CD44 cross-linking increases malignancy of breast cancer via upregulation of p-Moesin

Human BrCas cell lines (MDA-MB-453, MCF-7, T-47D, MDA-MB-231, BT-549 and Hs-578t) were purchased from the Cell Bank of the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). MDA-MB-453 cells were cultured in L-15(Gibco, USA), MCF-7 cells were cultured in MEM(Gibco, USA); BT-549 cells were cultured in RPMI-1640 medium(Gibco, USA); and MDA-MB-231, T-47D and Hs-578t cells were cultured in high-glucose DMEM (Gibco, USA).All the media were supplemented with 10% fetal bovine serum(Gibco, USA) and 100 IU/ml penicillin/streptomycin. Additional insulin with a final concentration of 0.01 mg/ml was added to the culture medium of BT-549 and Hs-578t. All cell lines were cultured at 37 °C in humidified air with 5% CO₂ and 95% air. Primary antibodies against CD44 (Abcam, ab119348), CD44 (clone IM7, Cat #14-0441-86), ERM (CST, 3142S), p-ERM (CST, 3141S), Moesin (Abcam, ab52490) p-Moesin (Abcam, ab177943), p-Merlin(CST, 13281S), Merlin (CST, 12888) were used.

Total RNA was extracted from cultured cells (MCF-7, T-47D, BT-549, and MDA-MB-231) by RNAiso Plus (Takara, Japan). RNA (1 μg) was reverse transcribed with the PrimeScript™ RT Reagent Kit with gDNA Eraser (Takara, Japan). Real-time PCR assays were performed by using SYBR Green Mix (Takara, Japan) according to the manufacturer’s protocol. All qRT-PCR values of each gene were normalized against that of GAPDH. The relative expression of genes was calculated by the 2^−ΔΔCt method.

The primer sequences for qRT-PCR are: CD44-F: GACACCATGGACAAGTTTTGG, CD44-R: GACACCATGGACAAGTTTTGG; Moesin-F, ATGCCCAAAACGATCA GTGTG, Moesin-R: ACTTGGCACGGAACTTAAAGAG; Ezrin-F: ACCAATCAA TGTCCGAGTTACC, Ezrin-R: GCCGATAGTCTTTACCACCTGA; Radixin-F: AA TTGTGGCTAGGTGTTGATGC, Radixin-R: GGTGCCTTTTTGTCGATTGGC; Merlin-F: AGTGGCCTGGCTCAAAATGG, Merlin-R: TGTTGTGTGATCTCCTGA ACCA; GAPDH-F: AGCCTCAAGATCATCAGC, GAPDH-R: GAGTCCTTCCAC GATACC.

The shRNA-carrying lentiviruses against Moesin, and negative control were produced by Genechem (Shanghai, China). BT-549 and MDA-MB-231 cells were infected with concentrated virus according to the manufacturer’s protocol, and the expression of Moesin was validated by western blot analysis.

RIPA buffer (Beyotime, China) was used for protein extraction. After the total protein concentration was determined by a bicinchoninic acid protein assay kit (Sigma, USA), 30 μg protein samples were separated by 8% SDS polyacrylamide gels and transferred onto PVDF membranes(Millipore, Billerica, USA). The membrane was blocked with 5% nonfat milk in TBST for 1 h and incubated with the indicated antibody at 4 °C overnight. Then HRP-conjugated secondary antibodies (1:5000) were added. Bands were subsequently visualized using the enhanced plus chemiluminescence assay (Pierce, USA). Measurement of the bands was conducted on an ImageQuant LAS 4000 mini.

In brief, cells were treated with 300 μg/ml hyaluronidase and control medium. Then, equal numbers of cells (2000 cells/well) were seeded into 96-well plates for the proliferation experiment. The proliferation of MDA-MB-231 and BT-549 cells was measured via CCK-8 assay (KeyGen Biotech,China) according to the manufacturer’s protocol.

Cells were treated with different concentrations of hyaluronidase for 0.5 h, then the cells were washed 3 times with ice-cold PBS (20 mM sodium phosphate, 0.15 M NaCl, pH 8.0). CD44 cross-linking was performed by incubation with 2 mM bis (sulfosuccinimidyl) suberate (BS₃) (Pierce, USA) for 30 min and quenched by incubation with 20 mM Tris, pH 7.6 for 15 min at room temperature. Cells were washed twice with PBS and lysed with cell lysis buffer.

For antibody-mediated CD44-crosslinking. BrCas cells were incubated for 90 min at 37 °C with rat monoclonal CD44 antibody (10 mg/ml) (clone IM7, Cat #14-0441-86). After three washes, cells were incubated with 1 mg/ml of goat anti-rat IgG-Fc (Cat #31226) for 60 min at 37 °C and then subjected to cell lysis.

To evaluate the migration and invasion abilities of BrCas cells, Transwell assays were performed. In brief, MCF-7, T-47D, MDA-MB-231 and BT-549 cells were suspended in medium containing 5% FBS after transfection. In addition, 3 × 10⁴ cells were seeded into the upper chamber of an 8-μm pore size insert with or without Matrigel (BD Biosciences, USA). The chambers were deposited in a 24-well plate with 600 μl of 20% FBS medium. After 24 h’s incubation, the cells were fixed with 4% paraformaldehyde (Beyotime, China) and stained with crystal violet (Beyotime, China). After removing the cells on the upper surface of the chamber, the penetrated cells were captured and the number of cells was counted by Image J software at 200× magnification in five random fields under a microscope.

Formalin-fixed paraffin-embedded human BrCas tissues were obtained from Shanghai Superchip Biotech (HBreD055CD01). The expression of p-Moesin in the tissue chip of the cohort of 55 tissues was examined by IHC. The tissue chip was incubated with rabbit monoclonal antibody against human p-Moesin (Abcam, ab177943). Then the sections of tissue chip were detected by Outdo Biotech (Shanghai, China).

The expression of Moesin was scored with intensity of staining and the percentage of the cells of interest staining. We divided the intensity of staining into 4 groups: 0 (–), 1 (+), 2 (++), and 3(+++). The (–), (+), (++), (+++) were defined as no staining, weak staining, moderate staining and intense staining. Then we ranked the percentage of positive staining into 4 categories: 0 (0%), 1 (1–29%), 2 (30–69%), and 3 (≥ 70%) as shown in Additional file 1: Figure S4. The IHC scores are obtained by multiplying the above two scores. The final figures were created by Graphpad 7.

All data are presented as the mean ± SD and were analyzed with GraphPad Prism 7 and SPSS v23 software. The student’s t-test was used to identify the differences between the treated groups and their controls. IHC scores among three groups were analyzed with the non-parametric alternative to ANOVA. A P value < 0.05 was considered statistically significant in the text and figures (*P < 0.05, **P < 0.01, ***P < 0.001).

Since there are few studies involving CD44 cross-linking abnormalities in BrCas, we selected four BrCas cell lines with different degrees of malignancy to explore the expression of CD44 and CD44 cross-linking. We found that the expression of CD44 was relatively higher in invasive BrCas cells MDA-MB-231 and BT-549, and lower in MCF-7 and T-47D cells (Fig. 1a). In addition, to show the CD44 cross-linked status on BrCas cells, we treated the cells with BS₃, a membrane-impermeable compound that cross-link only nearby proteins located within the length of the spacer. After incubation with BS₃ or control buffer, obvious cross-linked CD44 aggregations were showed in MDA-MB-231 and BT-549 cells rather than in MCF-7 and T-47D cells (Fig. 1b). At the same time, Transwell experimental results showed that MDA-MB-231 and BT-549 presented higher abilities of migration and invasion than MCF-7 and T-47D (Fig. 1c and d). These data suggest that CD44 expression level and CD44 cross-linking abilities may be accompanied by BrCas metastasis.

To investigate the effect of CD44 cross-linking on BrCas cells, we first carried out experiments to disconnect the cross-linking using three reagents (oligosaccharides of hyaluronan, hyaluronidase and Latrunculin B). All of them have been proven to effectively block the CD44 cross-linking [14, 21]. The results showed that hyaluronidase has the best dis-connecting effect and is not toxic to cells (Additional file 2: Figure S1), in which 300 μg/ml was selected as the effective concentration in our experiment. Next, we treated BrCas cells with hyaluronidase to abrogate CD44 cross-linking (Fig. 2a). Our studies showed that the removal of CD44 cross-linking in BT-549 and MDA-MB-231 cells significantly reduced cell migration and invasion without changing CD44 expression (Fig. 2b and c), suggesting that CD44 cross-linking may play an important role in the malignancy of BrCas.

Since CD44 cross-linking is an abnormal result of receptor-ligand interaction, and most of cellular activities are conducted through downstream ERM complex, we further explore the changes of intracellular cytoskeletal molecules underneath the CD44 receptor. Firstly, we screened the expressions of ERM complex in a panel of BrCas cell lines. qRT-PCR and Immunoblot analysis both showed that the expression of Moesin was relatively higher in invasive BrCas cells MDA-MB-231, Hs-578t and BT-549, and lower in MDA-MB-453, MCF-7 and T-47D cells (Fig. 3a and b). Interestingly, p-Moesin was overexpressed in invasive breast cancer cells (Fig. 3b). However, there was no significant difference in the expression of the other three actin-membrane crosslinkers (Ezrin, Radixin and Merlin) (Fig. 3b and Additional file 3: Figure S2). These results indicated that Moesin and its phosphorylation may play a significant role in cell metastasis. However, to our surprise, when we destroyed the CD44 cross-linking in MDA-MB-231 and BT-549, we found that it was the phosphorylation of Moesin, rather than Moesin expression, that was inhibited (Fig. 3c and Additional file 4: Figure S3A), suggesting that CD44 cross-linking may induce Moesin activation only, not the expression. To further clarify this hypothesis, we used antibody to re-cross link CD44. The addition of the secondary antibody enhanced CD44 cross-linking and resulted in increased p-Moesin expression (Fig. 3d and Additional file 4: Figure S3B), which suggested that CD44 cross-linking could promote p-Moesin expression. Also we can see that Ezrin, Radxin and Merlin and their phosphorylated forms do not show significant differences (Fig. 3c and Additional file 4: Figure S3A). Taken together, these results suggested that CD44 cross-linking may regulate tumor cell migration and invasion by altering the phosphorylation of Moesin.

To further clarify that CD44 cross-linking indeed regulates tumor cell migration and invasion by affecting p-Moesin in BrCas, we reduced Moesin expression in MDA-MB-231 and BT-549 by RNA interference. Western blot analysis showed that the down-regulation of Moesin could simultaneously reduce the expression of p-Moesin (Fig. 4a). Through Transwell experiment, we analyzed the effect of p-Moesin down-regulation on cell migration and invasion. The results showed that after p-Moesin was down-regulated in BrCas cells, cell migration and invasion were inhibited despite the presence of CD44 cross-linking (Fig. 4b and c), and the same results were observed in cell invasion experiments (Fig. 4d and e). These results suggest that p-Moesin expression plays an important role in affecting the migration and invasion of BrCas cells after CD44 cross-linking.

As our data show that p-Moesin may play a role in BrCas metastasis, we next try to investigate whether p-Moesin could be used in the clinicopathologic detection in BrCas. We analyzed the p-Moesin expression levels in 55 samples, including 34 BrCas (8 ductal breast carcinoma in situ and 26 invasive ductal breast carcinoma), 2 benign breast disease, 13 lymph nodes and 6 adjacent normal tissues by IHC staining assays. The data showed that p-Moesin level was significantly higher in ductal breast carcinoma in situ than those in adjacent normal tissues (Fig. 5a). Accordingly, the expression of p-Moesin in metastase tissues was also higher than that in primary foci of invasive ductal breast carcinoma (Fig. 5b). To further identify the significances between p-Moesin and Moesin, we carried on a TCGA database method to analyze the expression levels of Moesin in BrCass. We found that there were no significant differences in the expression of Moesin between cancer and adjacent tissues (Fig. 5c). Similarly, there was no difference in survival between patients with different Moesin expression (Fig. 5d). These data suggested that the phosphorylated form of Moesin not Moesin is correlated with tumor progression and metastasis and may be applied in the future clinicopathologic detection (Additional file 5: Figure S5).