Background
Cervical cancer (CC) is a malignant tumor that seriously threatens women’s life. The estimated incidence rate of CC is 13.1 per 100,000 women, with Africa and China accounting for a third of the global incidence [
1]. Human papillomavirus (HPV) infection has been considered to be the main cause of CC, and preventive vaccines have been developed not only to suppress CC occurrence but also to prevent HPV infection [
1‐
3]. Although the HPV vaccine, screening and prevention help reduce the infection rate of CC, a high incidence of CC persists in society [
4,
5]. Surgical treatments combined with chemotherapy or radiotherapy have improved the survival outcome of CC patients, yet the treatment effect in high-risk patients has remained poor [
6‐
8]. Immunotherapy studies have also provided a new potential treatment of CC [
9]. Moreover, the mortality rate of patients with CC has continued to soar because CC is prone to metastasis and recurrence [
10]. For this reason, the exploration of new early treatment and diagnosis methods for CC is of extraordinary significance in saving the lives of women with CC.
Circular RNAs (circRNAs) refer to a class of non-coding RNAs with covalently linked ring structures, which prevent them from being degraded by exonucleases [
11]. These RNAs perform a variety of biological functions, such as regulating genes. In recent years, a growing number of studies have shown that circRNAs are inextricably linked to the malignant process of many cancers [
12‐
16]. Some researchers confirmed that circRNAs could promote CC [
17‐
19], while some suggested that multiple circRNAs were associated with the pathological process of CC [
20‐
22]. One study reported that the up-regulation of certain circRNAs appeared in CC tissues [
23]. More interesting is that reconstructive analysis of CC indicated a complicated circRNA‑miRNA‑mRNA regulatory network [
24]. Even though research on the underlying molecular mechanisms of circRNAs in CC has attracted a great deal of attention from scholars, the literature is yet to investigate whether circ_0084927 plays a regulatory role in CC. This knowledge vacuum, therefore, explains the importance of investigating the role of circ_0084927 as well as its potential regulatory network in CC.
Regarded as a class of small endogenous non-coding RNAs commonly found in plants and animals, microRNAs (miRNAs) can interact with the 3′UTR of a target gene through complementary base pairing. Recent studies have shown that miRNAs act as a tumor promoter or tumor suppressor in the occurrence and development of CC [
25‐
28]. For instance, different pieces of research confirmed that miR-1179 played an inhibitory role in several cancers, including glioblastoma, gastric cancer and non-small-cell lung cancer [
29‐
31]. Besides, studies on miR-1179 showed that the abnormal down-regulation of miR-1179 accelerated the malignant process of breast cancer and pancreatic cancer [
32,
33]. Nonetheless, scientists are yet to clarify whether miR-1179 exerts a role in CC regulation.
Cyclin-dependent kinase 2 (CDK2) gene, located on the 12q13.2 chromosome, consists of eight exons. As a member of the protein kinase family, CDK2 participates in the regulation of the eukaryotic cell division cycle [
34]. Apart from the fact that a previous study uncovered that CDK2-related signaling pathways conferred complicated roles in several forms of cancers [
35], a few studies have investigated the tumor-promoting role of CDK2 in CC [
36‐
38]. In another research, bioinformatics analysis authenticated that the CDK2-related signaling pathway was involved in CC [
39]. Experimental results also suggested that CDK2 was a downstream target of some miRNAs in CC progression [
40,
41]. Despite these findings, no researcher has investigated whether CDK2 could be regulated by miR-1179 in CC. The interactome involving CDK2 and circRNA also remains unclear.
This study aimed to explore the role of circ_0084927 in CC development and reveal how the molecular mechanisms and regulatory networks of circ_0084927 affect CC. Our results showed that circ_0084927 promoted CC occurrence by sequestering the inhibitory effect of miR-1179 on CDK2.
Materials and methods
Sample acquisition and cell culture
CC tissue samples were collected from Yantai Affiliated Hospital of Binzhou Medical College, China, and the study protocols were approved by the Ethics Committee of Yantai Affiliated Hospital of Binzhou Medical College. CC cell lines (HeLa, CaSki, SW756 and C-33A) and normal cervical epithelial cell lines (HcerEpic) were purchased from the Beijing Beina Chuanglian Biotechnology Research Institute (BNBIO.com). HeLa, C-33A, SW756, and CaSki cells were cultured in 5% CO
2 at 37 °C in RPMI-1640 medium (E600028; Sangon, Shanghai, China) with 10% fetal bovine serum (16140071; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) in addition to 100 μg/ml streptomycin. HcerEpic cells were cultured in 5% CO
2 at 37 °C in MEM medium (E600024; Sangon, Shanghai, China) with 10% fetal bovine serum and 100 μg/ml streptomycin. The characteristics of the patients are shown in Table
1, and the representative histopathological examination results are illustrated in Additional file
1: Figure S1.
Table 1
The clinical characteristics of patients with cervical cancer
Age (years) |
≤ 55 | 13 (43.3%) |
> 55 | 17 (56.7%) |
FIGO stage |
I–IIa | 20 (66.6%) |
IIb, III–IV | 10 (33.3%) |
Tumor size |
≤ 4 cm | 18 (60.0%) |
> 4 cm | 12 (40.0%) |
Lymph node |
Negative | 18 (60%) |
Positive | 12 (40%) |
H&E staining
Tissue sections were deparaffinized twice using xylene treatment (10 min each time), and they were re-hydrated by decreasing the alcohol concentration. After washing the tissue sections in distilled water for 1 h, they were stained by hematoxylin solution for 8 min and by eosin for 3 min. After that, the tissue sections were dipped in 0.2% saturated lithium carbonate solution for 30 s. The eosin solution was then used to stain the tissue sections for 1 min after washing the sections in running tap water. Finally, the H&E staining images were photographed with the Nikon TE2000-U inverted microscope (Japan).
Cell transfection
The small interfering RNAs of circ_0084927 (si-circ_0084927) and CDK2 (si-CDK2), as well as the negative control siRNA (si-NC), were synthesized by GenePharma (Shanghai, China). Some items were purchased from RiboBio Co., Ltd. (Guangzhou, China), such as miR-1179 control, miR-1179 negative control, miR-1179 mimic (for luciferase reporter gene assay) and miR-1179 inhibitor. HeLa and C-33A cells were transfected with si-NC, miR-1179 inhibitor, si-circ_0084927, si-CDK2, miR-1179 inhibitor plus si-circ_0084927 or miR-1179 inhibitor plus si-CDK2 via Lipofectamine ™ 2000 (11668019; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and via lipofectamine transfection method for 20 min. After the cells were incubated for 2 days at 37 °C, they were analyzed by qRT-PCR.
Subcellular location using a nuclei-cytoplasm fractionation method
Before the nuclear and cytoplasmic RNA isolation, nuclear and cytoplasmic fractions were separated using the PARIS Kit (AM1921; Thermo Fisher Scientific, Waltham, Mass., USA). The isolated RNA products in nuclei and cytoplasm were analyzed by qRT-PCR. Then, the expression of circ_0084927 and ESRP1 mRNA was detected in the nuclei and cytoplasm. GAPDH and U2 were subsequently employed as a reference control for cytoplasmic expression and nuclear expression, respectively.
qRT-PCR
The trizol reagents (15596026; Thermo Fisher Scientific, Inc., Waltham, MA, USA) were first used, according to the instruction manual, to isolate and detect total RNA from the tissue samples and cell lines. The obtained RNA was then reverse-transcribed into cDNA. Then, miR-1179 was reverse-transcribed using the protocol of mirVana™ qRT-PCR miRNA Detection Kit (AM1558; Invitrogen™; Thermo Fisher Scientific, Inc., Waltham, MA, USA). The reverse-transcription of CDK2 mRNA and circ_0084927 was conducted with SuperScript III First-Strand Synthesis SuperMix for qRT-PCR (11752050; Thermo Fisher Scientific, Inc., Waltham, MA, USA). StepOnePlus Real-Time PCR System (4376600; Thermo Fisher Scientific, Inc., Waltham, MA, USA) was later used to perform qRT-PCR. The qPCR products were then validated using the agarose gel electrophoresis method. Next, the data were analyzed with the 2
−ΔΔCt method. GAPDH was then utilized as the internal control of circ_0084927 and CDK2 mRNA, while U6 was used as the internal control of miR-1179. The primer sequences are displayed in Table
2.
Table 2
The primer sequences for RT-qPCR
circ_0084927 |
Forward | CGAAGGAACGGAGAAGCTCT |
Reverse | GTGCCCTGACTACGGTGTTA |
circ_0084912 |
Forward | CTTGATGACCCCAGAAGGAG |
Reverse | ATATTCCAGGCTTCCCAACC |
circ_0081723 |
Forward | CCATCACCGACCTCATCAGT |
Reverse | TGATGTTTCCCAGTGTGTGG |
circ_0106385 |
Forward | GAGGAGGAGGAGAAGAATGC |
Reverse | ACGTGGCACAGACCTCTCTC |
circ_0099591 |
Forward | CCAACCAATGAGTCGAAGGT |
Reverse | CTCGGAGTGTGAGGGATAGC |
miR-1179 |
Forward | GCGCGCAAGCATTCTTTCAT |
Reverse | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGTACGAACCAACCA |
U6 |
Forward | CTCGCTTCGGCAGCACA |
Reverse | AACGCTTCACGAATTTGCGT |
CDK2 |
Forward | CCAGGAGTTACTTCTATGCCTGA |
Reverse | TTCATCCAGGGGAGGTACAAC |
β-Actin |
Forward | CATGTACGTTGCTATCCAGGC |
Reverse | CTCCTTAATGTCACGCACGAT |
Luciferase reporter gene assay
Oligonucleotides comprising the circ_0084927 mutant (the sequence containing the miR-1179 binding site was mutated to GAUACGA) or the CDK2 mRNA 3′UTR mutant (the sequence containing the miR-1179 binding site was mutated to GAUACGA) were synthesized by GenePharma (Shanghai, China). Inserted into the dual-luciferase miRNA target expression vector (pGL4) were wild-type circ_0084927, circ_0084927 mutant, CDK2 3′UTR mutant, and wild-type CDK2 3′UTR. This insertion was performed to construct luciferase reporter plasmid. HeLa and C-33A cells were also co-transfected with luciferase porter plasmid and miR-1179 mimic. After 48 h of incubation, the culture medium was removed to collect the cells. The collected cells were then lysed to obtain cell lysates. The luciferase activity was measured by Pierce Renilla-Firefly Luciferase Dual Assay Kit (16185; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the protocol.
RNA immunoprecipitation (RIP) assay
The Hela and C-33A cells transfected with miR-1179 mimic were cultured to an appropriate density. The cultured cells were digested using trypsin and were collected after trypsin treatment. The cells were lysed using RIP lysis buffer. The cell lysates were then incubated with RIP buffer containing magnetic beads coupled with anti-Argonaute2 (MA5-23515; Thermo Fisher Scientific, Inc., Waltham, MA, USA) or IgG for 1 h, with IgG serving as a negative control. The mixture was subsequently incubated with Proteinase K. After that, the immunoprecipitated RNA was isolated and analyzed using qRT-PCR.
RNA pull-down assay
RNA pull-down assay was conducted to further validate the regulatory binding relationship between miR-1179 and CDK2 mRNA. The biotinylated double-stranded RNA of miR-1179 (Bio-miR-1179) and biotinylated negative control RNA (Bio-NC) were designed by GenePharma (Shanghai, China). Whereas the sense sequence of bio-miR-1179 was 5′-AAGCAUUCUUUCAUUGGUUGG-biotin-3′, the antisense sequence of bio-miR-1179 was 5′-CCAACCAAUGAAAGAAUGCUU-3′. 1 × 105 Hela and C-33A cells were cultured in 6-well plates for 1 day, resuspended in 1 ml lysis buffer, and incubated in ice for 20 min. The lysate was centrifuged at 12,000×g for 15 min before the supernatant was collected. The mixture of bio-miR-1179 or bio-NC and streptavidin-coated magnetic beads (Invitrogen, USA) was added to the supernatant and incubated at 4 °C for 2 h. The pulled-down CDK2 mRNA in the bio-miR-1179 or bio-NC group was detected by qRT-PCR.
CCK-8 assay
After the transfected cells underwent trypsinization, 100 μl of the transfected cell suspension was seeded into a 96-well plate (2 × 103 cells/well). The plate was then placed in a 37 °C incubator for some hours (24 h, 48 h, and 72 h). Then, 10 μl of CCK-8 solution was added to each well, based on the manual guidelines of CCK-8. After the cells were incubated with CCK-8 for 2 h, the absorbance was measured at 450 nm.
BrdU incorporation ELISA assay (A colorimetric BrdU assay)
BrdU cell proliferation assay kit was used to detect cell-proliferation ability. Anti-BrdU antibodies were used to detect 5-bromo 2′-deoxyuridine (BrdU), which was incorporated into the cell DNA during cell proliferation. Then, a trypsin-treated suspension containing 104 cells was added to each well of a 24-well plate. The culture medium was changed every 6 h. After the cells were cultured for 24 h, 10 μm BrdU (E607203; Sangon, Shanghai, China) was added, and the culturing was continued for 4 h to allow the proliferating cells to incorporate BrdU into their DNA. The cultured cells were then fixed using the fixing solution and were permeabilized with 0.5% Triton (R) X-100 for 10 min. Mouse anti-IgG and anti-BrdU antibodies (diluted at 1:50) were then incubated with the cells overnight at 4 °C. Subsequently, cells were washed with PBST and incubated in the dark with HRP-conjugated secondary antibodies (A24494; Thermo Fisher Scientific, Inc., Waltham, MA, USA) at 1:500 in PBS at room temperature. In the end, the absorbance at 450 nm was proportional to the amount of BrdU incorporated into the cell, which directly reflected cell proliferation.
Cell–matrix adhesion assay
Before the cell suspension (10,000 cells/well) was seeded in the 96-well plates (4414133; Thermo Fisher Scientific, Inc., Waltham, MA, USA) that were previously coated with 10 μg/ml type I collagen (C7661, Sigma-Aldrich, USA), the cells were deprived of serum for at least 8 h. After 30 or 60 min adherence at 37 °C in a 5% CO2 atmosphere, the wells were washed with PBS for at least three times to remove the non-adherent cells. The remaining cells were then treated with MTT for two more hours at 37 °C. Finally, the MTT-treated cells were treated with 100 µl DMSO. The absorbance recorded using a microplate reader (Benchmark, Bio-Rad, USA) was 570 nm.
Assays for caspase 3 activation
Caspase-3 is an active cell-apoptosis protease and an early indicator of the onset of apoptosis. Colorimetric detection at 405 nm of p-nitroaniline (pNA), after the cleavage from the peptide substrate DEVD-pNA, may reflect the cell apoptosis level. The transfected Hela and C-33A cells (1x105) in different groups were briefly harvested and lysed in 50 ml of ice-cold cell lysis buffer. Cell lysates were centrifuged at 10,000g for 10 min to obtain the supernatant. Then, 50 μl of 2× Reaction Buffer/DTT Mix and 5 μl of 1 mM DEVD-pNA (substrate for caspase-3) from caspase 3 colorimetric assay kit (630217, Takara Biomedical Technology (Beijing) Co., Ltd., China) were added to the cell lysates. The absorbance was determined by measuring OD405 of the released pNA using a microplate reader (Benchmark, Bio-Rad, USA).
Western blot analysis
Quantitative analysis was performed after all the protein was extracted with RIPA lysis buffer (C500005, Sangon; Shanghai, China) from Hela and C-33A cells in different groups. An equal amount of protein was separated by 10% SDS-PAGE. The gel was immersed in a transfer buffer to achieve equilibrium before transferring it to a polyvinylidene fluoride membrane. Primary antibodies were diluted at a ratio of 1:1000. The membrane was later incubated for 2 h with diluted primary antibodies against CDK2 (D220395; Rabbit-Human; Sangon; Shanghai, China) and β-actin (SAB5500001; Rabbit-Human; Sigma-Aldrich, China). Following that, the hybrid membrane was blocked with 5% skimmed milk and incubated at 4 °C overnight. Next, the membrane was incubated for 2 h with diluted secondary antibodies (A32731; Goat-Rabbit; Thermo Fisher Scientific, Inc., Waltham, MA, USA). Finally, a hypersensitive ECL chemiluminescence kit (C510043; Sangon; Shanghai, China) was used to detect proteins according to the reagent instructions. The intensity of the protein bands was read using ImageJ software.
Cell cycle by flow cytometry
The transfected HeLa and C-33A cells were re-suspended once in pre-chilled 1xPBS and were subsequently diluted to 1 × 105 cells/ml in 1× Annexin binding buffer. In every assay, 100 µl of cell suspension (10,000 cells) was used. The transfected HeLa and C-33A cells were then re-suspended and treated with pure ethanol for 30 min. After that, cells were incubated with RNase for 30 min not only to remove RNA but also to eliminate the influence of the binding between PI and RNA. Cells were subsequently stained with the red-fluorescent stain, PI (V13242; Thermo Fisher Scientific, Inc., Waltham, MA, USA), in a dark room at room temperature to allow PI to bind to the DNA of the cells. The stained cells were finally put into a flow cytometer before the proportion of cells in each phase of the cell cycle was obtained from the linked BD FACSuite software.
Statistical analysis
With Microsoft Excel, all the means and standard deviations were calculated based on three independent experiments. GraphPad Prism 8.0 (GraphPad Prism, Inc., La Jolla, CA, USA) was used to produce the diagrams. One-factor analysis of variance (ANOVA) test and Student’s t test were used for the statistical analysis between multiple groups and for the statistical analysis of two groups, respectively. In terms of the gene expression in tissue samples, we used the Wilcoxon test for the CC tissue samples and matched adjacent healthy tissue samples for comparison. P < 0.05 was considered to be statistically significant, while P < 0.01 was considered to be extremely significant.
Discussion
Many studies have reported the up-regulation and miRNA-sponging roles of circRNAs in CC. For instance, circ_101996 was overexpressed in cervical cancerous tissues [
44]. One study showed that circ_0084927 was significantly up-regulated in malignant pleural effusion (MPE) of lung cancer [
45]. We reported in this research the significant up-regulation of circ_0084927 in CC tissues and cell lines, and we hypothesized that the upregulated circ_0084927 might facilitate CC progression. Most importantly, we proved that circ_0084927 silencing inhibited carcinogenesis by repressing the proliferation and adhesion of CC cells, fortifying apoptosis, and leading to cell cycle arrest. Overall, circ_0084927 promoted CC occurrence through the regulatory network of circ_0084927/miR-1179/CDK2.
Many up-regulated circRNAs were identified to exert critical tumor-promoting functions by sponging its downstream miRNAs. For instance, circ_0023404 and hsa_circ_CLK3 stimulated the aggressiveness of CC cells by acting as a miRNA sponge, thereby facilitating cancer occurrence and metastasis [
46,
47]. What’s more, circ_0000515 served as a miR-326 sponge, thus promoting the progression of CC [
18,
48]. According to a recent study, up-regulated circ_0000388 dramatically stimulated CC aggression by sponging miR-337-3p [
49]. In another research, circ_0075341 was identified as a sponge of miR-149-5p to promote the malignant phenotypes of CC cells [
19]. Similarly, circ_0060467 stimulated aggressiveness of CC by sponging miR-361-3p [
50].
We herein identified a potential downstream miRNA of circ_0084927, miR-1179, which has not been comprehensively studied in several cancers except CC. We found that circ_0084927 promoted CC malignant phenotypes by sponging miR-1197. This result suggested that circ_0084927 exerted its tumor-promoting functions by suppressing miR-1197, which was once described as a tumor suppressor that impaired the malignant progression of gastric cancer by inhibiting proliferation and invasion [
30]. Another study showed that increased miR-1179 significantly inhibited the aggressiveness of breast cancer cells while weakening the cancer metastasis [
33]. Moreover, miR-1179 functioned like a tumor suppressor: It inhibited the malignant proliferation and cell cycle progression of glioblastoma multiforme cells [
29]. These results suggested that miR-1179 could be a potential tumor suppressor in diverse cancers. However, no previous studies, which showed that miR-1179 played a tumor suppressor role in CC, have been reported.
We herein supplemented the results in CC and proposed that miR-1179 played an anti-oncogenic role in CC. It is crucial to note that miR-1179 has been reported to interact with other circRNAs, thus affecting human cancer cell phenotypes. For instance, a previous study published that the tumor suppressor function of miR-1179 was confiscated by circ_0000735 during the development of non-small cell lung cancer [
51]. A similar experiment confirmed that the inhibitory effect of miR-1179 on thyroid cancer was sponged by circ_0039411 during the pathological process [
52]. Another study pointed out that circ_0003645 improved cell aggressiveness through sponging miR-1179 [
53]. As a cancer-promoting factor, circ_0025033 promoted the progression and tumor growth of papillary thyroid carcinoma by sponging miR-1179 [
54]. These studies supported the claims that miR-1179 could exert tumor suppressor functions by sponging with circRNAs. Apart from validating the regulatory relationship between circ_0084927 and miR-1179, our findings unraveled the tumor-promoting effect of circ_0084927 and expanded the regulatory networking involving miR-1179 in CC. Most importantly, we identified a novel regulatory interactome that might contribute to the understanding of CC pathogenesis.
Regarding the downstream effector of miR-1179, CDK2, several studies have reported that CDK2 is the downstream effector of miRNAs in various cancers. This means that it affected cancer cell malignancy, especially cell-cycle progression. For instance, silencing CDK2 attenuated aerobic glycolytic cell metabolism in cells, thereby inhibiting the malignant characterization of gastric cancer cells [
55]. CDK2 was also up-regulated in many cancers as a cell cycle-dependent kinase that contributed to cell cycle progression and DNA damage responses [
56]. This up-regulation of CDK2 provided new immune targets for therapy on multiple cancers.
The study of CDK2 inhibitors also provided new prospects for cancer treatment [
57,
58]. Our results, for example, showed that the inhibition of CDK2 significantly suppressed CC cell growth and cell cycle progression as well as cell–matrix adhesion. Consistent with previous studies, our findings indicated that CDK2 could be a valuable therapeutic target for CC treatment. In terms of the interaction of miRNAs and circRNAs that are upstream of CDK2, it was reported that by downregulating miR-3619-5p, CDK2 exerted a crucial role in promoting the proliferation, migration and invasion of bladder carcinoma cells [
59]. By regulating its upstream circ_0078710/miR-31, CDK2 stimulated the malignant phenotypes of hepatocellular carcinoma cells [
60]. CDK2 was noted in another research to form a complex substance with circ-Foxo3; this substance was abnormally expressed in cancer tissues in terms of participating in cell cycle regulation [
61]. The evidence above indicated that CDK2 could be downstream effectors of circRNAs and miRNAs.
In our study, we reported a novel upstream regulator of CDK2, circ_0084927/miR-1179, in CC. We also found that miR-1179 inhibited the malignant phenotypes, including cell cycle progression of CC cells, by directly targeting CDK2. This regulation, however, could be reversed by circ_0084927 because it could sponge miR-1179 to release CDK2. To better clarify the pathogenesis of CC, the results of the in vitro experiments performed in this study require the validation of animal models. Even though our study did not further investigate the molecular receptors downstream of the CDK2 in CC, the accumulation of clinical samples is required to expand the sample size and ensure that the results are compelling and convincing.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.