Introduction
Metastatic cancer is a largely incurable disease and responsible for 90% of human cancer deaths [
1]. To develop metastasis in a distant organ, cancer cells must initially disseminate from the primary tumor and invade through the surrounding basement membrane and stroma into lymphatic or blood vessels, followed by survival, extravasation and re-implantation at a secondary site [
2]. As cancer cell motility and invasiveness are critical features in the initial development of metastasis, many molecules involved in these processes are becoming attractive therapeutic targets [
3]. Understanding the molecular mechanisms that govern these early processes may provide insightful strategies for the prevention of cancer progression and metastasis.
The transforming growth factor beta (TGFβ) superfamily is comprised of many members, including activins, anti-Müllerian hormone, bone morphogenetic proteins, growth and differentiation factors, inhibins and TGFβs [
4]. Among these family members, TGFβ ligands and its receptors are widely expressed in all tissues and the regulatory role played by these growth factors is of central importance to human cancer development and progression. TGFβ can be released from storage sites in the extracellular matix (ECM) and bone, as well as secreted in a paracrine and autocrine manner by platelet, myeloid, mesenchymal and cancer cells [
5‐
7]. The increasing amount of TGFβ1 is correlated with a high incidence of distant metastasis as TGFβ acts on the tumor cells and the surrounding stroma to promote epithelial to mesenchymal transition (EMT), ECM degradation, cell migration, cell invasion, angiogenesis, immunosuppression and modification of the tumor microenvironment [
8‐
11]. Intravital imaging of live tumor-bearing nude mice demonstrated that active TGFβ signaling is heterogeneously distributed in a minority of cancer cells within primary mammary tumors [
12]. The activation of TGFβ signaling promotes single tumor cell migration and metastatic spread into blood vessels and lymph nodes. However, not all cells with active TGFβ signaling are migratory, suggesting differential TGFβ signaling events and specific downstream targets are required for this process.
TGFβ signal transduction begins with ligand binding to the TGFβ type II receptor, which recruits and activates the type I receptor. The activated type I receptor then phosphorylates intracellular mediators known as receptor-regulated Smads (R-Smads), Smad2 and Smad3. This phosphorylation event allows for subsequent heterotrimerization of two phosphorylated R-Smad subunits with one common partner, Smad4 [
13,
14]. The Smad heterotrimer then translocates to the nucleus where it can bind DNA, but with a very low affinity [
15]. In order to achieve high affinity binding, the Smads associate with various DNA binding partners [
16]. It is thought that these partner proteins, which act as co-activators or co-repressors, are functionally expressed in different cell types, thus providing a basis for tissue and cell type-specific functions for TGFβ ligands [
17].
Perturbations in the regulation of the cell cycle machinery often occur in human cancers, resulting in an imbalance between cell growth and cell death [
18]. In addition, several reports have proposed that deregulation of cell cycle regulators results not only in proliferative advantages, but also in increased tumor progression and aggressiveness traits [
19]. Cell cycle progression is primarily mediated through interactions between the different cyclins with their respective cyclin-dependent kinases (CDKs). Among the different cyclins, cyclin D1 and cyclin E are associated with the G1-S phase transition [
20]. Cyclin D1 interacts with CDK4 and 6, while cyclin E interacts more specifically with CDK2 [
21‐
25]. The activity of the cyclin-CDK complexes is regulated by two classes of small proteins referred to as cyclin-dependent kinases inhibitors (CDKIs). The INK4 family, which includes p15INK4, p16INK4A, p18INK4C and p19INK4D, specifically binds to CDK4 and 6, thereby preventing their association with the D-type cyclins [
26‐
29]. The KIP family includes p21CIP1/WAF1 (p21), p27KIP1 and p57KIP2 [
30‐
35]. While the KIP family members are usually associated with cyclin E-CDK and cyclin A-CDK complexes, many reports indicated that they also interact with cyclin D-CDK complexes [
30,
36‐
38].
Many of these cell cycle regulators are primary targets of TGFβ signaling in human cancers [
39‐
41]. Interestingly, some of these cell cycle regulators, in particular cyclin D1 and p21, are often over-expressed in many human cancers and their levels are correlated with high tumor grade, poor prognosis, and increased metastasis in subsets of carcinomas such as breast, prostate, cervical carcinomas and lymphomas [
42,
43]. We previously demonstrated that p21 is a transcriptional co-regulator of Smad that mediates TGFβ-induced breast cancer cell migration and invasion in metastatic breast cancer cells [
44]. This prompted us to explore the roles of other cell cycle regulators in promoting tumor progression in breast cancer, aside from their well-established functions in cell cycle regulation. Thus, we investigated the effects of cyclins, in particular cyclin D1, downstream of TGFβ-mediated tumor progression. Indeed, several studies have supported the notion that the oncogenic effects of cyclin D1 may not be simply due to enhanced tumor cell growth or proliferation. These include reports showing a lack of correlation between cell proliferation and cyclin D1 expression in several large cohorts of 779 breast cancer patients [
45,
46] and the fact that elevated cyclin D1 expression is associated with a high incidence of metastasis and poor survival outcome [
47,
48], suggesting that cyclin D1 may play a role in promoting invasiveness of established tumors.
In this study, we found that TGFβ induced mRNA and protein expression of cyclin D1 in breast cancer cells with a highly migratory phenotype. Moreover, we found TGFβ to induce complex formation and nuclear co-localization of cyclin D1 and p21, indicating that these two proteins may cooperate to mediate TGFβ functions in aggressive human breast cancer cells. Furthermore, using gene silencing approaches, our results indicate that TGFβ-mediated cyclin D1 expression is a prerequisite for TGFβ-induced breast cancer cell migration. Orthotopic injection of cyclin D1/p21 null human breast cancer cells in nude mice considerably reduced mammary tumor growth in vivo, compared to animals injected with parental tumor cells. Moreover, we found that following fat pad transplantation, parental breast cancer cells invaded into the surrounding mammary tissues, while these effects were blocked when cyclin D1 and p21 gene expression were silenced. Collectively, these data indicate that TGFβ-mediated cyclin D1 and p21 gene expression leads to increased breast cancer migration and invasion in vitro and that blocking expression of these two cell cycle regulators in aggressive human breast tumors significantly reduced both tumor formation and local tumor invasion into the surrounding tissues in vivo.
Methods
Cell culture and transfection
Human breast cancer cell lines MDA-MB-231 (hereafter referred to as MDA) and SCP2 (provided by Dr. Joan Massagué) were cultured in DMEM containing 10% fetal bovine serum (FBS) and 2 mM L-glutamine. SUM149PT, SUM159PT and SUM229PE (provided by Dr. Stephen P. Ethier) were plated in F-12 HAM'S nutrient mixture (HyClone Laboratories, Inc., Logan, UT, USA) containing 5% FBS, 5 µg/ml insulin (Sigma-Aldrich, St. Louis, MO, USA), and 1 µg/ml hydrocortisone (Sigma). SUM1315MO2 were cultured in F-12 HAM'S nutrient mixture (HyClone) containing 5% FBS, 5 µg/ml insulin (Sigma), and 10 ng/ml epidermal growth factor (EGF) (Sigma). All cell lines were grown at 37°C in 5% CO2. Before stimulation with 5 ng/ml TGFβ1 (PeproTech, Rocky Hill, NJ, USA), cells were serum-starved overnight. For cell transfection, flag-tagged p21 cDNA (Addgene plasmid 16240), HA-tagged cyclin D1 cDNA (Addgene plasmid 11181), scrambled and cyclin D1 siRNAs (Sigma) were transfected using Lipofectamine™ 2000 (Invitrogen, Carlsbad, CA, USA), according to the manufacturers' protocols.
Western blot analysis and immunoprecipitation
Protein extraction buffer containing 10 mM Tris-HCl, pH 7.5, 5 mM EDTA, 150 mM NaCl, 30 mM sodium pyrophosphate, 50 mM sodium fluoride, 1 mM sodium orthovanadate, 1% Triton X-100 and protease inhibitors (1 mM phenylmethylsulfonyl fluoride, 10 µg/ml leupeptin hydrochloride, 10 µg/ml aprotinin and 10 µg/ml pepstatin A) were freshly prepared and kept at 4°C before cell lysis. After cell lysates were centrifuged at 14,000 rpm for 15 minutes at 4°C, the concentration of total protein was quantified using a BCA protein assay kit (Thermo Scientific, Rockford, IL, USA). Cell lysates were boiled with 6× sodium dodecyl sulfate (SDS) Laemmli sample buffer for five minutes and subjected to immunoblot using mouse anti-p21 and rabbit anti-cyclin D1 antibodies (1:1,000 dilution, Santa Cruz Biotechnology, Santa Cruz, CA, USA). p21 and cyclin D1 were immunoprecipitated overnight at 4°C using their respective antibodies and followed by the addition of protein G-Sepharose beads (GE Healthcare Bio-Sciences, Piscataway, NJ, USA) for one hour at 4°C. The immunocomplexes were washed four times with cold lysis buffer and then subjected to Western blot.
Real-Time PCR
TRIzol reagent (Invitrogen) was used to extract total RNA and reverse transcription of total RNA was carried out using M-MLV reverse transcriptase and random primers (Invitrogen) according to the manufacturer's instructions. SsoFast™EvaGreenÒ Supermix (Bio-Rad, Hercules, CA, USA) was used for amplification of the cyclin D1 mRNA in a Rotor Gene 6000 PCR detection system (MBI Lab Equipment, Montreal Biotech Inc., Kirkland, QC, Canada). The conditions for PCR were as follows: 95°C for 30 s, 40 cycles (95°C for 5 s and 59°C for 20 s). The primer sequences were as follows: cyclin D1 forward primer, AGCTGTGCATCTACACCGAC; reverse primer, ACTCCAGCAGGGCTTCGATCTG; GAPDH forward primer, GCCTCAAGATCATCAGCAATGCCT; reverse primer, TGTGGTCATGAGTCCTTCCACGAT.
Kinetic cell migration assay
Cell migration was performed as previously described [
44]. Briefly, 50,000 cells per well were cultured in Essen ImageLock 96-well plates (Essen Bioscience, Ann Arbor, MI, USA). The confluent cell layers were scratched to generate a wound using the Essen Wound maker. Cells were then treated in the presence or the absence of 5 ng/ml of TGFβ1. The images/videos of the wound were automatically taken at the exact same location using the IncuCyte™software (Essen Bioscience). Wound width, wound confluence or relative wound density were automatically measured by the IncuCyte software.
Transwell cell migration assay
Transfected cell suspensions (40,000 cells/well) were seeded in 24-well Cell Culture Inserts (8-µm pore size; BD Biosciences, Mississauga, ON, Canada). After 24 hours incubation, the cells that migrated to the bottom of the membrane were fixed with 3.7% formaldehyde for 10 minutes and then labeled with the near-infrared fluorescence DNA binding dye DRAQ5 (2 µg/ml in PBS) at 37ºC for 5 minutes. The fluorescence intensity of migrated cells was measured at 700 nm in a near-infrared fluorescence imager (Odyssey CLX, LI-COR Biosciences - Biotechnology, Lincoln, NE, USA) using the Image Studio software (LI-COR Biosciences - Biotechnology).
Immunofluorescence microscopy
For the invadopodia formation assay, cells were grown on top of eight-well chamber slides coated with 100 µl growth factor-reduced Matrigel. After TGFβ treatment for 24 hours, cells were fixed with 3.7% formaldehyde for 10 minutes, permeabilized in 0.1% Triton X-100 for 3 minutes, and blocked for 1 hour in 2% bovine serum albumin (BSA). Fixed cells were incubated with primary antibodies against p21, cyclin D1, F-actin and vimentin for one hour and followed by the secondary antibodies Alexa Fluor®568 goat anti-rabbit IgG and Alexa Fluor®488 goat anti-rabbit (1:800 dilution; Invitrogen) for one hour. Nuclei were stained with DAPI (Invitrogen). Confocal analysis was performed using a Zeiss LSM 510 Meta Axiovert confocal microscope (Carl Zeiss, Oberkochen, Baden-Württemberg, Germany) using the 63× objective.
Mammary fat pad injection of nude mice
The animal study and SCP2 cells used in the mice model were approved by the McGill ethics committee (University Animal Care Committee, UACC) and all the experimental animal protocols were in accordance with the McGill University Animal Care. Four- to six-week old female Balb/c nude mice (Charles River Laboratories International, Wilmington, MA, USA) were used as a model for assessing mammary tumor formation and local invasion. An anesthetic cocktail of ketamine (50 mg/kg), xylazine (5 mg/kg) and acepromazine (1 mg/kg) was injected intramuscularly into mice (six per group). Fifty thousand parental SCP2 cells or p21 and cyclin D1 double knockdown SCP2 cells in 100 μl of saline (20% Matrigel) were injected into the mice mammary fat pads using a 30-gauge needle. Tumor growth and size were measured using a caliper. At eight weeks post-injection, mice were sacrificed and mammary tumors with surrounding skin and tissues were fixed in 10% neutral-buffered formalin for one day. Sections of mammary tumor were embedded in Tissue-Tek O.C.T. (VWR International, Radnor, PA, USA) compound and 9 µm thick sections were stained with hematoxylin and eosin to assess local advanced features, including skeletal muscle, mammary fat pad, and lymphovascular invasion as well as skin ulceration. Images of the tumors were photographed by light microscope using 10× and 20× objectives.
For intratibia injections, parental and p21/cyclin D1-depleted SCP2 cells (2.0× 106) were injected intramuscularly into the left tibia of two group mice (six per group). The mice were monitored weekly for tumor burden. Digital radiography of hind limbs of all animals was used to monitor the development of skeletal lesions at four, six and eight weeks post-injection in a MX-20 cabinet X-ray system (Faxitron X-ray Corp.). On week 8, radiographs of anesthetized mice were taken.
Statistical analyses
The difference between groups was analyzed using Student's t-test, and *P <0.05 was considered statistically significant.
Discussion
Cyclin D1 is a well-characterized oncogene that is frequently overexpressed in human breast, lung, colon, prostate and hematopoietic carcinomas [
60‐
62]. This is a unique feature among the three closely related D type G1 cyclins (D1, D2 and D3), as amplification of cyclin D2 and D3 copy-number is rarely observed in human cancer. In fact, methylation of cyclin D2 resulting in loss of its expression has been reported in breast, pancreatic and prostate cancer [
63‐
65]. In addition to the association between cyclin D1 expression and human cancer, overexpression of cyclin D1 is tumorigenic, as supported by evidence that MMTV-driven cyclin D1 is sufficient for mammary hyperplasia and carcinoma development in transgenic mice [
66]. Furthermore, cyclin D1 is required for many oncogenes, such as HER2 or Ras, to induce mammary tumor growth in mice [
57‐
59]. The function of cyclin D1 in mammary oncogenesis in mice is mediated through the activation of its regulatory partner CDK4, as mice lacking CDK4 or expressing the CDK4/CDK6-specific inhibitor INK4A are resistant to HER2-induced mammary tumor formation [
58,
67‐
69]. While these studies addressed the importance of cyclin D1 on breast tumor initiation, its contribution to the development and progression of established tumors remains unclear.
Several studies support the notion that the oncogenic effects of cyclin D1 may not be simply due to enhanced tumor cell growth or proliferation. For instance, cyclin D1 expression did not correlate with Ki67 expression in a cohort of 779 breast cancer patients [
45]. In another study of 1,740 breast cancer patients, cyclin D1 expression was not tightly associated with proliferative genes that are regulated by the inactivation of CDK4 substrate RB [
46]. In addition, high expression of cyclin D1 is associated with high incidence of metastasis and poor survival outcome [
47,
48]. Therefore, cyclin D1 is potentially required for continual development and progression of established tumors.
In this study, we investigated the function of cyclin D1 on breast tumor progression induced by TGFβ, a potent tumor-promoting factor, in metastatic breast cancer cell lines. Our results showed that the effect of TGFβ on cyclin D1 expression was specific, as protein levels of other cyclins in G1, S and M phase are unresponsive to TGFβ stimulation. Furthermore, using a panel of tumorigenic triple negative breast cancer cell lines, which exhibit differential responses to TGFβ in terms of cellular migration, we found cyclin D1 expression to correlate with p21 expression and to be required for TGFβ-induced cell migration. Furthermore, up-regulation of the cyclin D1 gene by TGFβ is more potent and persistent in highly migratory cell lines compared with less motile cells. This is consistent with a previous study using intravital imaging of live tumor-bearing nude mice, showing that although TGFβ signaling promotes single tumor cell migration and metastatic spread into blood vessels and lymph nodes, not all cells with active TGFβ signaling are migratory [
12]. Our results suggest that cyclin D1 is a specific downstream target for TGFβ-mediated cell migration.
Subcellular localization and stabilization of cyclin D1 play an important role in human cancers [
70]. We showed a TGFβ-induced nuclear localization of cyclin D1 in these metastatic breast cancer cell lines. It has been demonstrated that oncogenic actions of cyclin D1 are predominantly nuclear in many cancers, as carcinogenic mutations and deletions often occur at the T286 site, which controls cyclin D1 protein turnover and nuclear export [
71,
72]. Mutated cyclin D1 with constitutive nuclear localization and impaired degradation not only enhanced cyclin D1 transformation efficiency
in vitro, but also promoted tumor formation
in vivo [
73]. Our study further revealed that TGFβ-induced nuclear cyclin D1 promotes cell migration by altering cell morphology and the formation of invasive subcellular structures in metastatic breast cancer cells.
Cyclin D1 has been recognized as a multifunctional protein, which regulates angiogenesis, lipogenesis, mitochondrial function and cell migration [
53,
54,
74‐
78]. A recent study identified that more than 100 cyclin D1-interacting proteins are involved in the regulation of cell cycle, transcription, DNA repair, RNA metabolism, protein folding and cell structure [
79], suggesting that these interactors might influence various biological functions of cyclin D1. It has been shown that p21 interacts with cyclin D1 to promote nuclear accumulation of cyclin D1 [
80]. In addition, cyclin D1 associates with p21 to facilitate DNA repair, and this function of cyclin D1 is independent of CDK4 activation [
81,
82]. We demonstrated that in the context of TGFβ signaling, cyclin D1 associates with p21 in metastatic breast cancer cells. Furthermore, depletion of cyclin D1 and p21 prevented mammary tumor formation and subsequent local invasion into surrounding tissues. Our previous study showed that p21 is required for TGFβ-mediated cell migration and invasion; therefore, these results not only highlight cyclin D1 as a novel TGFβ downstream target, but also indicate that cyclin D1 cooperates with p21 to mediate the effect of TGFβ on breast cancer progression.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
MD and JJL were involved in designing all experiments, and analyzing and interpreting data. MD performed the experiments and wrote the manuscript. JG was involved in the immunofluoresent experiment. NFA was involved in the cell migration experiment. MAV participated in the immunohistochemistry experiment. JJL, NFA, MAV and SA assisted in drafting and editing the manuscript. SA was involved in the study design and result analysis and interpretation. AAA analyzed tumor local invasiveness. SAR and AA performed in vivo studies and analyzed the mammary tumor growth. All authors read and approved the final manuscript.