Background
Invasive cervical cancer is one of the leading causes of cancer-related death in gynecological tumors [
1‐
4]. The exploration of new strategies for diagnoses, treatment, and prognoses of cervical squamous cell carcinomas (CSCCs) merit special attention [
5]. About 80% to 90% of cervical cancers are squamous cell carcinomas [
6,
7], where the abnormal squamous cells develop and cover the surface of the cervix. Although 80%–95% of women with early-stage CSCC could benefit from traditional surgery and chemoradiotherapy, it remains hard to reduce the recurrence- and metastasis-related cancer death [
8‐
10].
MicroRNAs (miRNAs) are a class of short non-coding RNAs that negatively regulate the expression of their protein-coding mRNA targets [
11,
12]. Up to now, thousands of miRNAs in human have been discovered. Despite their relatively limited number, each individual miRNA can alter the expression of hundreds of targeted mRNAs [
13]. Therefore, miRNAs are considered as major regulators of many important biological processes including apoptosis, viral infection and cancer development [
14‐
17]. Whole genome analyses showed that approximately half of miRNA coding genes lie in fragile sites or in tumor-associated genomic regions [
18]. Recently, dys-regulation of microRNA expression has been found to be one of the abnormal events during the development of cervical cancer [
19‐
21].
miR-30d is fairly frequently overexpressed in many human epithelial cancers and functionally affects various tumor biological events such as proliferation, differentiation, metastasis, apoptosis, etc. [
22‐
25]. Consistently, the chromosome locus of MIR30D gene, 8q24, is also found frequently amplified by comparative genomic hybridization (CGH) detection in various types of somatic cancers [
26,
27].
Although overexpression of miR-30d in cervical cancers was reported in a previous study using a high throughput assay [
28], the case number was very limited (
n = 10). Importantly, the clinical significance of miR-30d in the progression of cervical cancers remains under-investigated. In this research, 136 sporadic CSCC tumor samples and their matched adjacent normal tissues (ANTs) were collected from a Chinese population. Copy number variations (CNVs) of MIR30D gene as well as expression levels of miR-30d were examined, and analyzed with clinical characterization. In-vitro studies were also performed to estimate the role of miR-30d in the cell proliferation and migration of CSCCs. Our findings showed that amplified copy number of the MIR30D gene and/or up-regulated expression of miR-30d were positively correlated with CSCC disease progression, indicating that miR-30d plays as a critical oncomir in CSCC progression and could be a potential biomarker and therapeutic target for CSCCs.
Methods
Patients and tissue collection
Samples were taken from CSCC patients at the Department of gynecology and obstetrics, Peking University Shenzhen Hospital from June 2008 to July 2014. A summary of cohort characteristics was shown in Table
1. Tumors were staged according to the classification system: Stage 0 (The carcinoma is confined to the surface layer of the cervix; not included because it cannot be distinguished from CIN3), Stage 1 (The carcinoma has grown deeper into the cervix, but has not spread beyond it,
n = 35), Stage 2 (Cervical carcinoma invades beyond the uterus, but not to the pelvic wall or to the lower third of the vagina,
n = 78, IIa = 47, IIb = 31), Stage 3 (The tumor extends to the pelvic wall and/or involves lower third of the vagina and/or causes hydro-nephrosis or non-functioning kidney,
n = 16) and Stage 4 (The carcinoma has extended beyond the true pelvis or has involved (biopsy proven) the mucosa of the bladder or rectum,
n = 7). Cases under Stage IIa (including IIa) were grouped into early-stage, whose samples were collected from surgery. Cases above IIb (including IIb) were grouped into advanced stage and received radiotherapy and chemotherapy, whose samples were collected from biopsy. The matched ANTs were defined as tissues located at least 1.5 cm far from the macroscopically unaffected margins of the tumor. The samples without qualified ANTs were excluded. All samples were rapidly frozen in liquid nitrogen immediately after excision and were stored in liquid nitrogen until use.
Table 1
Summary of the cohort characteristics
Age | Average age | 49.8 |
Range | 18 ~ 71 |
Risk factors | Multiple sex partners | 55 |
Multiparous or pregnant at youth | 26 |
First sex before 18 | 19 |
None of above | 36 |
FIGO Staging | I | 35 |
II | 78 |
III | 16 |
IV | 7 |
HPV infection | High risk (HPV16, 18 or both) | 99 |
Other HPVs | 37 |
Lymph node metastasis(LNM) | With LNM | 33 |
Without LNM | 103 |
Smoking history | Yes | 21 |
No | 115 |
RNA extraction and quantitative real-time PCR (qPCR)
Total RNA from tissues or cell lines was isolated in accordance with the manufacturer’s instruction of the AxyPrep™ Blood Total RNA MiniPrep Kit (Axygen). Then the first-strand cDNA was synthesized by reverse transcription with the RevertAid™ First Strand cDNA Synthesis Kit (Fermentas). And the primer for reverse transcription of miR-30d is: 5′-GTC GTA TCC AGT GCA GGG TCC GAG GTA TTC GCA CTG GAT ACG ACC TTC CA-3′.
Bio-Rad iQ™ SYBR Green Supermix real-time PCR kit and CFX96 Detection System was used to perform qPCR. The quantitative primer pair for miR-30d is: forward: 5′-GCA TTG TAA ACA TCC CCG AC-3′, and reverse: 5′- GTG CAG GGT CCG AGG TAT TC-3′. Melt curves were produced for product identification and purity at the end point of PCR cycles. Because of the near-100% amplification efficiencies of all targeted genes, qPCR results were calculated using 2
−ΔΔct method. miR-30d expression level in each sample was analyzed using Bio-Rad CFX Manager software and normalized to the expression of U6. The expression levels of the target miRNAs or mRNAs were visually identified using exploratory data analysis with scatter plots [
29]. Each quantitative reaction was replicated twice, and the average value was used in the scatter plot. Other primer pairs for the targeted mRNA are listed in Table
2.
Table 2
Primer sets for the targeted mRNAs
ATG12 | TTGTGGCCTCAGAACAGTTG | GAGAGTTCCAACTTCTTGGTCTG |
GNPDA1 | TGCCTGTTTGAAGCTACTGC | ACCAAACATAGCCCTTAGGC |
CASP3 | AGGACTCTAGACGGCATCCA | TGACAGCCAGTGAGACTTGG |
CCNE2 | TAATAAGGCTTAGATGAACATGGTG | AGTTAGGAAGGAGCCACAGC |
GALNT1 | TTGTGCCTAAGAATGTTTCCA | CCCATGTGCTTGATGTTGAT |
GNAI2 | GACCATCTGCTTCCCTGAGT | TGGTGTCTTTGCGCTTATTC |
FOXO3 | TGATTTGAAGCACCTCATCC | TTAAGAAAGGCGGCAGAGTT |
SNAI1 | TCTGGTTCTGTGTCCTCTGC | GACAGGCCAGCTCAGGAAT |
SOCS1 | CGACTACCTGAGCTCCTTCC | AACACGGCATCCCAGTTAAT |
SPRR2D | CTGTAGTACACATCACTTGTGGC | ACTTGCATCCCAGGACAGAT |
GAPDH | TCCAAAATCAAGTGGGGCGA | TGATGACCCTTTTGGCTCCC |
ACTB | GACCTGACTGACTACCTCATGAAGAT | GTCACACTTCATGATGGAGTTGAAGG |
DNA extraction and quantification of copy numbers
The method of copy number calculation has been introduced previously [
30,
31]. Genomic DNA was prepared from tissues following the protocol of the Genomic DNA Extraction Kit (Innocent, Shenzhen, China). Quantitative PCR was performed through Bio-Rad CFX96 Detection System. The relative copy numbers of MIR30D were normalized to RNAse P gene (copy numbers =2) and analyzed by the comparative Ct method. The copy numbers as 0, 1, 2 and 3 were respectively defined by cut-off values of 0.25, 0.75, 1.25 and 1.75. The primer pair, forward: 5′-GAT GAT GAC TGG CAA CAT-3′ and reverse: 5′-GAA TAG CCG GTA GCA GCA-3′, was used for the detection of MIR30D. And the primer pair for RNAse P is: forward: 5′-AGA CTA GGG TCA GAA GCA A-3′ and reverse: 5′-CAT TTC ACT GAA TCC GTT C-3′. The relative copy number fold-change was calculated using the 2
−ΔΔCt method.
Fluorescence in situ hybridization (FISH) analysis
CSCC tissues and matched ANTs were collected in pairs as stated before, and ten pairs (5 with MIR30D amplification, 5 with unaltered MIR30D copy number) were selected for FISH analysis. The tissue was minced into single-cell suspension with a scalpel after treatment with 0.075 M KCl for 10 min. Then the cell suspension was fixed in a fixative (3:1 ratio of methanol and acetic acid). Target slides were prepared by dropping the suspension of isolated fixed nuclei on a glass slide, and slides were fixed in 70 °C steam and denatured in 2× SSC/70% formamide, pH 7, at 75 °C for 5 min and dehydrated in graded ethanol.
FISH detections were performed with dual-labeling hybridization using a directly labeled centromere probe for chromosome 8 (Spectrum Green-labeled) together with a probe for the MIR30D locus (8q24.22; Spectrum Orange-labeled). After denatured at 75 °C for 5 min, probes were hybridized onto the target slides overnight at 37 °C. Then these slides were washed with 50% formamide/2× SSC for 10 min three times, 2× SSC for 5 min, and 2× SSC/NP40 for 5 min at 45 °C. After washing, the slides were counterstained with 1 μg/ml DAPI, and signals for each locus-specific FISH probe were assessed using an Olympus microscope equipped with a triple band pass filter. At least 300 nuclei were examined in each sample. FISH signals were counted and recorded as 0, 1, 2, 3, 4, 5, or more signals for each probe.
Cell culture and proliferation assay
Human cervical cancer cell lines HeLa, C4–1, SiHa, Caski and C-33A were obtained from the Cobioer Biosciences Co., Ltd. (Shanghai, China) and grown in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplemented with 10% FBS (PAA) and 1% penicillin/streptomycin (Life Technologies, Inc.) at 37 °C and 5% CO2.
WST-1 measurement was used to detect cell proliferation. Cells transfected with mimic, inhibitor or non-sense strand were seeded onto 96-well culture plates with 1 × 103 cells per well, The proliferation of cells was tested using the colorimetric reagent WST-1 (Roche) at different time points (0, 1, 2, 3, 4, and 5 days).
Cell invasion assay
Invasion assays were done using 24-well transwell chambers (8 μm pore size; BD Biosciences). After incubation with 1% BSA for 1 h at 37 °C, transwells were coated with fibronectin (10 mg/ml in PBS) overnight at 4°C. Meanwhile, SiHa and HeLa cells were transfected with miR-30d mimic, inhibitor or control strand for 24 h. Then the cells were collected by trypsin-EDTA digestion, washed once in 10% FBS/DMEM, and resuspended in 1% FBS/DMEM at 2 × 105 cells/ml. And the cell suspensions were equivalently added to the upper compartment of each chamber (100 μl per chamber). Following 12 h incubation, the non-invaded cells on the upper surface of the membrane were removed with a cotton swab, whereas the cells that had invaded through the membrane to the underside surface were fixed by 3% formaldehyde and stained with 0.3% crystal violet for 10 min. The cells on the underside of the membrane were counted and the number of cells in five different fields (×100 magnification) was used to quantify cell invasion. Data represent the average ± SD of three independent experiments.
Retroviral transduction
Each retroviral vector and the pLC 10A1 retroviral packaging vector (Imgenex, San Diego, CA, USA) was co-transfected into HEK293T cells using the Lipofectamine LTX reagent (Invitrogen). After 24 h, the conditioned medium was collected as a viral solution. The retroviral vectors were infected into the cells in the medium that contained 10 μg/mL polybrene (Sigma, St. Louis, MO, USA) and allowed to incubate for 24 h. Then, the viable cells were selected using 800 μg/mL neomycin (G418; Invitrogen). The selected pooled clones were used in the biological analyses. The transfection efficiency was determined using qPCR analysis.
Generation of the in vivo xenograft model
Five-week-old male nude mice were used in this study. Subconfluent HeLa and SiHa cells were transduced with miR-30d-blocking or control viral vectors, trypsinized, and suspended in Phosphate-buffered saline (PBS). Then, the cells were subcutaneously injected into the right (to inhibit miR-30d) and left (control) flanks of the same mice. HeLa was subcutaneously injected at a concentration of 1 × 106 cells. SiHa cells were subcutaneously injected as a mixture of 2 × 106 cells and an equal volume of Matrigel (BD Biosciences), reaching a total concentration of 10 mg/mL (15 mice each group). Tumor growth was followed for 42 days after tumor cell injection. Moribund animals were euthanized according to the protocols of the Peking University Health Science Center. Each xenograft tumor volume was calculated using the following formula: tumor volume = (short axis2 × long axis)/2.
Gene expression studies
Gene expression profiles were obtained by using Affymetrix GeneChip® Probe Arrays. According to the manufacturer’s instructions, the total RNA was isolated from each sample (prewashed by 50 mM potassium phosphate buffer, pH 7.4) with RNeasy Mini Kit (Qiagen). And Bioanalyzer 2100 (Agilent Technologies, US) was applied to confirm the quality of extracted RNA. The DNA microarray data were was produced by Bio Matrix Research (Chiba, Japan).
GeneSpring software package (Agilent Technologies, US) was used for statistical analysis, and online tools of the Munich Information Center for Protein Sequence (MIPS) was used for the pathway- or function-based classification. Gene expression data have been submitted to the Gene Expression Omnibus (GEO;
http://www.ncbi.nlm.nih.gov/geo).
Statistical analysis
The categorical data were analyzed for statistical significance by chi-square test or Fisher exact test, or analysis of variance (ANOVA). All the above mentioned analyses were performed using GraphPad Prism 5.0 statistical software and p-values less than 0.05 were considered statistically significant.
Discussion
Besides identification and functional annotation of miRNAs, investigation of transcriptional regulation of miRNA genes should also be one of the notable issues. In the present study, we found that copy number variation also played a role in the dysregulated expression of cancer-microRNA in CSCCs. The amplifications of MIR30D (22.8%, 31 out of 136) were found in collected CSCC samples. Given that no statistical difference of MIR30D CNVs between HNCs and ANTs was observed, the CNVs of MIR30D were more likely to acquire aberrations in CSCC tumor tissues. However, the frequency of MIR30D gene copy number gain was lower than previously reported proportions of chromosomes 8q24 gain as 36–57% in somatic cancers [
7,
38,
39]. This discrepancy might be due to the limited region of MIR30D gene on chromosome 8q24 which is less influenced by repeated replication during tumor progression. Amplifications of MIR30D were mainly found in advanced CSCCs, indicating that the increase of MIR30D copies might occur in the progression but not the initiation of CSCCs and may contribute to tumor aggressiveness. We also found that CSCCs with LNM showed more frequencies of MIR30D amplification than those without LNM, which indicated the potential association between MIR30D amplification and CSCC metastasis. Interestingly, in 2 cases with LNM, we found that the copy numbers of MIR30D were increased in LNMs compared to primary tumor. Did the copy number gain of MIR30D take place in migrating cells at the initiation of metastasis or later in the lymph node in these 2 cases? This needs further investigation.
Microarray-based comparative genomic hybridization (aCGH) analyses have shown that CNVs may directly or indirectly make a healthy body susceptible to cancer by altering the expression of oncogenes or tumor suppressor genes. Detection of the CNVs status is just a starting point for investigations into the role of such gene alterations in the development of cervical cancer. However, there are many discrepancies among the results obtained from the previous high-throughput studies of CNVs. Therefore, it is necessary to validate these CNVs in a large number of clinical samples. Furthermore, the detection sensitivity could also be improved by using sequence specific quantitative PCR to examine short DNA fragments of hundreds of base pairs.
Although it has been thought that cell phenotype is well correlated with the genotype of CNVs [
40,
41], our study on the correlation between expression of miR-30d and copy numbers of MIR30D gene showed discordant findings. Compared to ANTs, the expression of miR-30d in CSCC tissues was increased in both groups with or without MIR30D amplification. Thus CNVs were not the only motivating factor for over-expression of the miR-30d in CSCCs. Some other mechanisms could be involved in the transcriptional regulation of miRNA expression. For instance, CpG island hyper-methylation have been reported to be involved in the regulation of miR-30d expression in somatic malignancies.
In the in-vitro and in-vivo studies, we showed that amplification and up-regulation of miR-30d promoted CSCC growth and metastasis, which further indicated the important role of miR-30d de-regulation in the progression of CSCC. As a non-coding RNA, miR-30d must mediate its tumor-promoting role through suppression of special targets. Here we also screened several key targets of miR-30d that might be involved in this progress. In the genes suppressed by miR-30d over-expression, most are tumor-suppressing genes that were down-regulated by miR-30d transfection. However, several target genes, such as CCNE2 and SNAI1, are positively correlated with tumorigenesis. These indicated the complex role of microRNAs in influencing tumorigenesis.
Acknowledgements
Not applicable.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (
http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.