Background
Microglial cells are resident macrophages of the nervous system with pivotal roles in innate immune regulation and neuronal homeostasis [
1,
2]. They are cells of the mononuclear phagocyte lineage but their unique localization within the nervous system and their morphological features clearly distinguish them from other macrophage populations [
3]. Ramified microglial cells actively scan their environment with their long protrusions [
4,
5] and continuous inhibitory signals from neurons prevent microglial toxicity [
6,
7]. Disconnection of the microglia-neuron cross-talk [
8], local danger signals such as released ATP [
9], or neurotransmitter gradients [
10] can lead to a functional transformation of microglial populations with a variety of effector functions. Consequently, alarmed microglia and reactive microgliosis have been identified in a variety of neurodegenerative diseases including Alzheimer's disease [
11], Parkinson's disease [
12], amyotrophic lateral sclerosis [
13], multiple sclerosis [
14], and inherited photoreceptor dystrophies [
15]. The concept of a microglia-targeted pharmacotherapy to prevent neurodegeneration in the brain and the retina is therefore a promising approach under active investigation [
16,
17].
There is a growing interest in the identification of natural compounds that limit neuroinflammation and simultaneously support neuronal survival [
18,
19]. Among the naturally occuring immuno-modulators, curcumin ((E, E)-1,7-bis(4-hydroxy-3-methoxyphenyl)-1,6-heptadiene-3,5-dione), a major constituent of tumeric, is a herbal medicine used for centuries in India and China [
20]. Curcumin has a wide range of pharmacological activities including anti-inflammatory, anti-microbial, antioxidant, and anti-tumor effects [
21]. Curcumin is a particularly potent immuno-regulatory agent that can modulate the activation and function of T-cells, B-cells, neutrophils, natural killer cells and macrophages [
22].
Curcumin treatment effectively inhibits the activation of microglial cells by diminishing the production of nitric oxide [
23] and reducing the secretion of pro-inflammatory cytokines such as IL1β, IL6 and TNF [
24]. Moreover, curcumin blocks the LPS-mediated induction of cyclooxygenase-2 (COX2) via inhibition of the transcription factors nuclear factor kappa B (NFkB), activator protein 1 (AP1), and signal transducers and activators of transcription (STATs) [
25,
26]. Recent experiments have also demonstrated that curcumin protects dopaminergic neurons against microglia-mediated neurotoxicity [
27], limits brain inflammation [
28], and rescues retinal cells from stress-induced cell death [
29].
The inhibitory role of curcumin on pro-inflammatory gene expression in microglia is well documented. However, this information is limited to only a few well-studied examples including pro-inflammatory cytokines, Nos2 and COX2. In a genome-wide search for target genes, we investigated the transcriptomic effects of curcumin in resting and LPS-activated BV-2 microglial cultures using DNA-microarrays. Furthermore, we validated the curcumin-regulated expression of microglial transcripts with qRT-PCR and studied the related microglial migration and neurotoxicity.
Methods
Reagents
Curcumin and E.coli 0111:B4 lipopolysaccharide were purchased from Sigma Aldrich (Steinheim, Germany). Curcumin was dissolved in DMSO and added in concentrations that did not exceed 0.05% of the total volume in any of the cell culture experiments.
Cell culture
BV-2 microglia-like cells were provided by Professor Ralph Lucius (Clinic of Neurology, Christian Albrechts University, Kiel, Germany). BV-2 cells were cultured in RPMI/5% FCS supplemented with 2 mM L-Glutamine and 195 nM β-mercaptoethanol. BV-2 cells were stimulated with 100 ng/ml LPS, 20 μM of curcumin, or DMSO as control for 6 h. These stimulation conditions were adapted from previously published experiments [
24,
30]. MTT assays revealed that 100 ng/ml LPS, 20 μM curcumin, or a combination of both had no cytotoxic effects on BV-2 cells (data not shown). 661W photoreceptor-like cells were a gift from Prof. Muayyad Al-Ubaidi (University of Illinois, Chicago, IL) and the culture conditions have been described elsewhere [
31].
Scratch assay
500.000 BV-2 cells were grown in 6-well plates as 80% confluent monolayers and were wounded with a sterile 100 μl pipette tip. Thereafter, the cells were stimulated with 100 ng/ml LPS, 20 μM of curcumin, 100 ng/ml LPS + 20 μM of curcumin, or DMSO as solvent control. Migration into the open scar was documented with microphotographs at different time points after wounding. The number of migrating cells was quantified by counting all cells within a 0.4 mm2 region in the center of each scratch. A minimum of 5 individual cultures was used to calculate the mean migratory capacity of each cell culture condition.
Transwell migration assay
The Costar Transwell System (8-μm pore size polycarbonate membrane) was used to evaluate vertical cell migration. 1 Mio BV-2 cells in 1.5 ml serum-free medium were added to the upper well, and 2.6 ml serum-free medium was added to the lower chamber. 100 ng/ml LPS, 20 μm curcumin, 100 ng/ml LPS + 20 μm curcumin, or DMSO as solvent control were added to the lower chamber medium. At the end of a 24 h incubation period, cells that had migrated to the lower surface were quantified by counting the migrated cells on the lower surface of the membrane using microscopy.
661W co-culture in microglia-conditioned medium and apoptosis assay
To test microglial neurotoxicity, a culture system of 661W photoreceptors with microglia conditioned medium was established. 661W cells were incubated for 48 h either in their own medium or with culture supernatants from unstimulated, 100 ng/ml LPS, 20 μM curcumin, or 100 ng/ml LPS + 20 μM curcumin treated microglial cells. The 661W cell morphology was assessed by phase contrast microscopy and apoptotic cell death was determined with the Caspase-Glo® 3/7 Assay (Promega). Cells were lysed and incubated with a luminogenic caspase-3/7 substrate, which contains the tetrapeptide sequence DEVD. Luminescence was then generated by addition of recombinant luciferase and was proportional to the amount of caspase activity present. The luminescent signal was read on a BMG FluoStar Optima plate reader (Labtech, Offenburg, Germany). A blank reaction was used to measure background luminescence associated with the cell culture system and Caspase-Glo® 3/7 Reagent. The value for the blank reaction was subtracted from all experimental values. Negative control reactions were performed to determine the basal caspase activity of 661W cells. Relative luciferase units (RLU) reflect the level of apoptotic cell death in the different 661W cell cultures.
RNA isolation and reverse transcription
Total RNA was extracted from cultured microglial cells according to the manufacturer's instructions using the RNeasy Protect Mini Kit (Qiagen, Hilden, Germany). Purity and integrity of the RNA was assessed on the Agilent 2100 bioanalyzer with the RNA 6000 Nano LabChip® reagent set (Agilent Technologies, Böblingen, Germany). The RNA was quantified spectrophotometrically and then stored at -80°C. First-strand cDNA synthesis was performed with RevertAid™ H Minus First Strand cDNA Synthesis Kit (Fermentas, St. Leon-Rot, Germany).
DNA-microarray analysis
4 × 44 K microarrays (014868) (Agilent Technologies) were used for hybridization with three independent RNAs from non-stimulated BV-2 microglial cells or cultures treated for 6 h with 20 μM curcumin, 100 ng/ml LPS, or 20 μM curcumin + 100 ng/ml LPS, respectively. Briefly, 200 ng of total RNA were labeled with Cy3 using the Agilent Quick-Amp Labeling Kit - 1 color according to the manufacturer's instructions. cRNA was purified with the RNeasy Mini Kit (Qiagen) and labeling efficiency was determined with a NanoDrop ND-1000 photometer (PeqLab). The arrays were incubated with cRNAs in Agilent SureHyb chambers for 17 hours at 65°C while rotating. After washing, scanning was done with the Agilent G2565CA Microarray Scanner System and the resulting TIFF files were processed with Agilent Feature Extraction software (10.7.). Minimum information about a microarray experiment (MIAME) criteria were met [
32]. The microarray dataset of this study is publicly available at the National Center for Biotechnology Information Gene Expression Omnibus
http://www.ncbi.nlm.nih.gov/geo/ as series record GSE23639.
Integrative analysis of genome-wide expression activities from BV-2 cells was performed with the Gene Expression Dynamics Inspector (GEDI), a Matlab (Mathworks, Natick, MA) freeware program which uses self-organizing maps (SOMs) to translate high-dimensional data into a 2D mosaic [
33]. Each tile of the mosaic represents an individual SOM cluster and is color-coded to represent high or low expression of the cluster's genes, thus identifying the underlying pattern. The Partek Genomics Suite (Partek Inc.) was used for ANOVA analysis and hierarchical clustering of normalized expression values. Differentially regulated transcrips in curcumin-stimulated versus non-treated and curcumin + LPS versus LPS-treated BV-2 cells, respectively, were retrieved with the Genomatix ChipInspector program (Genomatix Software GmbH, Munich, Germany), applying the Significance Analysis of Microarray (SAM) algorithm using a false-discovery rate of 0.1%.
Quantitative real-time RT-PCR
Amplifications of 50 ng cDNA were performed with an ABI7900HT machine (Applied Biosystems) in triplicates in 10 μl reaction mixtures containing 1×TaqMan Universal PCR Master Mix (Applied Biosystems), 200 nM of primers and 0.25 μl dual-labeled probe (Roche ProbeLibrary). The reaction parameters were as follows: 2-min 50°C hold, 30-min 60°C hold, and 5-min 95°C hold, followed by 45 cycles of 20-s 94°C melt and 1-min 60°C anneal/extension. Measurements were performed in triplicate. Results were analyzed with an ABI sequence detector software version 2.3 using the ΔΔCt method for relative quantitation. A Ct (cycle threshold) < 35 was used as cutoff for estimating significantly expressed transcripts and cDNA samples with values > 35 were marked with n.e. for
not
expressed. Ct-values between 35 and 40 were solely used for calculation of relative expression differences in treated cells versus control cells. Primer sequences and Roche Library Probe numbers are listed in Table
1.
Table 1
Primer pairs and Roche library probes for real-time qRT-PCR validation
Atp5b
| ggcacaatgcaggaaagg | tcagcaggcacatagatagcc | 77 |
C3
| accttacctcggcaagtttct | ttgtagagctgctggtcagg | 76 |
Ccl2
| catccacgtgttggctca | gatcatcttgctggtgaatgagt | 62 |
Dll1
| ttcaactgtgagaagaagatggat | gccgaggtccacacactt | 103 |
Egr2
| ctacccggtggaagacctc | aatgttgatcatgccatctcc | 60 |
Il4
| catcggcattttgaacgag | cgagctcactctctgtggtg | 2 |
Il6
| gatggatgctaccaaactggat | ccaggtagctatggtactccaga | 6 |
Nos2
| ctttgccacggacgagac | tcattgtactctgagggctga | 13 |
Ntng1
| aggggcaagagaccaagg | agggatggtgtctatcgtcct | 103 |
Pecam1
| cggtgttcagcgagatcc | cgacaggatggaaatcacaa | 45 |
Perp1
| tcatatgccggctcacct | atccactggcgtctggagt | 110 |
Pparα
| ccgagggctctgtcatca | gggcagctgactgaggaa | 11 |
Ptgs2
| gatgctcttccgagctgtg | ggattggaacagcaaggattt | 45 |
Stat1
| aaatgtgaaggatcaagtcatgtg | catcttgtaattcttctagggtcttga | 15 |
Tlr2
| accgaaacctcagacaaagc | cagcgtttgctgaagagga | 49 |
Statistical analyses
Statistical analyses were performed on ΔΔCt data using the Mann-Whitney Rank Sum test and quantitative expression data are expressed as mean ± SD plotted at a logarithmic scale. Gene expression levels in control BV-2 cells were used as calibrators. The Student's t test or Mann-Whitney Rank Sum test were used for the comparison of experimental groups in cell migration assays and apoptosis assays as indicated. p < 0.05 was considered significant.
Discussion
Oxidative stress and neuroinflammation are major factors in the pathogenesis of neurodegenerative disorders [
36]. Therefore, antioxidant and anti-inflammatory compounds like curcumin may be treatment options for this group of diseases [
37]. However, only few experimental data are available that report on curcumin-triggered transcriptional mechanisms and direct signaling targets in microglia.
Our transcriptomic analysis in BV-2 cells sheds some light on target genes and potential signaling mechanisms. We identified a prominent transcriptional response of resting as well as LPS-activated microglial cells after curcumin treatment. Distinct gene clusters were detected that reflect up-regulated and suppressed transcripts in both microglial phenotypes. We identifed and validated six genes that were constistently induced in resting as well as activated BV-2 cells that have not been described as curcumin targets before. Among these, four curcumin target genes are related to cell migration. Netrin G1 is a lipid-anchored protein that is structurally related to the netrin family of axon guidance molecules [
38]. It regulates synaptic interactions between neurons by binding to transmembrane netrin G ligands [
39]. Interestingly, the related Netrin 1 molecule is a broad inhibitor of leukocyte chemotaxis [
40] and Netrin G1 may have a similar function in microglia. The adhesion molecule PECAM1 is also directly involved in monocyte/macrophage migration [
41]. Another migration-related gene induced by curcumin is Plasma cell endoplasmic reticulum protein 1. PERP 1 is a molecular chaperone required for proper folding and secretion of immunoglobulins in B-cells [
42,
43]. Related to our study, a recent report linked PERP 1 (alias MZB1) to calcium signaling, activation of integrins and cell adhesion [
44]. Expression of the Notch-ligand Delta-like 1 has been demonstrated in BV-2 cells and primary rat brain microglial cells, where Notch-1 signaling negatively regulates TNF release [
45]. Our data show that basal Dll1 expression in resting microglial cells can be potently induced by curcumin, which could potentially trigger Notch-signaling to prevent migration associated with pro-inflammatory priming of BV-2 cells.
These transcriptomic data of curcumin-treatment promoted us to analyze its effects on microglial motility. Both types of assays, the wound healing assays and the transwell migration experiments, showed that BV-2 cell migration was significantly inhibited by 20 μM curcumin over a period of 12 hours to 24 hours. These findings are in good agreement with papers reporting reduced migration of tumor cells, endothelial cells, and dendritic cells after treatment with comparable doses of cucumin [
46‐
48]. In the homeostatic state, microglia constantly scan their environment with their long protrusions without movement of the somata [
5]. In contrast, migration of microglial cells is a hallmark of pro-inflammatory and chronic activation during early phases of neurodegeneration. Thus, curcumin may support the homeostatic state of microglia and prevent their early and excessive transformation into migrating phagocytes.
It is well known that curcumin broadly inhibits pro-inflammatory gene expression by targeting different signal pathways and transcriptional regulators including NFkB, AP1, EGR1, and STAT3 [
49]. Our microarray data corroborate these findings especially in LPS-activated BV-2 cells by showing curcumin-triggered suppression of Ptgs2, Ccl2, Il6, and Nos2, which are NFkB, AP1, and STAT3 target genes [
21]. Moreover, the curcumin-regulated transcriptomic profiles revealed lower gene expression of toll-like receptor 2 in resting microglia and complement factor 3 in activated cells. These two factors broadly support the conversion of microglial cells to the pro-inflammatory state [
50,
51] and hence curcumin signaling may abrogate both pathways. Our data also showed diminished mRNA expression of the transcription factors Egr2 and Stat1 following curcumin-treatment. This indicates that curcumin may further dampen microglial activation by interfering with two other key transcription factors expressed in activated microglial cells. In addition to its inhibitory effects on pro-inflammatory signaling, two well known anti-inflammatory molecules, PPARα and IL4, were significantly induced by curcumin. PPARα and IL4 both specifically inhibit pro-inflammatory activation of microglial cells [
52,
53] and some of the immune-dampening effects of curcumin may be mediated via this signaling axis.
The cell culture experiments with conditioned media from BV-2 cells showed that curcumin significantly reduced LPS-triggered microglial neurotoxicity on 661W photoreceptor cells. We hypothesize that the strong suppression of LPS-induced Nos2 transcription by curcumin is a major pathway responsible for this phenomenon. In this context, Mandal
et al. have recently demonstrated that curcumin protects 661W cells from hydrogen peroxide-induced cell death [
29]. This effect is very likely mediated by the antioxidant and radical-scavenging capacity of curcumin. In a model of light-induced retinal degeneration, curcumin also suppressed inflammatory marker expression
in vivo [
29], which could be potentially mediated by its attenuating effect on retinal microglia.
Conclusions
We have shown that curcumin triggered global changes in the transcriptome of resting and LPS-activated microglial cells. In addition to its known function in blocking pro-inflammatory gene expression via interference with NFkB signaling, curcumin induced novel anti-inflammatory targets in microglia. Curcumin also significantly inhibited microglial migration and cytotoxicity, which are key features of neuroinflammation. Our publicily avialable dataset provides a basis to understand the pleiotropic beneficial effects of curcumin on microglia as key innate immune cells of the nervous system. Moreover, the results of this study also underscore the importance of curcumin as a promising dietary compound for the treatment of various neurodegenerative disorders associated with inflammation.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
MK, EL, and YW carried out cell culture stimulations and qRT-PCR experiments. MK and EL analyzed qRT-PCR and functional data. CM performed microarray analysis. AA performed scratch assays. MM critically read and corrected the paper. TL designed the study, obtained funding, carried out biostatistical analyses of microarrays and wrote the manuscript. All authors read and approved the final manuscript.