Introduction
Liver cancer is the sixth most prevalent cancer and the fourth leading cause of cancer-related deaths worldwide [
1]. Hepatocellular carcinoma accounts for nearly 85–90% of liver cancer [
2]. Immune checkpoint blockades (ICBs) have shown promising clinical success in many malignancies, including HCC [
3,
4]. However, it benefits only a limited subset of patients, with less than a 20% response rate for PD-1 inhibitor monotherapy in HCC [
5]. It was demonstrated that genomic alterations might dictate the phenotypic performance of tumours and influence the therapeutic sensitivity of the ICBs [
6]. Hence, understanding the regulatory role of genomic alterations may provide novel insight for developing innovative biomarkers as well as therapeutic strategies for cancer. Meanwhile, next-generation sequencing (NGS) revealed that different genomic alterations between HCC with contrasting pathological features should be treated differently [
7,
8]. Chronic infections with HBV are significant causes of HCC in sub-Saharan Africa and East Asia, which is entirely different from western countries [
9]. Therefore, we have mainly focused on HBV-HCC in the current study.
ARID1A encodes an essential subunit of the mammalian SWI/SNF chromatin remodelling complex. This domain is involved in multiple cellular processes, such as DNA replication, DNA damage repair, tumour metabolism [
10] and transcription [
11]. ARID1A is the most frequently mutated subunit of the chromatin remodelling complex and the most commonly mutated gene in cancers. ARID1A mutations occur in approximately 7% ~ 17% of HCC [
8,
12‐
14]. The majority of ARID1A mutations are loss-of-function mutations and thus result in ARID1A deficiency. Early research focused on the tumour suppressor role of ARID1A and ARID1A deficiency, which are associated with worse prognostic outcomes in various cancers [
15,
16]. However, increasing evidence has shown that ARID1A deficiency may modulate the tumour immune system, correlating it with better therapeutic outcomes of ICBs. These observations have highlighted that ARID1A might serve as a new biomarker for immunotherapy [
17‐
19]. In addition, ARID1A deficiency was associated with a higher TMB, more infiltrating lymphocytes, and increased PD-L1 expression in various tumours [
20,
21].Moreover, mice with ARID1A-deficient ovarian cancers showed a prolonged survival rate when treated with ICBs [
22]. Overall, both the clinical and preclinical evidence suggest that ARID1A deficiency might influence immune activity and synergistically enhance the effects of ICBs.
In this study, we focused on HBV-HCC, the most important prevalent subtype of HCC. We used bioinformatics approaches and preclinical experiments to evaluate the ARID1A regulatory role in the biological behaviors and immune modulation of HBV-HCC and its potential immunotherapeutic implications.
Materials and methods
Data
Three datasets were explored in this study. In the CHCC-HBV cohort, patients were selected as hepatitis B core antibody (HBcAb) and hepatitis B surface antigen (HBsAg) positive. A total of 150 patients were enrolled in the analysis, among which 15 patients had ARID1A deficiency, as they carried loss-of-function mutations or copy number deletions in ARID1A. The expression data were downloaded from
https://www.biosion.org [
7]. The mutation data were obtained from the supplementary information of the CHCC-HBV study [
23]. For the TCGA-LIHC cohort, the infection status of HBV was obtained from two studies, which contained 44 and 87 HBV patients [
12,
23]. A total of 108 HBV-infected patients were enrolled from the TCGA-LIHC cohort after removing duplicates and patients with mutations or missing clinical information. For the AMC cohort, only 167 patients identified to have HBV infection were included in this study [
24]. All the original data can be downloaded at cBioPortal (
https://www.cbioportal.org). Overall, 425 HBV-related hepatocellular carcinoma patients were enrolled in the study. The clinical information of patients included in this study can be found in Supplementary file S
1.
Tumour Mutation Burden (TMB)
Tumour mutation burden was calculated as the number of nonsynonymous mutations per targeted sequencing length. The exon length from the TCGA cohort was estimated as 38 Mb [
25], while the CHCC and AMC cohorts used the Agilent SureSelect 50 Mb system to capture the exon area [
7,
24].
Gene set enrichment analysis
Based on the Molecular Signatures Database (MSigDB), gene set enrichment analysis (GSEA) was performed to correlate the CHCC-HBV cohort grouped by ARID1A mutation status to the known hallmark gene expression signatures. The normalized gene expression of the CHCC-HBV cohort was taken as the input. We followed the GSEA user’s guide using default parameters to run the software. An FDR corrected q-value < 0.05 was considered statistically significant.
Immune cell infiltration level analysis
The immune infiltration level was estimated by single-sample GSEA using the Gene Set Variation Analysis (GSVA) program against the gene signatures representing immune cell populations (Supplementary file S
2). In addition, the immune infiltration status of the tumour purity, immune components, and overall stromal status in the CHCC-HBV cohort was computed using ESTIMATE.
Cell culture and CRISPR knockout
The human hepatocellular carcinoma cell lines Hep3B and SK-HEP-1 were purchased from ATCC. Cells were grown in Dulbecco’s modified Eagle medium (Gibco™; Thermo Fisher Scientific, MA, USA) supplemented with 10% foetal bovine serum (Gibco™; Thermo Fisher Scientific) and 1% penicillin‒streptomycin (Gibco™; Thermo Fisher Scientific) and maintained in a humidified incubator at 37 °C with 5% CO2. Hep3B and SK-HEP-1 cells stably expressing Cas9 were established by lentiviral transduction with Cas9 plasmids (Lenti-Cas9-2A-Blast, 73310; Addgene).
ARID1A knockout lentiviral plasmids were synthesized and purchased from GenePharma (Beijing, China). Plasmid psPAX2 (12260; Addgene), pmd2G (12259; Addgene), and ARID1A Knockout lentiviral plasmids were cotransfected into 293 T cells by PEI (Proteintech, #PR40001). First, Hep3B and SK-HEP-1 cells were infected with lentivirus containing polybrene (10 μg/ml) (TR-1003; Sigma‒Aldrich) for 24 h. Then, positive cells were selected with 100 μg/ml hygromycin B. The efficiency of ARID1A knockout was confirmed by Western blotting.
The sgRNA sequences were as follows:
-
ARID1A-sgRNA1: 5’- CAGCAGAACTCTCACGACCACGG -3’ (Exon 1),
-
ARID1A-sgRNA2: CCTGTTGACCATACCCGCTGGGG -3’ (Exon 3)
The siRNA duplexes and negative control were synthesized and purified by GenePharma. (Beijing, China). Briefly, HepG2/2.2.15 cells were transfected with negative control siRNA using Lipofectamine™ 3000 (#L3000001; Invitrogen) according to the manufacturer’s instructions. Knockdown efficiency was tested by Western blot analysis 48 h after transfection. siRNA sequences used for ARID1A knockdown can be found in Supplementary file S
3.
Western blot
Lysis buffer (R0010–100 ml, Solarbio) was used to extract proteins from Hep3B and SK-HEP-1 cells. Cells were washed twice with ice-cold PBS, and then protein lysates were separated by 12.5% SDS‒PAGE at 120 V for 70 min (Omni-Easy™ One-Step PAGE Gel Fast Preparation Kit, PG213; EpiZyme, Shanghai, China) and transferred to PVDF membranes (IPVH00010; Merck Millipore) with transfer buffer plus 10% methanol on ice at 300 mA for 2.5 h. (Transfer Buffer (10x), PS109; EpiZyme, Shanghai, China). Subsequently, the membranes were blocked in 5% skim milk for 1 h and incubated overnight with antibodies against ARID1A (rabbit monoclonal antibody, 1:1000, HPA005456; Sigma‒Aldrich) followed by secondary antibodies (goat anti-rabbit IgG H&L (HRP), ab6721; goat anti-mouse IgG H&L (HRP), ab6789; Abcam). β-Actin (mouse monoclonal antibody, 1:2000; ab8226; Abcam) was used as the loading control. Images were visualized using chemiluminescent horseradish peroxidase substrate (WBKLS0100; Merck Millipore) on Bio-Rad Gel Doc 2000 system analysis software (Bio-Rad Laboratories, Inc., Hercules, CA).
RNA extraction and real-time quantitative PCR
Total RNA was isolated from harvested cells using TRIzol reagent (Invitrogen, Thermo Fisher Scientific). cDNA synthesis was performed with 1 μg of total RNA using PrimeScript RT Master Mix (RR036;ATakara). In addition, quantitative reverse transcription-PCR (qRT‒PCR) was performed using TB Green® Premix Ex Taq™ II (RR820A; Takara) on a quantitative PCR machine (qTOWER3G, Analytik Jena, Jena, Germany). The primers used for qPCR are listed in Supplementary file S
3.
Cell proliferation analysis
The effects of ARID1A deficiency on HCC proliferation were assessed by using a Cell Counting Kit-8 (CCK-8) (HY-K0301; MedChemExpress) and clone formation assays. Hep3B, SK-HEP-1 wild-type cells, and knockout cells were collected and seeded in a 96-well plate (3,000 cells per well). In addition, 10 μL of CCK-8 solution was added to each well at 24 h, 48 h, 72 h, and 120 h. The optical density (OD) of each well was measured (EnSpire, PerkinElmer, CA, USA) at 450 nm 2 h after incubation. For clone formation, 2000 cells were seeded into a six-well plate and cultured for 2 weeks or more. The cells were then fixed with Paraformaldehyde Fix Solution for 30 min and stained with 0.1% crystal violet for 15 min. At least three replicate samples were analysed for all assays.
Cell migration and invasion assay
Transwell migration and invasion assays were performed using 8-μm-pore inserts (Corning Incorporated Costar, Tewksbury, USA). For the migration assay, cells (5 × 104 cells per well) were seeded into the upper chamber directly with serum-free medium. For the invasion assay, the inserts were coated with 50 µL of Matrigel (Solarbio, Beijing, China), and 600 µL culture medium containing 15% FBS was added to both lower chambers. Migrated or invaded cells were stained with 0.1% crystal violet 24 h after culture and counted in three random fields under light microscopy in a 100 × scope.
Immunohistochemistry
We retrospectively reviewed the data of 19 consecutive HCC patients admitted to the oncology department of Peking University International Hospital between 1 April and 30 September 2020 and performed next-generation sequencing of tumour tissues. Three patients had ARID1A mutations. Paraffin sections from HCC patients were baked at 60 °C for 2 h, deparaffinized, and hydrated with xylene and graded alcohol. Heat-based antigen retrieval was performed using citrate or EDTA-containing buffer. Hydrogen peroxide (3%) was used to block endogenous peroxidase in tissues, which were then incubated with primary antibodies against ARID1A (rabbit monoclonal antibody, 1:100, HPA005456; Sigma‒Aldrich), TIM-3 (rabbit monoclonal antibody, 1:200, ab241332; Abcam), CD8 (rabbit monoclonal antibody, 1:200, ZA-0508; Zhongshan Goldenbridge) and CD56 (rabbit monoclonal antibody, 1:200, ZM-0057; Zhongshan Goldenbridge) overnight. Furthermore, the slides were incubated with polyperoxidase-anti-mouse/rabbit IgG (PV-9000; Zhongshan Goldenbridge) for 30 min. Finally, the slides were stained with DAB and haematoxylin. For each section, three random fields were captured under light microscopy (Carl Zeiss, Primovert, NY) (100 × scope; 200 × scope) and analysed by ImageJ software.
Flow cytometry
Flow cytometric analysis was performed to determine the effects of ARID1A deficiency on galectin-9 expression. Cells were collected and washed twice with ice-cold PBS and then incubated with Alexa Fluor® 488 anti-human Galectin-9 Antibody (348918; Biolegend) for 15 min. Finally, Galectin-9 expression was detected using FCM (FACS Calibur flow cytometer, BD Biosciences) and analysed using FlowJo software.
Statistics
Two-sided Fisher’s exact tests and Mann‒Whitney U tests were applied to compare the two groups. Overall survival was estimated by Kaplan‒Meier analysis. R 3. 6. 1 package was used for all analyses. Preclinical experiments and data analyses were performed using GraphPad Prism v8.0. Statistical significance was determined by Student’s t test between two groups. P < 0.05 was considered statistically significant.
Discussion
Exploring predictive biomarkers and therapeutic strategies for ICBs has become an urgent need in clinical practice. Increasing evidence indicates that genomic alterations inside tumour cells determine their phenotypic performance and the surrounding microenvironment. Therefore, such genes might be explored as predictive biomarkers for prognostic and therapeutic outcomes. ARID1A is a subunit of the SWI/SNF family and is involved in various cellular processes. The effects of ARID1A deficiency potentiate therapeutic antitumour immunity and thus might serve as a predictive biomarker for ICB therapy outcomes. The plausibility of ARID1A as a biomarker was confirmed by Jiang et al. through pan-cancer analysis using an online database [
18]. As ARID1A is one of the most frequently mutated genes in HCC and ICBs, it has become one of the main treatment options for HCC. Therefore, in the present study, we explored the immune-modulating role of ARID1A deficiency in HBV-HCC and its potential immunotherapeutic implications.
Consistent with previous reports [
26], we confirmed the tumour-suppressive effect of ARID1A using bioinformatics approaches and preclinical experiments. Furthermore, ARID1A deficiency promoted growth, migration, and invasion. These results imply a more aggressive biological feature and worse overall survival of HBV-HCC with ARID1A deficiency.
Previously, we conducted genome-wide next-generation sequencing of 81 HCC tissue samples and found that ARID1A alterations were significantly correlated with a higher tumour mutation burden in HCC [
32]. In this study, the TMB of HBV-HCC with ARID1A deficiency was significantly higher than the TMB of HCC without ARID1A deficiency. Apart from our study, ARID1A deficiency was observed to induce a similar MMR phenotype, correlating with microsatellite instability-high (MSI-H) and higher TMB (TMB-H) in ovarian cancer [
22]. In gastric cancer, ARID1A deficiency was correlated with dMMR and increased expression of PD-L1 [
33]. The ARID1A deficiency resulted in its inability to recruit MSH2 to chromatin during DNA replication, compromising the MMR and increasing mutagenesis [
22]. In addition, ARID1A has synthetic lethal effects with PARP inhibitors and ATR inhibitors. These effects were synthetically lethal with mutations in the DDR pathway, such as BRCA1/2, indicating a tightly intertwined relationship between DDR and ARID1A deficiency [
34,
35]. For the first time, we reported that HBV-HCC with ARID1A deficiency had a higher mutation rate in the DDR pathway. This might be an alternative mechanism of DDR impairment and TMB-H in ARID1A deficiency in HBV-HCC.
Furthermore, the present study revealed that HBV-HCC with ARID1A deficiency had a higher level of immune cell infiltration in tumour tissues, which is characteristic of the so-called “hot tumour” and is more prone to ICBs [
33]. In addition, CD8 + cytotoxic T lymphocytes, the main executors of antitumour immunity, and other kinds of immune cell enrichment, such as natural killer cells (NK cells) and dendritic cells (DCs), also accumulated in the ARID1A-deficient group. These cells are critical for antitumour effects through antigen presentation, cytokine secretion, lymphocyte chemotaxis, etc. [
36,
37]. In addition, GSEA showed multiple enriched immune-related pathways, including the IL6 and IFN-γ signalling pathways, in ARID1A-deficient HBV-HCC, which are important for antitumour activity conducted by immune cells, especially T lymphocytes. These results suggest that ARID1A deficiency is associated with elevated therapeutic immunity in HBV-HCC. Therefore, consistent with studies of other tumours, it might serve as a predictive biomarker for ICB treatment.
T-cell dysfunction is a major mechanism for immune escape. Hence, most current immunotherapeutic strategies act on reactive T cells to exert antitumour effects. However, in addition to the expression of several immune checkpoints, including PD-1, PD-L1, and CTLA4, TIM-3, another inhibitory immune checkpoint expressed in T cells has been investigated to induce tumour infiltrating CD8 + T lymphocyte exhaustion in HCC [
38]. For the first time, we reported that ARID1A deficiency was correlated with the increased expression of TIM-3. In contrast, the expression of Galectin-9, which is the ligand of TIM-3, could also be upregulated in ARID1A knockout Hep-3B or knockdown HepG2/2.2.15 cell line but not in the SK- HEP -1 cell line. Hep-3B and HepG2/2.2.15 is the HBV-positive HCC cell line, while SK-HEP-1 is not. This observation implied that the activity of the TIM-3/Galectin-9 pathway was upregulated only in HBV-HCC. Thus, the combined blockade of PD-1/PD-L1 with TIM-3 might be a better option to revitalize the antitumour activity of infiltrating T lymphocytes in HBV-HCC with ARID1A deficiency. Furthermore, NSCLC patients whose disease progressed after treatment with PD-1 inhibitors showed higher expression of TIM-3. Importantly, the TIM-3 antibody could overcome resistance to PD-1 blockade in mouse models of lung cancer [
39]. Therefore, the increased activity of the TIM-3/Galectin-9 pathway might be one of the mechanisms for primary or secondary drug resistance during ICB therapy. Therefore, combining inhibition of both pathways might be a promising strategy to overcome the drug resistance of PD-1/PD-L1 inhibitor monotherapy in HBV-HCC patients with ARID1A deficiency.
For predicting the therapeutic efficacy of ICBs, PD-L1 expression, tumour-infiltrating lymphocytes, TMB, dMMR, and MSI-H are the most commonly explored biomarkers [
36]. However, it has several limitations in clinical practice. First, there is spatiotemporal heterogeneity in PD-L expression. The immunohistochemical staining of PD-L1 might be inaccurate; the testing range and optimal threshold for defining the positivity of TMB are still unknown; next-generation sequencing (NGS) for determining the TMB and MSI-H is expensive and time-consuming. Second, the predictive value of these markers is very limited in HCC. Furthermore, dMMR expression was observed in only 2–3% of HCC [
40], although the positive expression of PD-L1 was as high as 42–75% in HCC. Moreover, PD-L1 positivity (in terms of TPS) and the therapeutic efficacy of PD-1 antibodies were not significantly correlated in either the KEYNOTE 240 or CheckMate-040 study [
5]. There is an urgent need to explore biomarkers applicable to clinical use in HCC. Considering the malignant biological features of the tumour, including the immune escape capability of tumour cells due to its genetic alterations [
37], it is logical to hypothesize that genetic alterations within tumour cells might be the vital underlying factors that shape the tumour immune fate by driving specific immune-related pathways. For example, WNT/β-catenin pathway activation could lead to ICB therapy resistance in melanoma by inducing the absence of tumour-infiltrating lymphocytes and T-cell exhaustion [
38]. In addition, HCC with activating mutations in the WNT/β-catenin pathway also demonstrated worse median progression-free survival (mPFS) and median overall survival (mOS) for patients treated with ICBs [
39]. In our study, ARID1A deficiency greatly impacted multiple aspects of immune signatures in HBV-HCC. Therefore, ARID1A deficiency may serve as a stand-alone or combined predictive marker for ICB therapy in HBC-HCC.
Our study had several limitations. First, most results were based on bioinformatics approaches and in vitro experiments. In vivo experiments and data from clinical practice are required to further validate our study's results. Second, the underlying mechanisms of ARID1A interacting with this immune signature are still unknown and need to be investigated further.
In conclusion, we confirmed the tumour-suppressive effect of ARID1A in HCC. For the first time, we have shown that ARID1A deficiency was correlated with more active immune signatures and higher expression of immune checkpoints in HBV-HCC. Furthermore, our study suggests that ARID1A deficiency might be a promising predictive biomarker for assessing the therapeutic outcomes of ICBs in HBV-HCC. The combination of TIM3 blockades and current therapeutic approaches might help achieve a superior response.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.