Circular RNA circNTRK2 facilitates the progression of esophageal squamous cell carcinoma through up-regulating NRIP1 expression via miR-140-3p

The study was permitted by the Ethics Committee of The First Affiliated Hospital of Henan University of Chinese Medicine and performed according to the Declaration of Helsinki Principles. Informed written consents were signed by each patient for using their tissues. Tumor tissue samples and adjacent normal tissues (at least 3 cm from the edge of cancer tissues) were obtained from 56 patients with a definite pathological diagnosis of ESCC. None of the participants received preoperative radiotherapy or chemotherapy. All specimens were immediately snap-frozen in liquid nitrogen and stored at − 80 °C until further used.

Human ESCC cell lines (Eca-109, EC-9706, KYSE-30, KYSE-150, TE-1) were purchased from Cell Bank of the Chinese Academy of Sciences (Shanghai, China). Human normal esophageal epithelial cell line Het-1A was obtained from American Type Culture Collection (ATCC; Manassas, VA, USA). ESCC cells were cultured in RPMI 1640 medium (Invitrogen, Carlsbad, CA, USA) containing 10% fetal bovine serum and 1% penicillin/streptomycin. Het-1A cells were maintained in bronchial epithelial cell growth medium (BEGM, BulletKit, Lonza, MD). All cells were kept in a humidified incubator under an atmosphere of 5% CO₂ at 37 °C.

Total RNA in ESCC tissues and cells was extracted using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA). For circRNA and mRNA, the cDNA was synthesized by using SuperScript VILO cDNA Synthesis kit (Invitrogen; Carlsbad, CA, USA). For miRNA, reverse transcription was performed by using miRcute Plus miRNA First-Strand cDNA Synthesis Kit (Tiangen, Beijing, China). The quantitative PCR was conducted using SYBR Premix Ex Taq II (TaKaRa, Dalian, China) on a LightCycler 480 system (Roche, Basel, Switzerland). The relative gene expression was calculated by using the 2^-ΔΔCt method with U6 as the reference gene for miRNA and GAPDH as the internal control for circRNA and mRNA. All primers were obtained from Songon (Shanghai, China) and listed as follows:

circNTRK2: F, 5′-TCTCGGTCTATGCTGTGGTG-3′, R, 5′-CATTCGCTGCAGTTCCATAA-3′;

miR-140-3p: F, 5′-CAGTGCTGTACCACAGGGTAGA-3′, R, 5′-TATCCTTGTTCACGACTCCTTCAC-3′;

NRIP1: F, 5′-GAGCACTCCACCTTTACTTACAT-3′, R, 5′-CAATCATACCTATCGGTTTATCTG-3′;

GAPDH: F, 5′-TGTTCGTCATGGGTGTGAAC-3′, R, 5′-ATGGCATGGACTGTGGTCAT-3′;

U6: F, 5′-ATTGGAACGATACAGAGAAGATT-3′, R, 5′-GGAACGCTTCACGAATTTG-3′.

To confirm the circular structure of circNTRK2, the circular and linear transcripts of NTRK2 were amplified by divergent and convergent primers in both complementary DNA (cDNA) and genomic DNA (gDNA) from ESCC cells. Then, agarose gel was used to separate the PCR products. In theory, circNTRK2 is amplified by divergent primers in cDNA but not gDNA. Additionally, Sanger sequencing was performed to verify the sequence of circNTRK2. Meanwhile, total RNA (5 μg) extracted from ESCC cells was incubated with RNase R (3 U/μg, Epicenter, Madison, WI, USA) for 20 min at 37 °C, followed by qRT-PCR to measure the expression levels of circular and linear NTRK2.

To down-regulate circNTRK2, small interfering RNAs (siRNAs) targeting back splice junction of circNTRK2 (si-circ #1, si-circ #2, si-circ #3) were synthesized by GenePharma (Shanghai, China). NRIP1-specific siRNA (si-NRIP1) was used to silence NRIP1. Non-targeting control siRNA (si-NC) was used as a control. The sequences of siRNAs were listed as follows: si-circ #1, 5′- GCATGAAAGGTGCAAACCCAA − 3′; si-circ #2, 5′- GGCATGAAAGGTGCAAACCCA − 3′; si-circ #3, GTTTGGCATGAAAGGTGCAAA; si-NRIP1, 5′- GAGGAUCAGAACUUUAACATT-3′; si-NC, 5′-UUCUCCGAACGUGUCACGUTT-3′. MiR-140-3p mimics (miR-140-3p) and its matched control (miR-NC), miR-140-3p inhibitor (anti-miR-140-3p) and its matched control (anti-miR-NC) were obtained from GenePharma (Shanghai, China). To construct circNTRK2-overexpression plasmid (circNTRK2), the full length circNTRK2 cDNA was synthesized and then inserted into pLCDH-ciR vector (Geneseed, Guangzhou, China), while mock vector with no circNTRK2 sequence was used as a control. To establish NRIP1-overexpression plasmid (NRIP1), the coding region of NRIP1 cDNA was subcloned into pcDNA3.1 expression vector (Geneseed, Guangzhou, China). Cells were screened with puromycin (2 μg/ml) for 4 weeks to establish overexpression and control cell lines. ESCC cells were transfected with these oligonucleotides or plasmids at appropriate doses using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s manual.

CCK-8 (Bimake, Shanghai, China) was used to evaluate ESCC cell viability. Cells (2 × 10³/well) were inoculated into 96-well plates. After incubation of 24 h, 48 h, 72 h, or 96 h at suitable condition, 10 μl CCK8 solution and 90 μl medium were added to each well. Two hours later, the absorbance at 450 nm was measured using a Varioskan Flash Microplate Reader (Thermo Fisher Scientific, Waltham, MA, USA).

The proliferative ability of ESCC cells was detected by using a Cell-Light™ EdU DNA Cell Proliferation Kit (RiboBio, Guangzhou, China) following the manufacture’s guideline. Images of randomly selected fields were obtained under a fluorescence microscope (Leica, Wetzlar, Germany).

ESCC cells were added into 6-well plates at a density of 1000 cells/well and incubated at 37 °C for half a month. After fixing with 75% ethanol and staining with 0.1% crystal violet, the colonies with more than 50 cells were counted.

Transwell assay was implemented to determine the invasive capability of ESCC cells in 24-well Boyden chambers (Corning Incorporated, Corning, NY, USA) with pre-coated Matrigel (BD Biosciences, Franklin Lakes, NJ, USA). Briefly, 600 μl RPMI 1640 medium containing 10% FBS was added to the lower chamber, while 1 × 10⁵ cells in 200 μl serum-free medium was plated into the upper chamber. After incubation at 37 °C with 5% CO₂ for 24 h, cells remaining on the upper surfaces of the transwell chambers were removed, and cells traversed to the bottom surface were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet. The invasive cells were captured by a light microscope (Olympus, Japan) and counted from five randomly chosen fields.

ESCC cells (5 × 10⁵/well) were seeded into 6-well plates and cultured for 48 h at 37 °C. Then, cells were stained with an Annexin V-FITC apoptosis detection kit (BD Biosciences, San Jose, CA, USA) and subjected to a FACSCalibur flow cytometer (BD Biosciences, San Jose, CA, USA) for apoptosis detection.

Total protein from ESCC cells was extracted using RIPA lysis and extraction buffer (Thermo Fisher Scientific, Rockford, IL, USA) and quantified by BCA Protein Assay Kit (Beyotime, Shanghai, China). Subsequently, 30 μg protein samples were separated by sodium dodecyl sulfonate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene fluoride (PVDF) membrane (GE Healthcare, Piscataway, NJ, USA). After blocking in nonfat milk overnight at 4 °C, the membranes were incubated with primary antibody against E-cadherin (1:500, Abcam, Cambridge, MA, USA), vimentin (1:1000, Abcam), Cleaved PARP (1:1000; Abcam), Cleaved caspase-3 (1:500, Abcam), NRIP1 (1:500, Abcam), and GAPDH (1:10,000, Abcam) overnight at 4 °C, and then were probed with HRP-conjugated secondary antibody for 2 h at room temprature. ECL Western Blotting Detection Kit (Solarbio, Beijing, China) was used to detect the protein bands.

The RNA from nuclear and cytoplasm fractions was isolated by using a Cytoplasmic and Nuclear RNA Purification Kit (Norgen, Thorold, ON, Canada). In brief, ESCC cells were incubated with lysis solution on ice for 10 min and then centrifuged for 3 min at 12,000 g. The supernatant was collected for cytoplasmic RNA extraction and the nuclear pellet was used for nuclear RNA. qRT-PCR was used to measure the relative expression of circNTRK2 in different fractions. GAPDH was used as the cytoplasmic control, while U6 was used as the nuclear control.

The targets of circNTRK2 were predicted by CircInteractome (https://​omictools.​com/​circinteractome-tool), CircBank (http://​www.​circbank.​cn/​) and StarBase 3.0 (http://​starbase.​sysu.​edu.​cn/​) online databases. TargetScan ((http://​www.​targetscan.​org/​vert_​71/​), miRDB (http://​mirdb.​org/​), DIANA-microT (http://​diana.​imis.​athena-innovation.​gr/​DianaTools/​index.​php?​r=​microT_​CDS/​index), DIANA-TarBase (http://​carolina.​imis.​athena-innovation.​gr/​diana_​tools/​web/​index.​php?​r=​tarbasev8%2Findex) and miRTarBase (http://​mirtarbase.​mbc.​nctu.​edu.​tw/​) online databases were utilized to predicted the candidate targets of miR-140-3p. GEPIA tool (http://​gepia.​cancer-pku.​cn/​detail.​php?​gene=​&​clicktag=​boxplot) was used to analyze the expression of NRIP1 in cancer and normal tissues in TCGA database.

To evaluate the direct binding between miR-140-3p and circNTRK2, the wild type or mutant sequences containing the binding sites of miR-140-3p in circNTRK2 were inserted into a pmirGLO vector (Promega Corporation, Madison, WI, USA), named as circNTRK2-wt and circNTRK2-mut, respectively. Subsequently, the luciferase reporter (100 ng) and miR-140-3p mimic or miR-NC (40 nM) were co-transfected into ESCC cells. After 48 h, the luciferase activity was measured using the Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA) with renilla luciferase activity as an internal reference. Similar procedures were conducted to examine the binding between miR-140-3p and NRIP1. Luciferase reporters including wild type NRIP1-wt and mutated types (NRIP1-mut1: nt 893–900, NRIP1-mut2: nt 3086–3092, and double mutation: NRIP1-mut1 + 2) were constructed.

Magna RNA immunoprecipitation kit (Millipore, Billerica, MA, USA) was used to validate the binding between circNTRK2 and miR-140-3p. Briefly, ESCC cells were washed with PBS and lysed in RIP lysis buffer. Subsequently, cell lysates were incubated with RIP buffer containing magnetic beads coupled with human anti-Argonaute 2 antibody (Ago2; Millipore) or non-specific anti-IgG (Millipore). After elution, qRT-PCR was used to determine the level of circNTRK2 in immunoprecipitated RNA.

ESCC cells were transfected with the wild type biotin-labelled miR-140-3p (Bio-miR-140-3p-wt), mutant biotin-labeled miR-140-3p (Bio-miR-140-3p-mut), and non-specific negative control (Bio-miR-NC). After 48 h, cell lysates were incubated with streptavidin magnetic beads, followed by qRT-PCR to measure the level of circNTRK2 in RNA complexes.

All animal experiments were approved by the Institutional Animal Care and Use Committee of The First Affiliated Hospital of Henan University of Chinese Medicine and performed following the guidelines of National Institutes of Health. Male BALB/c nude mice aged 4–5 weeks were obtained from Shanghai Laboratory Animal Company (SLAC, Shanghai, China). KYSE-150 cells (5× 10⁶) stably infected with lentivirus vectors encoding shRNA against circNTRK2 (sh-circNTRK2) or a non-silencing negative control (sh-NC) were subcutaneously injected into the right armpit of nude mice (n = 5 per group). The length and width of xenograft tumors were measured at indicated time points, and tumor volumes were calculated according with the formula: volume (mm³) = width² × length/2. At 25 days after inoculation, all mice were sacrificed and xenografts were dissected for further analysis.

Data analysis was performed by using GraphPad Prism 7 (GraphPad Software, Inc., La Jolla, CA, USA). All continuous data were presented as mean ± standard deviation (SD). Differences in two groups were assessed by Student’s t-test, while one-way analysis of variance (ANOVA) was utilized in multiple groups. Chi-square test was applied to evaluate the relationship between circNTRK2 expression and clinicopathological parameters. Kaplan-Meier method was employed to determine the survival rate and log-rank test was used to compare the difference. Pearson’s correlation coefficients were used to detect the correlation. P < 0.05 was set as statistically significant.

In order to seek for circRNAs aberrantly expressed in ESCC, we analyzed GEO database (GSE131969) containing 3 ESCC tissues and 3 normal tissues. Heat map exhibited the 10 most up-regulated and down-regulated circRNAs (Fig. 1A). Here, hsa_circ_0087378 was selected for further analysis due to that it is the most significantly increased circRNA. Hsa_circ_0087378 is produced from exon 12–14 of NTRK2 located on chromosome 9 and is 237 bp in length, thus we named it as circNTRK2. The back-spliced region was confirmed in the RT-PCR product of circNTRK2 by Sanger sequencing (Fig. 1B). In addition, circNTRK2 expression was significantly higher in human ESCC cell lines (Eca-109, EC-9706, KYSE-30, KYSE-150, TE-1) than that in human esophageal epithelial cell line Het-1A (Fig. 1C). Subsequently, divergent and convergent primers were designed to amplify the circular and linear transcripts of NTRK2, respectively. As shown in Fig. 1D by gel electrophoresis, circNTRK2 was amplified by divergent primers in cDNA but not gDNA, while linear NTRK2 was amplified by convergent primers in both cDNA and gDNA from Eca-109 and KYSE-150 cells. Compared to linear NTRK2 mRNA, circNTRK2 was found to be resistant to RNase R (Fig. 1E and F). Furthermore, circNTRK2 expression was significantly elevated in tumor tissue samples in contrast to that in adjacent normal tissue samples from 56 ESCC patients (Fig. 1G). Consistently, circNTRK2 expression was found to be up-regulated in 35 ESCC tumor tissues compared to adjacent non-cancerous (Supplementary Fig. 1). As shown in Table 1, high circNTRK2 expression was demonstrated to be correlated with advanced TNM stage and lymph node metastasis. Kaplan-Meier survival analysis showed that the overall survival of ESCC patients with high circNTRK2 expression were shorter in comparison with that in low circNTRK2 expression group (Fig. 1H). These data confirmed the circular structure of circNTRK2, and circNTRK2 expression was up-regulated in ESCC.

To explore the effects of circNTRK2 in ESCC progression, three different siRNAs targeting circNTRK2 (si-circNTRK2 #1, si-circNTRK2 #2, and si-circNTRK2 #3) were designed and transfected into Eca-109 and KYSE-150 cells, while circNTRK2-overexpressing vector (circNTRK2) was constructed and transfected into EC-9706 cells. As presented in Fig. 2A, circNTRK2 expression was significantly decreased in Eca-109 and KYSE-150 cells transfected with si-circNTRK2, while a dramatical up-regulation of circNTRK2 was found in circNTRK2-transfected group. Since si-circNTRK2 #2 possessed the highest knockdown efficiency, it was used in the following experiments. CCK-8 assay showed that down-regulation of circNTRK2 decreased cell viability in Eca-109 and KYSE-150 cells, while overexpression of circNTRK2 increased cell viability in EC-9706 cells (Fig. 2B). Similarly, EdU assays revealed that cell proliferation ability was notably inhibited in si-circNTRK2 group, but was apparently enhanced by circNTRK2 (Fig. 2C). Colony formation assay further verified the anti-proliferative roles of circNTRK2 knockdown in Eca-109 and KYSE-150 cells and the pro-proliferative effects of circNTRK2 up-regulation in EC-9706 cells (Fig. 2D). As demonstrated by transwell assay, silencing of circNTRK2 led to a decline of invasive ability in Eca-109 and KYSE-150 cells, while enforced expression of circNTRK2 resulted in an enhancement of invasion in EC-9706 cells (Fig. 2E). In agreement with the above findings, western blot clarified an increase of E-cadherin expression and a reduction of Vimentin expression in Eca-109 and KYSE-150 cells with circNTRK2 depletion, while circNTRK2 overexpression displayed an opposite effect (Fig. 2F). Flow cytometry analysis with Annexin V/PI double staining showed that down-regulation of circNTRK2 promoted apoptosis in Eca-109 and KYSE-150 cells (Fig. 2G). Consistently, knockdown of circNTRK2 in Eca-109 and KYSE-150 cells significantly enhanced the expression of apoptosis-related protein including cleaved PARP and cleaved caspase-3 (Fig. 2H). Taken together, these results indicated that knockdown of circNTRK2 inhibited ESCC cell proliferation and invasion, and induced apoptosis.

In order to seek for the potential molecular mechanism of circNTRK2 in ESCC progression, subcellular fractionation was performed in ESCC cells. As exhibited in Fig. 3A, circNTRK2 was mostly located in the cytoplasm of Eca-109 and KYSE-150 cells. Accumulating evidence supports the idea that circRNAs could act as miRNA sponges to affect mRNA stability and transcription at the post-transcriptional level in cancer [16]. Thus, we speculate the oncogenicity of circNTRK2 in ESCC was attributed to the similar mechanism. Firstly, the putative candidate targets of circNTRK2 were searched in CircInteractome, CircBank, StarBase 3.0 online databases. The Venn diagram displayed hsa-miR-140-3p and hsa-miR-432-5p via overlapping the prediction results (Fig. 3B). According to the data from dbDEMC 2.0 (https://​www.​picb.​ac.​cn/​dbDEMC/​search.​html), decreased expression of miR-140-3p was observed in esophagus cancer. Hence, miR-140-3p was chosen as the research subject. The complementary bases between circNTRK2 and miR-140-3p were shown in Fig. 3C. Moreover, silencing of circNTRK2 promoted the level of miR-140-3p, while overexpression of circNTRK2 reduced miR-140-3p expression in Eca-109 and KYSE-150 cells (Fig. 3D). Nevertheless, circNTRK2 expression was unchanged due to miR-140-3p up-regulation or knockdown (Fig. 3E). Subsequent dual-luciferase reporter assays showed that transfection of miR-140-3p lowered the luciferase activity of circNTRK2-wt reporter in comparison with that in miR-NC group; however, no significant fluctuation was found in the luciferase activity of circNTRK2-mut reporter between miR-NC and miR-140-3p group (Fig. 3F). RIP assay revealed that Ago2 pulled down much more circNTRK2 in miR-140-3p group than that in miR-NC group (Fig. 3G). RNA pull-down experiments clarified that in contrast to Bio-miR-NC, Bio-miR-140-3p-wt captured more circNTRK2 in ESCC cells, but the this effect was disappeared when the binding sites on circNTRK2 were mutated (Fig. 3H). As expected, miR-140-3p expression was confirmed to be lowered in ESCC tissue specimens and cell lines (Fig. 3I and K). Also, the scatter plot revealed that the level of miR-140-3p was negatively correlated with circNTRK2 expression in ESCC tissues (Fig. 3J). To sum up, circNTRK2 suppressed miR-140-3p expression in ESCC cells by acting as a molecular sponge.

To gain insight into the functions of miR-140-3p, and further address whether it was associated with circNTRK2 in ESCC, Eca-109 and KYSE-150 cells were transfected with miR-140-3p alone or co-transfected with miR-140-3p and circNTRK2. As shown in Fig. 4A, the level of miR-140-3p was significantly up-regulated in Eca-109 and KYSE-109 cells transfected with miR-140-3p, while introduction of circNTRK2 reversed this promotion effect. Functionally, overexpression of miR-140-3p significantly repressed cell viability (Fig. 4B), EdU-positive cell rate (Fig. 4C) and colony forming ability (Fig. 4D), and such anti-proliferative effects were abated by the up-regulation of circNTRK2. Analogously, miR-140-3p mimic dramatically inhibited cell invasion, while this effect were neutralized after co-transfection with circNTRK2 (Fig. 4E). Moreover, E-cadherin expression was increased and Vimentin expression was declined in Eca-109 and KYSE-150 cells with miR-140-3p overexpression, however, these changes were greatly reversed after co-transfection with circNTRK2 and miR-140-3p (Fig. 4F). In addition, overexpression of miR-140-3p resulted in an increase of apoptotic rate in Eca-109 and KYSE-109 cells, whereas miR-140-3p-induced apoptosis was relieved following the up-regulation of circNTRK2 (Fig. 4G). Collectively, circNTRK2 promoted cell malignant phenotypes in ESCC through sponging miR-140-3p.

To gain insight into the underlying mechanisms of miR-140-3p involved in ESCC, we used 5 online databases TargetScan, miRDB, DIANA-microT, DIANA-TarBase, and miRTarBase to search for the candidate targets of miR-140-3p. As presented in Venn Diagram, 6 putative targets (NFYA, DAZAP2, CDK6, ACVR2B, VKORC1L1, and NRIP1) were found (Fig. 5A). Then, the effects of miR-140-3p on these gene expressions were explored in Eca-109 and KYSE-150 cells. The result showed that only NRIP1 expression was declined in both Eca-109 and KYSE-150 cells transfected with miR-140-3p (Fig. 5B). Thus, NRIP1 was selected as the target gene for further experiments. Western blot assays revealed that overexpression of miR-140-3p repressed the protein level of NRIP1 in Eca-109 and KYSE-150 cells (Fig. 5C). As exhibited in Fig. 5D, the complementary binding sites between 3’UTR of NTRP1 and miR-140-3p were predicted in two sites (893–900 and 3086–3092). Dual-luciferase reporter assay demonstrated that miR-140-3p mimic significantly decreased the luciferase activity of NRIP1-wt reporter in Eca-109 and KYSE-150 cells. Single mutation of the putative binding sequences in NRIP1-wt, namely NRIP1-mut1 or NRIP1-mut2, partially restored the luciferase activity suppressed by miR-140-3p, while mut1 + 2 reporter with double mutation completely reversed miR-140-3p-induced inhibition of luciferase activity (Fig. 5E). According to Gene Expression Profiling Interactive Analysis (GEIPA) database, level of NRIP1 was higher in tumor tissues than that in normal specimens in esophageal carcinoma (Fig. 5F). Subsequent qRT-PCR results further verified the up-regulation of NRIP1 in ESCC tissues when compared with their adjacent normal tissues (Fig. 5G). Besides, a negative correlation between NRIP1 and miR-140-3p was observed in esophageal carcinoma by using starBase Pan-Cancer Analysis (Fig. 5H). As depicted by western blot assay in Fig. 5I, the protein level of NRIP1 was elevated in circNTRK2-transfected Eca-109 and KYSE-150 cells, while this effect was attenuated by the recovery of miR-140-3p expression. The scatter diagram presented that NRIP1 expression was positively correlated with circNTRK2, but negatively associated with miR-140-3p in ESCC tissues (Fig. 5J and K). These findings supported that circNTRK2 up-regulated NRIP1 expression in ESCC cells through sponging miR-140-3p.

Next, a specific siRNA targeting NRIP1 (si-NRIP1) was transfected into ESCC cells to investigate the function of NRIP1 in ESCC. The knockdown efficiency was confirmed by western blot assay in Eca-109 and KYSE-150 cells (Fig. 6A). Functionally, knockdown of si-NRIP1 resulted in a striking suppression of cell viability (Fig. 6B), colony formation ability (Fig. 6C) and invasiveness (Fig. 6D). Moreover, cell apoptosis was greatly increased in Eca-109 and KYSE-150 cells with NRIP1 down-regulation (Fig. 6E). Consistently, silencing of NRIP1 lead to an increase of cleaved PARP, cleaved caspase-3 and E-cadherin expression, while a decrease of Vimentin expression (Fig. 6F). These data indicated that knockdown of NRIP1 exerted a tumor-suppressive effect in ESCC in vitro.

To further confirm the detailed mechanism of circNTRK2 in ESCC, rescue experiments were performed in Eca-109 cells by transfection with si-circ #2 or si-circ #2 + NRIP1. As shown in Fig. 6G, si-circ #2-induced suppression of NRIP1 was reversed by co-transfection with NRIP1-overexpression vector. Moreover, si-circ #2-mediated inhibition of cell proliferation, colony forming ability and invasion was markedly abated by NRIP1 up-regulation (Fig. 6H-J). By and large, circNTRK2 facilitated ESCC progression through regulating NRIP1 expression.

To validate the effects of circNTRK2 on ESCC progression in vitro, KYSE-150 cells stably infected with lentivirus vectors encoding sh-circNTRK2 or sh-NC were injected into nude mice. As depicted in Fig. 7A, tumor growth was significantly slowed down by the knockdown of circNTRK2. Consistently, the weights of tumors derived from sh-circNTRK2-transfected cells were decreased compared to the control group (Fig. 7B). As we might expect, the level of circNTRK2 were declined, while miR-140-3p expression was increased in the excised tumor tissues of sh-circNTRK2 group compared to that of sh-NC group (Fig. 7C and D). Moreover, silencing of circNTRK2 led to a down-regulation of NRIP1 protein level (Fig. 7E). These data demonstrated that depletion of circNTRK2 impeded ESCC tumor growth in vivo.