20 μl. The reactions were denatured at 95 °C for 30 s and then subjected to 45 cycles of 95 °C for 5 s and 60 °C for 20 s. After the reaction cycle was complete, the temperature was increased from 65 to 95 °C at a rate of 0.2 °C/15 s, and the fluorescence was measured every 5 s to construct a melting curve. A control sample that contained no template DNA was run with each assay, and all determinations were performed at least in duplicate to ensure reproducibility. The authenticity of the amplified product was determined by melting curve analysis. All data were analyzed using the Bio-Rad CFX Manager, version 2.1 analysis software (Bio-Rad Laboratories).
Analysis and activation of NK cells
The activation of NK cells was assessed by the capacity to produce IFN-γ and granzyme B (GrB) following brief stimulation with PMA and ionomycin (Sigma-Aldrich). Splenocytes were prepared from BL/6 and 4-1BB KO mice 2 dpi and stimulated with PMA (50 ng/ml) and ionomycin (750 ng/ml) in the presence of monensin (2 μM) to induce the expression of IFN-γ and GrB for 1 and 2 h, respectively. After stimulation, cells were surface stained by FITC anti-mouse-CD3ε, PE-Cy7 anti-mouse NK1.1, and biotin-conjugated anti-mouse pan-NK cell (CD49b) [DX5] antibodies and streptavidin-APC for 30 min at 4 °C. The cells were then washed twice with FACs buffer containing monensin. After fixation, cells were permeabilized with 1× permeabilization buffer (eBioscience) and stained intracellularly with PE anti-mouse IFN-γ (XMF1.2) and GrB antibodies (NGZB) in permeabilization buffer for 30 min at 4 °C. Finally, the cells were washed with PBS twice, and analysis was performed with FACS Calibur flow cytometer (Becton Dickson Medical Systems, Sharon, MA, USA) and FlowJo software (ver. 7.6.5; Tree Star, San Carlos, CA, USA).
JEV-specific CD4+ and CD8+ T cell responses
JEV-specific CD4
+ and CD8
+ T cell responses were determined by intracellular CD154 [
55,
56] as well as IFN-γ and TNF-α staining in response to stimulation with respective JEV epitope peptides. Surviving mice infected with JEV (3.0 × 10
7 PFU) were sacrificed at 7 or 14 dpi, and splenocytes were prepared. The erythrocytes were depleted by treating single-cell suspensions with ammonium chloride-containing Tris buffer (NH
4Cl-Tris) for 5 min at 37 °C. The splenocytes were cultured in 96-well culture plates (5 × 10
5 cells/well) in the presence of synthetic peptide epitopes (NS1
132–145, NS3
563–574, and NS4B
215–225) for 12 and 6 h, in order to observe CD4
+ and CD8
+ T cell responses, respectively. Monensin (2 μM) was added to antigen-stimulated cells 6 h before harvest. The cells were washed twice with PBS and surface stained with FITC-anti-CD4 or CD8 antibodies for 30 min at 4 °C and then washed twice with PBS containing monensin again. After fixation, the cells were washed twice with permeabilization buffer (eBioscience) and stained with PE Cy5.5-anti-IFN-γ or APC-anti-TNF-α in permeabilization buffer for 30 min at room temperature. Intracellular CD154 was detected by the addition of CD154 mAb in the culture media during peptide stimulation. Finally, the cells were washed twice with PBS and fixed using a fixation buffer. Sample analysis was performed with FACS Calibur flow cytometer (Becton Dickson Medical Systems) and FlowJo (Tree Star) software.
Intracellular staining for analysis of CD4+ Th1, Th17, and Treg cells
To monitor CD4+ Th subsets, mice infected with JEV (3.0 × 107 PFU) were sacrificed at 3 and 5 dpi, and splenocytes were prepared. Splenocytes were cultured in 96-well culture plates (106 cells/well) with PMA (50 ng/ml) plus ionomycin (750 ng/ml) in the presence of monensin (2 μM) for 5 h at 37 °C. The stimulated cells were washed twice with PBS and surface stained with FITC-anti-CD4 for 30 min at 4 °C and then washed twice with PBS containing monensin. After fixation, the cells were washed twice with permeabilization buffer (eBioscience) and stained with PerCP-anti-IFN-γ and APC-anti-IL-17α in permeabilization buffer for 30 min at room temperature. Finally, the cells were washed twice with PBS and fixed using fixation buffer. To monitor Treg cells, splenocytes were surface stained for FITC-anti-CD4 markers for 30 min on ice and then fixed with fixation/permeabilization concentrate buffer (eBioscience) for 6 h at 4 °C. After fixation, the cells were washed twice with permeabilization buffer and stained with PE-anti-Foxp3 in permeabilization buffer for 30 min at room temperature. The sample analysis was performed with FACS Calibur flow cytometer.
Analysis of leukocytes infiltrated into the CNS
Mice infected with JEV were perfused with 30 ml of HBSS at 2 or 4 dpi via cardiac puncture of the left ventricle. Brains were then harvested and homogenized by gently pressing them through a 100-mesh tissue sieve, after which they were digested with 25 μg/ml of collagenase type IV (Worthington Biochem, Freehold, NJ, USA), 0.1 μg/ml trypsin inhibitor Nα-p-tosyl-L-lysine chloromethyl ketone, 10 μg/ml DNase I (Amresco, Solon, OH, USA), and 10 mM HEPE in HBSS for 1 h at 37 °C, under shaking conditions. Cells were separated by using an Optiprep density gradient (18/10/5 %) centrifugation at 800 × g for 30 min (Axis-Shield, Oslo, Norway), after which cells were collected from the 18 to 10 % interface and washed twice with PBS. Cells were counted and stained for CD11b, Ly6G, Ly6C, F4/80, and MHC II with directly conjugated antibodies (eBioscience) for 30 min at 4 °C. Finally, the cells were fixed with 10 % formaldehyde. Data collection and analysis were performed with FACS Calibur flow cytometer (Becton Dickson Medical Systems) and FlowJo (Tree Star) software.
Primary cell culture and infection
Myeloid-derived DCs and macrophages
Bone-marrow derived DCs (BMDC) and macrophages (BMDM) were prepared from bone marrow cells of 4-1BB KO and WT mice. In order to prepare BMDC, bone marrow cells (3 × 105 cells/ml) from femurs and tibiae were cultured in RPMI 1640 supplemented with 2 ng/ml GM-CSF and 10 ng/ml IL-4. On day 3, another 6 ml of fresh complete medium containing 2 ng/ml GM-CSF and 10 ng/ml IL-4 was added, and half of the medium was changed on day 6. On day 8, non-adherent and loosely adherent DCs were harvested by vigorous pipetting. Cells were then characterized by flow cytometric analysis, which revealed that the culture generally consisted of >85 % CD11c+ cells (25 % CD11c+CD11b+and 65 % CD11c+CD8α+). BMDM were prepared by culturing bone marrow cells in DMEM supplemented with 30 % L929 cell-conditioned medium (LCCM) as a source of macrophage-colony-stimulating factor (M-CSF). On day 3, another 6 ml of fresh complete medium containing 30 % LCCM was added, and half of the medium was changed on day 6. The cultured cells were harvested following an 8-day incubation and analyzed by flow cytometry. The prepared BMDM were composed of >85 % F4/80+ cells that consisted of 99.2 % F4/80+CD11b+ and ~1 % F4/80+CD11c+ cells. Prepared BMDC and BMDM were infected with JEV at MOIs of 1.0 and 10 for viral replication and 10 MOI for cytokine expression.
Primary cortical neurons
Primary cortical neurons were prepared from 15-day-old embryos. Cortical neurons were seeded in 12-well poly-D-lysine/laminin-coated plates in DMEM containing 5 % FBS and 5 % horse serum for 24 h and then cultured for 4 days with neurobasal medium containing B27 supplement and L-glutamine (Invitrogen, Carlsbad, CA, USA). Primary cortical neurons were infected with JEV at a 0.1 MOI for viral replication and type I IFN responses.
Generation of BM chimeric mice and determination of serum IFN-β
C57BL/6 mice (5-week-old) and 4-1BB KO mice were γ-irradiated with one dose of 900 rads. Within 12 h, recipient mice were reconstituted with 107 donor BM cells derived from C57BL/6 and 4-1BB KO mice. The recipient mice were given sulfamethoxazole and trimethoprim in their drinking water for 10 days after irradiation. Mice were infected with JEV 4–6 weeks after irradiation. A commercial ELISA kit (PBL Biomedical Laboratories, Piscataway, NJ, USA) was used to measure levels of secreted IFN-β protein in the sera, according to the manufacturer’s protocol.
Statistical analysis
All data were expressed as the average ± standard deviation, and statistically significant differences between groups were analyzed by unpaired two-tailed Student’s t tests for ex vivo experiments and immune cell analysis or ANOVA and post hoc test for multiple comparisons of the mean. The statistical significance of viral burden was evaluated by Mann–Whitney test or unpaired two-tailed Student’s t test. Kaplan-Meier survival curves were analyzed with the log-rank test. A p value ≤0.05 was considered significant. All data were analyzed using Prism software (GraphPadPrism4, San Diego, CA, USA).
Discussion
The impact of the 4-1BB/4-1BBL co-stimulatory pathway on antiviral immunity has been studied in several viral infection models using gene knockout systems. Although 4-1BB/4-1BBL interactions result in both positive and negative impacts on viral infection depending on the type of virus, disease severity, and timing of 4-1BB signal blockade [
47‐
54], our data demonstrate that blocking the 4-1BB signaling pathway provides increased resistance to JE, rather than causing detrimental effects. This finding is supported by our observation that treatment with a 4-1BB agonistic mAb (3E1) exacerbated JE. The reduction of viral burden in extraneural tissues and the CNS by blocking the 4-1BB signal pathway correlated with an increased frequency of IFN-γ-producing NK and CD4
+ Th1 T cells as well as increased accumulation of mature Ly-6C
hi monocytes in the inflamed CNS. More interestingly, DCs and macrophages derived from 4-1BB KO mice showed potent and rapid IFN-I innate immune responses in response to JEV infection, which could represent inhibition of JEV replication. In addition, 4-1BB signal-ablated neuron cells displayed enhanced IFN-I innate responses to JEV infection compared to normal neuron cells. Ultimately, these results imply that the promotion of IFN-I/II responses in a 4-1BB signal-ablated environment contribute to the inhibition of viral replication at the periphery and CNS, thereby ameliorating JE progression. Therefore, our data suggest that regulation of the 4-1BB signaling pathway with blocking mAb or inhibitors could represent a valuable therapeutic target in the treatment of JE.
The role of IFN-γ, the only member of IFN-II, is rather unclear in immune-mediated protection against viral disease of the CNS [
65]. In particular, the requirement of IFN-γ in recovery from infections with different flaviviruses has been shown vary. IFN-γ plays a crucial role in early protective immune responses against a virulent North American isolate of WNV [
23] and mouse-adapted strains of dengue virus [
24,
25], but is dispensable in the control of infection with less virulent strains of WNV [
26] or yellow fever virus [
27,
28], and shows only a modest protective role against Murray Valley encephalitis [
29]. Similarly, IL-12 has been reported to show suppressed protective immunity to JEV in mice through IFN-γ [
66], but in some experiments, IFN-γ was associated with a beneficial effect on the outcome of JE [
22]. Our data favor the latter results that show a beneficial role of IFN-γ in JE progression. IFN-γ is involved in diverse functions for the control of microbial infections, including activation and polarization of CD4
+ Th cells, upregulation of Fas in infected target cells, upregulation of MHC I- and II-restricted Ag-presentation pathways, macrophage activation, and direct antiviral activity that overlaps with activities triggered by IFN-I [
67]. Conceivably, it is possible that enhanced production of IFN-γ by NK and polyclonal CD4
+ Th1 T cells in a 4-1BB-blocked environment is involved in the early control of viral replication in extraneural tissues and the CNS. However, considering that NK cell-depleted mice show no change in viral burden or survival [
29], NK cell responses do not appear to significantly contribute to host survival, even though infection with JEV provides early activation of NK cells. This notion is consistent with the absence of a protective value of NK cells against WNV [
68]. Furthermore, flaviviruses, including WNV, exhibit immune escape from NK-cell attack involving the upregulation of MHC-I in infected cells [
69]. Therefore, it is unlikely that IFN-γ produced from NK cells and the cytolytic function of NK cells via granzyme B is dominant in the regulation of JE progression.
The cytolytic function of infected target cells by antigen-specific CD8
+ T cells is thought to play a crucial role in disease recovery, given that depletion of CD8
+ T cells results in increased viral burden in the CNS [
70]. In addition, CD4
+ T cells that show IFN-γ-producing Th1 type in response to JEV Ag appear to elicit an important protective immune parameter for the control of JEV [
21]. Because of impaired and delayed JEV-specific CD4
+ and CD8
+ T cell responses in 4-1BB signal-ablated mice, our data suggest that IFN-γ-producing CD4
+ Th1 cells may be dominant players in the control of viral replication during the early phase. In addition, this fact raises the notion that the equilibrium of IFN-γ-producing CD4
+ Th1 and IL-17-producing CD4
+ Th17 cells may become an important parameter for prognosis in JE progression. Here, one interesting result was that the frequency or number of CD4
+CD25
+Foxp3
+ Treg cells was not apparently changed by the ablation of 4-1BB signal. Because an increased number of CD4
+CD25
+Foxp3
+ Treg cells is correlated with milder forms of encephalitis caused by flavivirus infection [
58], this finding suggests that IFN-γ produced from CD4
+ Th1 cells can affect the progression of JE without changing the number of CD4
+CD25
+Foxp3
+ Treg cells.
IFN-γ produced by CD4
+ Th1 cells appears to be involved in the maturation of myeloid-derived cells, including Ly-6C
hi monocytes [
71,
72]. Further, IFN-I produced by myeloid-derived cells, including DCs and macrophages, is likely to play an important role in the differentiation and function of Ly-6C
hi monocytes [
73]. These notions support the increased accumulation of mature CD11b
+Ly-6C
hi monocytes in both inflamed CNS and lymphoid tissues of 4-1BB KO mice via enhanced responses of IFN-II-producing NK and CD4
+ Th1 cells and IFN-I innate responses in 4-1BB-deficient myeloid cells. In addition, activated microglia/macrophages in the CNS of 4-1BB KO mice showed higher expression levels of MHC II molecules that could be induced by IFN-γ produced from NK and CD4
+ Th1 cells [
61,
62]. Therefore, it is likely that mature CD11b
+Ly-6C
hi monocytes infiltrated into the CNS of 4-1BB KO mice exert a more effective regulatory effect in JE progression compared to those of wild-type BL/6 mice. To date, the roles of CD11b
+Ly-6C
hi monocytes in CNS inflammation caused by neurotropic viruses have not been clearly delineated due to conflicting results [
33‐
36]. CD11b
+Ly-6C
hi monocytes cause significant damage and destruction that exacerbate morbidity and mortality [
74,
75], whereas CNS infiltration of CD11b
+Ly-6C
hi monocytes plays a protective role during CNS inflammation [
33‐
36]. Because the enhanced infiltration of CD11b
+Ly-6C
hi monocytes in the CNS of 4-1BB KO mice correlates with better survival, our data support their beneficial role in JE progression. Although the detailed mechanisms by which infiltrated CD11b
+Ly-6C
hi monocytes regulate neuroinflammation caused by neurotropic viruses remain to be defined, it is thought that CD11b
+Ly-6C
hi monocytes exert regulatory functions through differentiation into DCs, macrophages, and microglia [
30‐
32]. In support, we found that the mature macrophage marker F4/80 was expressed in CD11b
+Ly-6C
hi monocytes of 4-1BB KO mice at much higher levels than in wild-type BL/6 mice. In addition, ablation of the 4-1BB/4-1BBL system may enhance the anti-pathogen response by induction of myelopoiesis, resulting in the generation of more myeloid cells that can enhance the strength and efficiency of anti-pathogenic immune responses [
76‐
78]. CD11b
+Ly-6C
hi monocytes are derived from BM, travel through blood and subsequently arrive at inflamed tissues, depending on expression of the CCR2 chemokine receptor [
30]. Thus, it is possible that CD11b
+Ly-6C
hi monocytes in a 4-1BB signal-ablated environment may be in greater supply in the CNS during JE progression.
The most intriguing result in this study was that DCs and macrophages derived from BM cells of 4-1BB-ablated mice showed potent and rapid IFN-I innate immune responses to JEV infection. This presumably promotes early clearance of the virus at the periphery, because DCs and macrophages are primary target cells for JEV infection. Although the detailed mechanisms behind enhanced IFN-I responses in DCs and macrophages derived from 4-1BB KO mice are not defined, our data suggest that the enhanced stimulation of intracellular PRRs (RIG-I, MDA5) and subsequent activation of their transcription factors (IRF7) may be involved in potent IFN-I innate immune responses in 4-1BB-deficient DCs and macrophages. In addition, the potent IFN-I response of DCs and macrophages derived from 4-1BB KO mice may be indirectly mediated by soluble factors produced from host cells by viral infection, i.e., DMAPs. We did not exclude the potential interaction of the 4-1BB signaling pathway with pathways of PRRs that recognize JEV infection in myeloid-derived cells. Considering that only a small fraction (10–20 %) of myeloid-derived cells are infected by JEV [
79], uninfected myeloid-derived cells are thought to contribute substantially to antiviral ISG induction through stimulation of IFNAR and their transcription factor STAT1, thereby inducing ISG49, ISG54, and ISG56 [
80]. In addition, somewhat interestingly, neuron cells derived from 4-1BB KO mice exerted increased IFN-I innate responses. However, different induction patterns of PRRs and their transcription factors between JEV-infected neuron and myeloid-derived cells indicate that specific types of cells differentially trigger IFN-I innate immune responses following JEV infection. Ultimately, despite the clear induction of potent and rapid IFN-I innate immune responses in 4-1BB-deficient myeloid cells and neurons, future studies will be required to delineate the mechanistic and functional intermediates that link and regulate IFN-I innate immune responses in the absence of the 4-1BB signaling pathway.
JE pathogenesis in the murine model may be altered by the route of administration, virus propagation conditions, or strain of virus [
11]. Although JEV infection via an i.p. route may not directly reflect natural infection mediated by the intradermal or subcutaneous route taken when an organism is bitten by mosquitoes, JEV introduced via an i.p. route shows entirely similar pathogenesis to a natural infection, due to peripheral amplification in the spleen. Furthermore, mice infected with JEV usually display a neurological disorder at 4–5 dpi. Thus, rapid innate immune responses, including IFN-I of myeloid cells and IFN-II of NK and CD4
+ Th1 cells, are more critical in controlling JE progression compared to delayed Ag-specific adaptive responses.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
SBK and SKE designed and analyzed the results and wrote the manuscript. SBK, JYC, JHK, EU, AMP, and YWH conducted the experiments. SYP, JHL, and KK contributed reagents/materials/analysis tools. All authors read and approved the final manuscript.