Background
Maturity-onset diabetes of the young (MODY) is an autosomal dominant form of non-ketotic, non-insulin dependent diabetes that is typically diagnosed before 25 years of age. The majority of MODY subjects are defined by mutations in six specific MODY-related genes, including the nuclear transcription factors hepatocyte nuclear factor (HNF)-1A and HNF-4A [
1‐
3]. HNF1A-MODY represents the most common form of MODY [
3‐
5]. Mutations in
HNF4A are less common than mutations in
HNF1A, however over 30 mutations have been identified to date [
6].
HNF1A and
HNF4A mutations cause a similar clinical phenotype of MODY, characterized by progressive beta-cell dysfunction, defects in glucose-stimulated insulin secretion [
7,
8] and sensitivity to low-dose sulphonylureas [
9]. However infants with
HNF4A mutations are at risk of developing macrosomia and transient as well as persistent hyperinsulinaemic hypoglycaemia [
10,
11]. Hence specific biomarkers that would differentiate between
HNF1A and
HNF4A mutations would facilitate better identification of these subtypes. In addition, features of
HNF1A and
HNF4A mutation carriers tend to overlap with type 1 diabetes, type 2 diabetes and other monogenic forms of diabetes [
12,
13]. Non-specific clinical features of MODY result in difficulty in selecting the appropriate molecular testing [
13]. Sequencing is considered the standard method for mutation detection in individuals with monogenic diabetes. However sequencing is expensive and not immediately available in many hospitals.
HNF1A and HNF4A belong to the steroid/thyroid hormone receptor superfamily of transcription factors [
14]. HNF1A and HNF4A act in a transcription factor network with HNF4A controlling the activity of HNF1A [
15]. This network plays a fundamental role in the early development of the pancreas, liver and intestine [
16]. Both transcription factors are also important for the maintenance of beta-cell function throughout life, and influence the expression of
insulin and the principle glucose transporter
Glut2, among many other target genes [
14,
17‐
20]. Molecular studies have demonstrated that HNF4A-regulated gene expression patterns are remarkably similar to that of its downstream transcription regulatory protein, HNF1A, and that the two factors may activate transcription by a synergistic action [
21‐
23]. We have previously demonstrated that elevated serum pancreatic stone protein / regenerating protein A (PSP/reg1A) levels can be detected in subjects with HNF1A-MODY compared to HNF1A-MODY-negative non-diabetic family members [
24]. We have also shown that PSP/reg1A levels did not correlate with hyperglycemia [
25]. Other studies have identified high-sensitivityC-reactive protein (hsCRP), a known HNF1A target gene [
26,
27] to be reduced in serum levels of subjects with HNF1A-MODY, compared to other forms of diabetes such as type 1 diabetes, type 2 diabetes, HNF4A-MODY, and glucokinase-MODY [
28‐
30]. The concept that the
crp gene is not regulated by HNF4A, despite HNF1A being downstream of HNF4A, has not yet been mechanistically proven, and there is evidence for a partial overlap of hsCRP levels in HNF1A- and HNF4A-MODY subjects [
29,
30]. Furthermore, hsCRP levels are elevated during inflammation, demonstrating the need for additional biomarkers. In this study we aimed (i) to investigate whether HNF1A and HNF4A differentially influence the expression of
PSP/reg and
crp, and (ii) to provide clinical proof-of-concept that parallel measurements of PSP/reg1A and hsCRP levels may be of clinical use in distinguishing HNF1A- from HNF4A-MODY subjects.
Materials and methods
Inducible repression of HNF1A and HNF4A function in insulinoma INS-1 cells
Rat INS-1 insulinoma cells overexpressing a dominant-negative (DN) mutant of HNF1A-MODY (Pro291fsinsC-HNF1A), carrying a C nucleotide insertion in the polyC-tract that results in the translation of a truncated dominant-negative protein, or expressing a dominant negative mutant of HNF4A (DN-HNF4A), lacking the first 111 amino acids, all under the control of a doxycycline-dependent transcriptional activator have been described previously [
31‐
36]. Cells were cultured in RPMI 1640 medium supplemented with 10% FBS (PAA, Cölbe, Germany), 2 mmol/l L- glutamine, 1 mmol/l pyruvate, penicillin (100 U/ml), streptomycin (100 μg/ml), 10 mmol/l HEPES (pH 7.4) and 50 μmol/l 2-mercaptoethanol (Sigma, Dublin, Ireland) [
37]. For experiments, cells were seeded at a density of 5 × 10
4 cells/cm
2 for 48 h prior to treatment with / without doxycycline (500 ng/ml), and were cultured in RPMI 1640 medium containing 6 mmol/liter glucose and co-treated with reagents as indicated.
Real-time quantitative RT-PCR (qPCR)
Expression patterns of Glut2, insulin, Crp, and PSP/reg mRNA were examined using real-time qPCR. INS-1 cells were harvested from culture treatments at the appropriate time-points. Total RNA was extracted using the RNeasy mini Kit (Qiagen, Crawley, UK). First-strand cDNA synthesis was performed using 2 μg total RNA as template and Superscript II reverse transcriptase (Invitrogen) primed with 50 pmol random hexamers (New England Bio labs, Ipswich, MA, USA). Quantitative real-time PCR was performed using the Light Cycler 2.0 (Roche Diagnostics, Indianapolis, IN, USA) and the QuantiTech SYBR Green PCR kit (Qiagen) as per manufacturers’ protocols and 25 pmol of primer pair concentration (Sigma-Genosys).
AACAGCACCTTTGTGGTCCT and GTGCAGCACTGATCCACAAT for insulin;
CAATTTCATCATCGCCCTCT and GTCTCTGATGACCCCAGGAA for Glut2;
GGCTTTGACGCGAATCAGTC and AGTCAGTCAAGGGCCACAGC for Crp;
AGGCCAGGAGGCTGAAGAAG and TGGAGGCCAATCCAGACATT for PSP/reg;
and AGCCATCCAGGCTGTGTTGT and CAGCTGTGGTGGTGAAGCTG for β-actin.
Western blotting
Cells were rinsed with ice-cold phosphate-buffered saline (PBS) and scraped before being lysed in buffer containing 62.5 mM Tris-Cl (pH 6.8), 2% SDS, 10% glycerin and protease inhibitor cocktail (Sigma, Dublin, Ireland). Protein content was determined using the Pierce BCA Micro Protein Assay kit (Thermo Fisher Scientific Inc., Rockford, Illinois). Samples were supplemented with 2-mercaptoethanol (Sigma Aldrich, Dublin, Ireland) and denaturated at 95°C for 5 min. An equal amount of protein (25–50 μg) was separated with 12–15% SDS-PAGE and blotted to nitrocellulose membranes (Protean BA 85; Schleicher & Schuell, Dassel, Germany). The membranes were blocked with 1% bovine serum albumin in Tris-buffered saline (20 mM Tris, pH 7.5, 150 mM NaCl) for 2 h at room temperature. The primary rabbit polyclonal CRP antibody (Abcam, Cambridge, UK), rabbit polyclonal anti-PSP/
reg antibody [
39] and primary mouse monoclonal β-actin mouse antibody were diluted 1:10,000 in 5% milk (Sigma). The primary mouse monoclonal anti-tubulin antibody (Sigma) was diluted 1:5,000. Antibodies were incubated overnight at 4 C. The membranes were washed in Tris-buffered saline containing 0.05% Tween 20. The secondary antibodies peroxidase-coupled goat anti-rabbit IgG (Sigma) or goat anti-mouse (Jackson Immunoresearch, Europe Ltd) were diluted 1:25,000 in the same buffer. The membranes were washed in Tris-Buffered Saline containing 0.05% Tween 20. Antibody-conjugated peroxidase activity was visualized using the Super Signal chemiluminescence reagent (Pierce, Buckinghamshire, UK). Densitometry was carried out by quantifying the intensities of bands using ImageJ 1.41o. Regions were drawn around each band and the integrated intensity was measured, with intensity of a background region of the same size on the same gel subtracted. The intensity of each protein of interest was divided by the corresponding loading control protein.
Subjects
Subjects with a clinical diagnosis of MODY were recruited from the diabetes clinics in the Mater Misericordiae University Hospital Dublin in Ireland. Sequencing of the
HNF1A and
HNF4A genes were performed by IntegraGen (Bonn, Germany) in 2006–2007 and the Molecular Genetics Laboratory (Exeter, UK) in 2008–2010. Genetically confirmed MODY patients included 33 cases with
HNF1A mutations and 9 with
HNF4A mutations. The subjects with
HNF1A mutations were from 11 pedigrees and the mutations included L17H, G207D, P291finsC, S352fsdelG, F426X, P379T, and IVS7-6G > A. The genotype/phenotype of these patients was published previously, and all mutations described co-segregated with diabetes in all pedigrees [
40]. Subjects with
HNF4A mutations were from 2 pedigrees and the mutations included M1? and R290C. The genotype/phenotype of these two pedigrees was published previously and both mutations likewise co-segregated with diabetes [
40]. All subjects underwent full clinical assessment including a full medical history and physical examination. Details of the subjects’ weight, height and blood pressure were recorded. Plasma glucose was measured using Beckman Synchron DXC800 (Beckman Instruments Inc, Brea, USA). Haemoglobin A
1c (HbA
1c) was determined by high-performance liquid chromatography (Menarini HA81-10, Rome, Italy). The study was approved by the Research Ethics Committee at the Mater Misericordiae University Hospital Dublin and all subjects gave informed written consent.
Measurement of serum PSP/reg1A levels
The enzyme-linked immunosorbent assay (ELISA) was used to quantify human PSP/reg1A. Recombinant human PSP/reg1A protein was used to immunize rabbits and guinea pigs to obtain Antisera [
24,
39,
41]. Serum was prepared by centrifugation, and the IgG were purified by affinity chromatography on protein A columns. Subsequently, a sandwich ELISA was designed on 96-well ELISA plates. Antibody of the first species (Guinea pig) was coated to the bottom, blocked with bovine serum albumin and aliquots of serum were then incubated for two hours. After washing the wells, antibodies of the other species (Rabbit) were incubated, followed by a series of washing steps. Finally, a phosphatase-coupled anti-rabbit IgG was used. The reaction of the phosphatase with a substrate was determined on a multiplate reader (Dynatech) and subjects’ serum PSP/reg1A levels were compared with standard amounts of recombinant human PSP/reg1A protein. PSP/reg1A levels of some of the HNF-1A-MODY subjects are historic data and have been published previously [
24,
25].
Measurement of serum hsCRP levels
Serum hsCRP levels were measured using particle enhanced immunonephelometry assay (Cardio Phase® hsCRP, Siemens) on a Siemens BN II analyzer (Siemens Healthcare Diagnostics, Deerfield, IL, USA). A typical limit for detection of hsCRP was 0.175 mg/L for measurements performed using a sample dilution of 1:20. A coefficient of variation at the concentration 0.41 mg/L was 7.6%. We considered that hsCRP values >10 mg/l were likely to represent an inflammatory response in line with previous studies [
28,
42,
43]. We therefore performed two separate analysis approaches, one in which we included (termed ‘all patients’), and one in which we excluded (termed ‘without extreme CRP’) the 2 HNF1A-MODY patients with serum hsCRP values of >10 mg/l.
Statistical analysis
Clinical data are expressed as median and interquartile range (IQR). Biochemical data are expressed as mean ± standard error of the means (SEM). Statistical analysis was performed using SPSS statistical software package for Windows, version 18.0 (SPSS, Chicago, IL, USA). The significance of the difference between 2 groups was determined by Mann–Whitney U test (non-parametric clinical data) or t test as indicated. For comparisons of categorical data, chi-square test was applied. The Spearman correlation test was used for correlation analysis. Differences and correlations were considered significant at P < 0.05.
In order to investigate the performance of hsCRP and PSP/reg1A to distinguish HNF1A- from HNF4A-MODY subjects, plots of the receiver operating characteristic (ROC) were analyzed and linear discriminant analysis (LDA) was performed. ROC plots were obtained by calculating all sensitivity and specificity pairs for the levels of serum markers observed in the subjects. An observed value reaching similarly high sensitivity and specificity qualified as final cut-off value for classification. LDA was applied to calculate the best equation for a linear cut-off function to discriminate between groups. Both approaches were applied to each serum marker individually and to the ratio of PSP/reg1A to hsCRP to investigate whether a combination of the markers improved discrimination. ROC, LDA and resulting sensitivity and specificity where assessed using Mat Lab R7.4 (The Math works Inc., Natick, MA, USA).
Discussion
The present study provides molecular proof and preliminary clinical proof-of-concept that the combination of serum PSP/reg1A and hsCRP levels may be of clinical use in distinguishing HNF1A-MODY from HNF4A-MODY subjects. Molecular validation of these clinical findings validated that HNF1A suppression negatively regulates crp mRNA and CRP protein levels in INS-1 cells, while crp gene and protein expression was normal in cells with a suppressed HNF4A function. Conversely, the induction of PSP/reg was inhibited by HNF4A suppression, but was not sensitive to HNF1A suppression. However it should be noted that overexpression of DN-HNF4A may also alter the activity of endogenous HNF1A.
Current guidelines for the genetic diagnosis of MODY recommend to test for
HNF1A mutations if there is a history of young-onset diabetes before 25 years old in at least one family member, family history of diabetes (at least two generations), in the absence of pancreatic islet autoantibodies and without the evidence of insulin resistance [
44]. Testing for
HNF4A mutations is recommended when
HNF1A genetic analysis does not show a mutation in individuals with clinical features of MODY or in diabetic family members with macrosomia or diazoxide-responsive neonatal hyperinsulinism [
44]. Nevertheless, a recent study from the UK estimated that more than 80% of MODY cases are not diagnosed by molecular testing [
45].
Barriers to molecular genetic testing include low availability and high financial cost of genetic testing. The availability of biomarkers which can be used in combination with clinical characteristics will enable clinicians to better identify cases of MODY and/or prioritise DNA testing. Though DNA sequencing is the ultimate proof of a genetic mutation, which cannot currently be substituted by any other test, measurement of PSA/reg1A and hsCRP levels can be performed to help the clinicians to correctly and rapidly identify patients with either HNF1A- or HNF4A-MODY and to aim for genetic counseling. Our proof-of-concept study suggests that parallel measurements of serum PSP/reg1A and hsCRP levels may be able to discriminate HNF1A- and HNF4A-MODY subjects with high confidence. In this study, we have demonstrated that HNF4A-MODY patients showed significantly lower levels of serum PSP/reg1A and significantly higher serum hsCRP levels compared to HNF1A-MODY patients. Our findings support the previous reported value of hsCRP as a diagnostic biomarker for HNF1A-MODY vs. HNF4A-MODY [
28‐
30]. However the above cited earlier studies observed a significant overlap in hsCRP levels between these two groups. Therefore, the use of hsCRP as a marker to identify HNF1A-MODY may yield a high false positive rate. In addition hsCRP is a major acute-phase plasma protein which undergoes a rapid and marked rise of its serum concentration in response to infection or tissue injury [
46]. In previous studies up to 10% of subjects had hsCRP levels higher 10 mg/L [
29,
30]. Serial hsCRP measurements would then be required after resolution of the infection. It has been demonstrated that there may be a positive correlation between hsCRP and HbA
1c when HbA
1c levels are > 9% in type 2 diabetic subjects [
47]. In our study, there is a significant difference in HbA
1c levels between HNF1A-MODY and HNF4A-MODY subjects even though both groups had relatively low HbA
1c levels. HNF1A-MODY subjects had higher HbA
1c levels, yet their CRP levels were lower than HNF4A-MODY subjects. We found no association however between hsCRP and HbA
1c levels in HNF1A- and HNF4A-MODY subjects. It has been previously shown that there was no association between hsCRP and HbA
1c levels in HNF1A-MODY patients [
28]. However, it is still possible that utilizing hsCRP as a biomarker alone for diagnosing HNF1A-MODY in a subject with an HbA
1c >9% may yield a false negative result.
Because of the routine availability of hsCRP testing, the clinical significance of hsCRP as a marker in identifying HNF1A-MODY subjects may become significant in the future. However, the combined detection of hsCRP and PSP/reg1A levels may provide an improved mean for better discrimination of HNF4A and HNF1A subjects.
In our study, we could not confirm PSP/reg and hsCRP to be normally distributed, which might be due to our small sample sizes in this proof-of-concept study. We applied ROC and LDA to investigate the usefulness of hsCRP and/or PSP/reg as biomarker to distinguish HNF1A- form HNF4A-MODY. Resulting classification rules are not optimal, and need to be confirmed in larger cohorts.
Identification of
HNF1A and
HNF4A mutation carriers has significant therapeutic implications as these subjects show sensitivity to low-dose sulphonylureas and subsequent alterations in treatment can improve glycaemic control in the majority of subjects [
48]. HNF4A-MODY caused by mutations in the
HNF4A gene is relatively less common than
HNF1A mutations and accounts for approximately 5% of MODY cases worldwide [
44]. However it is likely that many individuals with HNF4A-MODY remain undiagnosed. HNF4A-MODY subjects have similar progressive diabetic phenotype to HNF1A-MODY subjects, except that
HNF4A mutations are associated with macrosomia, transient and persistent neonatal hypoglycaemia, later age of diabetes onset and the absence of low renal threshold [
9,
10]. It is crucial to identify
HNF4A mutation carriers as heterozygous mutations in the
HNF4A gene in either parent can impact on pregnancy. The offspring of
HNF4A mutation carriers has a 50% chance of inheriting the mutation from either parent and has the risk of macrosomia due to increased insulin secretion in utero [
11]. Therefore pre-pregnancy counseling for
HNF4A mutation subjects is required and close monitoring during pregnancy and immediately at birth is needed to minimize complications of macrosomia and neonatal hypoglycaemia. The potential biomarkers to differentiate HNF4A-MODY from HNF1A-MODY would assist in better identification of HNF4A-MODY subjects and would enable these subjects to receive appropriate treatment and monitoring prior to and during the pregnancy to ensure successful maternal and neonatal outcome.
Of note, our study also confirms the clinical observation of a differential regulation of
crp and
PSP/reg genes by HNF1A and HNF4A on a molecular level. Previous studies have demonstrated that HNF4A- and HNF1A- regulated gene expression are remarkably similar [
21‐
23], and that HNF4A acts upstream of HNF1A. Indeed there is evidence for a
cis-acting element located upstream of the TATA box of the HNF1A promoter that has a high-affinity-binding site for HNF4A [
14]. Previous studies have shown the presence of putative HNF1A binding elements within the promoter region of the
crp gene, and a loss of
crp expression was shown to be directly linked with altered regulation of HNF1A function [
27,
28,
46]. Interestingly in our experimental studies we showed that INS-1 cells with an inducible suppression of HNF4A function showed no decrease in
crp gene expression. In contrast, we observed a strong decrease in
PSP/reg gene expression in response to suppression of HNF4A function, compared to a prominent induction of
PSP/reg at the gene and protein levels during suppression of HNF1A function. Our study is therefore also one of the first reports that demonstrate differentially regulated HNF1A and HNF4A target genes.
Acknowledgments
This research was supported by grants from the Health Research Board (HRB RP/2004/220), the Mater Foundation/MRCG/HRB Co-fund Grant Scheme (06–01) and a Mater College Grant to M.M.B., and by grants from the Health Research Board (RP/2008/14) and Science Foundation Ireland (08/IN.1/B1949) to J.H.M.P. We thank the research nurses Eilish Donnelly and Hazel Little for helping with data collection, Professor Claes Wollheim (University of Geneva, Switzerland) for the inducible INS-1 cell lines, Professor Sian Ellard and Dr. Kevin Colclough (Department of Molecular Genetics, Exeter, UK) for molecular genetic testing, and Dr. Clodagh Whelan (Immunology Laboratory, Mater Misericordiae University Hospital, Dublin, Ireland) for measurement of hsCRP.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
MPK carried out recruitment and phenotyping of subjects, participated in the design of the study, statistical analysis, interpretation of data and drafting the manuscript. CB performed experiments in cellular models and participated in interpretation of data and drafting the manuscript. SB participated in recruitment and phenotyping of subjects. SMK performed experiments in cellular models and analysed data. JS performed statistical analysis and participated in manuscript drafting. RG measured PSP/reg and participated in the study design. JHMP supervised experiments in cellular models, participated in the design of the study, interpretation of data and manuscript drafting. MMB conceived of the study, participated in its design and coordination, supervised the study and drafted the manuscript. All authors read and approved the final manuscript.