Background
Neovascularization is one of the hallmarks of cancer as it is a necessary process to provide tumor with its metabolic requirements, while simultaneously creating an escape route by which cancer cells will disseminate [
1,
2]. Thus, several angiogenesis inhibitors have been developed and most of them target vascular endothelial growth factor (VEGF) signaling [
3]. Today, VEGF inhibitors are included in first-line therapies against advanced and metastatic cancers [
4]. However, the lack of substantial improvements of overall survival and resistance issues clearly support the crucial need for identification of alternative and/or complementary targets for drug development [
5].
The transforming growth factor (TGF)-β family type I receptor ALK1 (activin receptor-like kinase 1), which is mainly expressed on endothelial cells, has been identified as a potential target for anti-angiogenic cancer treatment [
6,
7]. ALK1 is indeed an essential receptor in vascular development, as genetic ablation of
Acvrl1 (encoding ALK1) in mice results in embryonic lethality due to vasculogenic or angiogenic defects [
8,
9]. In addition, mutations of the genes
ACVRL1 and
ENG, encoding the co-receptor endoglin, are responsible of the Rendu-Osler syndrome also known as hereditary hemorrhagic telangiectasia (HHT) [
10,
11]. The discovery of the high affinity binding of BMP9 (bone morphogenetic protein) and BMP10 to ALK1 has revealed the key role of these two ligands in vascular development [
12,
13]. BMP9 and BMP10 are very similar at the amino-acids levels but they differ in several ways. First, the site of expression is different, as BMP9 is mainly produced by the liver [
14] while BMP10 is mostly produced by the heart [
15], although they are both detected in blood [
16,
17]. Second, although BMP9 and BMP10 both bind to the type I receptor ALK1 with high affinity, only BMP9 binds to ALK2 [
18] and their affinities for the type II receptors differ [
19]. Knockout mice for
Gdf2 (encoding BMP9) are viable and fertile with no overt defect in blood vessel development [
20] while
Bmp10−/− mice die during embryonic development due to heart defects [
21]. Still, we could show that
Gdf2-deficient mice present defects in lymphatic valve formation and lymph drainage, supporting a specific role for BMP9 in lymphatic maturation [
22]. Moreover, it was recently shown that BMP9 and BMP10 play redundant roles in retinal vascularization and ductus arteriosus closure [
17,
20,
23]. Together, these data clearly demonstrate, in vivo, the crucial roles of ALK1 and its two ligands, BMP9 and BMP10, in vascular development. However, their precise role during the complex process of physiological angiogenesis has proven difficult to pinpoint from in vitro studies, as their actions appear highly concentration- and context-dependent [
24].
Still, due to the key role of this pathway in angiogenesis, ALK1 has been identified as an interesting target in tumor angiogenesis [
6,
25]. Pharmacological targeting of ALK1 has been evaluated using either a neutralizing anti-ALK1 antibody (PF-03446962) or a soluble form of ALK1 (Dalantercept) that will trap the biological ligands of ALK1, BMP9 and BMP10 [
26,
27]. Most of the published preclinical studies, using these neutralizing tools, reported a decrease in tumor volume, tumor angiogenesis and metastasis [
28‐
30]. Thus, several phase I/II studies using these agents are currently being conducted. However, despite being generally well tolerated, no efficacy of ALK1 blockade has been demonstrated to date [
5,
25,
31,
32].
Little is known about the respective roles of BMP9 and BMP10 in tumor angiogenesis, cancer development and metastatic dissemination. BMP9 has been shown to play, via ALK2, a direct role on tumor growth as an autocrine growth factor in hepatocarcinoma [
33]. The roles of BMP9 and BMP10 have also been studied in different cancers using tumor cells overexpressing either BMP9 or BMP10 [
34‐
37], although BMP9 and BMP10 are not or moderately expressed in most of the tumors that have been studied so far. In these studies, BMP9 and BMP10 were described as tumor suppressors acting directly on cancer cells but their roles in tumor angiogenesis have not been investigated.
Herein, we studied the respective roles of BMP9 and BMP10 in tumor growth, tumor angiogenesis and metastatic dissemination using the murine syngeneic orthotopic mammary cancer model (E0771) [
38,
39]. To understand the contribution of BMP9 and BMP10 ligands, we made use of
Gdf2-deficient mice, inducible
Bmp10-deficient mice and double
Gdf2- and Bmp10-deficient mice. Our study demonstrates a specific role for BMP9 in tumor growth, tumor angiogenesis and lung metastasis in the E0771 model.
Bmp10 deletion did not significantly affect this mammary model, and the double deletion did not lead to a stronger phenotype than the single deletion of
Gdf2.
Methods
Cell lines
E0771 (Tebu-Bio) breast cancer mouse cells were maintained in culture in RPMI-1640 (Life Technologies) supplemented with 10% fetal calf serum (FCS) and were used below passage 5. Mouse endothelial cells H5V (gift from Dr. A. Mantovani) were maintained in culture in DMEM 4.5 g/L glucose (Life Technologies) supplemented with 10% FCS. Breast epithelial cells EpH4 (Clone J3B1A, a gift from Dr. P. Soulie) were maintained in culture in DMEM/F12 (Life Technologies) supplemented with 10% FCS. All cells were tested for Mycoplasma (MycoAlert™ PLUS, Lonza).
Gdf2−/−, Bmp10-cKO and double-KO (Gdf2−/−and Bmp10) mice
Gdf2−/−mice generation was previously described [
20]. To circumvent the early embryonic lethality of
Bmp10-KO mice [
21], the Institut Clinique de la Souris (Illkirch, France) generated for us a
Bmp10lox/lox mice by flanking loxP sites around exon2. These mice were then crossed with the Rosa26CreER
T2 mice provided by Pr. P. Chambon (IGBMC, Illkirch, France) [
40] to generate conditional knockout mice for
Bmp10 (
Bmp10-cKO mice). Intraperitoneal injections of tamoxifen (1 mg) were performed for five days in 3-week-old control (
Bmp10lox/lox) and
Bmp10-cKO (Rosa26CreER
T2;
Bmp10lox/lox) in order to delete
Bmp10. Rosa26CreER
T2;
Bmp10-cKO mice were crossed with
Gdf2−/− mice to generate
Gdf2−/−;Bmp10lox/lox that will be referred to as double-KO mice. The same protocol as for
Bmp10-cKO mice was used to delete
Bmp10.
Bmp10-cKO mice were maintained in the C57BL/6 background. All mice described were viable and fertile.
Orthotopic syngeneic mammary tumor models
For the E0771 model, 105 cells were injected orthotopically into the fourth mammary fat pad of isofluran-anesthesized C57BL/6 CTL and KO females at 6 weeks of age. Mice were euthanized at 9 weeks of age 10 min after intravenous injection of 50 μL of tomato lectin (DyLight 488 Lycopersicon esculentum, DL-1174, Vector Laboratories, 1 mg/mL). Tumor size was measured with calipers, and the volume was calculated according to the formula (L*w2)/2 where L and w stand for length and width respectively.
Tissue preparation and immunostainings
Tumors were fixed in 4% paraformaldehyde over night at 4 °C and embedded in Tissue-TekR OCT™ compound (optimum cutting temperature) (Sakura) for frozen sections or in paraffin.
For immunohistochemistry, paraffin-embedded sections were deparaffinized and rehydrated followed by citrate antigen retrieval. Blocking was performed in 2% BSA in TBS. Sections were stained using antibodies to PCNA (dilution 1:6000; Abcam [PC10] Ab29) and active caspase-3 (dilution 1:1000; R&D Systems AF835). Appropriate biotinylated secondary antibodies were used (Vector Laboratories). Sections were incubated with an avidin-biotin complex (Vectastain ABC kit; Vector Laboratories) and staining revealed by addition of 3.3′-diaminobenzidine (Liquid DAB+ Substrate Chromogen System; Dako). Counterstaining was performed using hematoxylin or fast nuclear red. Images were acquired with a Zeiss Axioplan microscope and analyzed using Axiovision 4.8 software.
For immunofluorescence, frozen sections were fixed in 4% paraformaldehyde and permeabilized in 0.5% triton in PBS. Blocking was performed in 2% BSA in PBS. Sections were stained using antibodies to podocalyxin (dilution 1:50; R&D Systems AF1556), FITC (dilution 1:100; Alexa Fluor 488 conjugated; Jackson Immunoresearch Laboratories [1F8-1E4] 200–542-037), α-SMA (dilution 1:200; Cy3 conjugated; Sigma Aldrich [1A4] C6198) and LYVE-1 (dilution 1:100; R&D Systems MAB2125). Appropriate secondary antibodies conjugated with fluorochromes were used (Jackson Immunoresearch Laboratories). Apoptosis was analyzed by the indirect TUNEL (Terminal deoxynucleotidyl transferase dUTP nick end labeling) method (ApopTag® Red In Situ Apoptosis Detection Kit from Millipore). Nucleus were stained using Hoechst blue (33,342, Sigma). Images were acquired with a Zeiss ApoTome microscope, treated using Zen Blue software and analyzed using ImageJ software.
For necrosis quantification, paraffin-embedded sections were stained with hematoxylin and eosin. Images were acquired using AxioScan Z1 (Zeiss) slide scanner and analyzed using Zen Blue software.
All quantifications were performed by assessing 3 to 5 images per tumor using ImageJ software.
After being inflated using 4% paraformaldehyde, lungs were embedded in paraffin upon tissue fixation in 4% paraformaldehyde. The metastatic burden was assessed by serial sectioning of the entire lungs. Hematoxylin and eosin staining was performed on sections every 200 μm. Images were acquired using AxioScan Z1 (Zeiss) slide scanner and analyzed using Zen Blue software.
Western blot analysis
Cells were stimulated in 0% FCS with recombinant BMP9 (R&D Systems) at the concentration indicated for 1 h after 1 h30 of serum deprivation. Cell extracts were lysed in 50 mmol/L Tris-HCl pH 7.4, 0.5 mol/L NaCl and a cocktail of protease inhibitors (Sigma) by sonication. 20 μg of proteins from cell lysates were separated on a SDS/PAGE, 4–20% (Bio-Rad) and analyzed by immunoblotting with anti-pSmad1/5/9 antibody (Cell Signaling #9511). The same membrane was reprobed with a monoclonal antibody against β-actin (clone AC-15; Sigma) to confirm equal protein loading.
RT-PCR analyses
Total RNAs were extracted at the indicated times using the Nucleospin RNA XS kit (Macherey-Nagel). First-strand cDNAs were synthesized from 1 μg of total RNA by reverse transcription using the reverse transcriptase iScript system from Bio-Rad according to the manufacturer’s instructions. Quantitative RT-PCR was performed using a Bio-Rad CFX96 apparatus and qPCR Master Mix (Promega). Relative quantification of gene expression was normalized to the RPL13a mRNA expression level. Sequences of the PCR primers were as follows:
ALK1: F-CCTCACGAGATGAGCAGTCC, R- GGCGATGAAGCCTAGGATGTT;
ALK2: F-GTCATGGTTCAGGGAGACGG, R-CCAGAGTAGTGAGCTGAAGGT;
ALK3: F-ATGCAAGGATTCACCGAAAGC, R-AACAACAGGGGGCAGTGTAG;
BMPRII: F-TGGCAGTGAGGTCACTCAAG, R-TTGCGTTCATTCTGCATAGC;
ActRIIA: F-AGCAAGGGGAAGATTTGGTT, R-GGTGCCTCTTTTCTCTGCAC;
ActRIIB: F-CTGTGCGGACTCCTTTAAGC, R-TCTTCACAGCCACAAAGTCG;
BMP9: F-CAGATACACAACGGACAAATCGTC, R-TTGGCAGGAGACATAGAGTCGG;
BMP10: F- CCATGCCGTCTGCTAACATCATC, R-ACATCATGCGATCTCTCTGCACCA;
RPL13a: F- CCCTCCACCCTATGACAAGA, R- TTCTCCTCCAGAGTGGCTGT.
Enzyme-linked immunosorbent assay (ELISA)
BMP9 and BMP10 ELISAs were performed with commercially available assays (R&D Systems). VEGF-A ELISA was performed with a commercially available assay (Mouse VEGF Quantikine ELISA Kit, R&D Systems).
Cell proliferation, migration, viability and apoptosis
Cells were treated with 10 ng/mL of BMP9 or BMP10 in 0% FCS RPMI-1064 medium. Cell proliferation was assessed by counting cells every 24 h using an automated cell counter (TC20, Bio-Rad). Cell migration was assessed after wounding with a plastic pipette tip, placed back at 37 °C in the incubator and photographed at indicated times (0, 24, 48 and 72 h). Quantitation of monolayer closure was performed using Zen Blue software. Results are expressed as % of wound closure. Cell viability was assessed using the cell titer-Glo luminescent assay (Promega) at 24 h and 48 h after BMP9 addition. Cell apoptosis was assessed using the caspase-Glo 3/7 assay from Promega at 24 h and 48 h after BMP9 addition.
Statistical analysis
Statistical data analysis was performed using the Mann-Whitney test except for tumor growth analysis, and in vitro proliferation and migration which were performed by the two-way Anova test using GraphPad Prism6.
Discussion
Several clinical trials targeting ALK1 or its co-receptor endoglin are ongoing although the role of these two receptors in a tumor context are not yet understood and, so far present limited beneficial results [
25]. Since both ALK1’s ligands, BMP9 and BMP10 circulate in blood, there is an urgent need to understand the respective contribution of each ligand in tumor development and metastasis. Contrary to what we expected from many preclinical studies aiming at blocking ALK1, we found that loss of BMP9 led to an increase in tumor growth, combined with decreased tumor vessel maturation and increased lung metastasis in the E0771 model. On the other hand, loss of BMP10 did not seem to affect the E0771 mammary cancer model and the double deletion of BMP9 and BMP10 did not lead to a stronger phenotype than the single deletion of BMP9. Together these results demonstrate, for the first time, that BMP9 and BMP10 exhibit distinct roles in tumor growth, angiogenesis and metastatic dissemination.
We show that the loss of BMP9 led to a small but statistically significant increase in tumor volume. However, this result does not seem to be a consequence of a direct effect of BMP9 on tumor cell proliferation since BMP9 did not affect E0771 cell proliferation, cell viability nor apoptosis in vitro
. In accordance, we could not observe any significant differences in PCNA staining nor on activated caspase-3 or TUNEL stainings on tumors that were harvested at the end of the study. This is in contrast to other studies that have shown that overexpression of BMP9 using adenoviruses inhibit the growth, invasion and migration of the breast cancer cell lines MDA-MB-231, SK-BR-3 and 4 T1 [
35,
42,
43]. This could be due to differences in breast cancer models or in the doses of BMP9 used. On the other hand, we found that loss of BMP9 affected tumor neovascularization. Indeed, we found that the loss of BMP9 increased tumor vessel density, and decreased tumor vessel perfusion and coverage by mural cells as illustrated by α-SMA staining, indicating decreased vessel maturation. This is in accordance with the current hypothesis that BMP9 is a maturation or “normalization” factor [
44]. The tumor vasculature has been described as a dense but chaotic and heterogeneous network of structurally and functionally abnormal vessels with a compromised blood flow, a lack of pericyte coverage and a high permeability with non-specific extravasation of blood components [
45]. “Normalization” of the tumor vasculature through the Angiopoietin-Tie2 axis, for example, decreases vessel density, increases vessel coverage and perfusion while decreasing permeability. As a consequence of this vessel normalization, tumor growth is decreased as well as tumor necrosis and metastasis [
46]. Our results on E0771 tumor growth, necrosis, metastasis and tumor perfusion are in accordance with this concept. Together, our data support that BMP9 is a circulating vascular quiescence factor in both physiological and tumoral contexts.
Most cancer patients die of their metastases rather than of their primary tumor so therapeutic strategies have recently focused on metastasis. In the E0771 model, we found that
Gdf2−/− mice developed more and larger metastases. This supports the normalization theory where heterogeneity, leakage and lack of perfusion leads to hypoxia and aggravates tumor progression and metastasis (which is hindered upon normalization) [
47]. It is also possible that, as for the primary tumor, the growth of the metastases would be favored in
Gdf2−/− mice. Differences in lymphangiogenesis could also be an explanation as we have previously shown that
Gdf2 deletion in the C57BL/6 background leads to lymphatic drainage deficiency [
22]. However, although we detected lymphatic vessels in these tumors, we found no differences in tumor lymphatic vessel density between WT and
Gdf2−/− mice.
It was recently shown, in another preclinical study, that blocking BMP9, using a neutralizing anti-BMP9 antibody, significantly reduced renal tumor growth and reduced tumor vascular permeability [
48] suggesting potential differences between different tumor types. The role of BMP9, using a similar approach of
Gdf2 knockdown, has recently been described in the pancreatic RIP1-TAg2 PanNETS cancer model [
49]. However, in this model,
Bmp9 ablation led to a reduced tumor volume, no effect in vessel density but an increase in vessel branching and pericyte coverage and an increase in metastasis. These results, apart for the increase in metastasis, differ from our results. This might be due to differences between cancer types. However, in this paper, using the same pancreatic model, the authors obtained different and even opposite results with mice deleted within this signaling pathway (
Eng+/−, Acvrl1+/− and
Gdf2−/− mice) [
49], highlighting the difficulties of understanding the role of this pathway in cancer and tumor angiogenesis. Nevertheless, their results [
49] and ours show that, in these two cancers, the loss of BMP9 leads to an increase in metastasis and thus cautions against blockade of this BMP9/ALK1 pathway in cancer treatments.
We found that, in contrast to the loss of BMP9, the loss of BMP10 had no significant effect in the E0771 mammary carcinoma model and the loss of both BMP9 and BMP10 in the double-Knockout mice did not lead to a stronger phenotype than the single loss of BMP9. This was not due to tamoxifen injection as
Gdf2-KO mice injected with tamoxifen also showed significantly increased tumor growth (data not shown). Tamoxifen injection led to a 90% decrease in BMP10 circulating levels. It is unlikely, that the remaining 10% of BMP10 could explain the lack of effect. Our results rather support that BMP10 does not play an important role in this breast tumor model. It is interesting to note that loss of BMP9 is sufficient to affect tumor development in this mammary carcinoma model. This supports that, in contrast to post-natal model of angiogenesis or vascular remodeling [
17,
20,
23], there is no redundancy between BMP9 and BMP10 in this tumor context. This absence of redundancy could be due to differences between physiological and tumor angiogenesis or due to the fact that the role of BMP9 and BMP10 might be different in newborns and adults. Indeed, we have previously shown that blocking BMP10 with a neutralizing antibody in newborn
Gdf2−/− mice led to the death of these pups within few days [
23], which is not the case here in adult mice.
Acknowledgements
We thank Dr. S.J. lee (Johns Hopkins University School of Medicine, Baltimore, MD, USA) and Dr. T. Zimmers (Thomas Jefferson University, Philadelphia, PA, USA) for providing Gdf2-/- mice and Dr. D Metzger (IGBMC, Illkirch, France) for providing us the Rosa26-CreERT2 mouse, and the animal facility staff at Institut de Biosciences et Biotechnologies de Grenoble (BIG, Grenoble, France) for animal husbandry.