Background
Streptococcus suis is one of the most prevalent pathogens in swine herds; it can cause a wide variety of life-threatening infections or syndromes in pigs, including septicemia, meningitis, endocarditis, arthritis, and even sudden death, resulting in serious economic losses in the pig industry. It is also an emerging zoonotic pathogen with the ability to induce meningitis, endocarditis, and streptococcal toxic shock-like syndrome (STSLS) in humans, which usually result from direct contact with infected pigs or pig products [
1]. So far,
S. suis infection in humans has been largely reported in Asian countries, as well as in North and South America, Australia, New Zealand, and several European countries [
2‐
4]. Among the 33
S. suis serotypes,
S. suis 2 (SS2) is the most prevalent and virulent in pigs and humans [
5]. The outbreak of SS2 in 2005 in China resulted in more than 200 cases of human infection, with a fatality rate reaching 20 % [
2]. Meningitis is an important clinical manifestation of SS2 infection, in which more than 50 % of patients suffer from hearing loss sequelae [
1,
5]. Recently, SS2 has emerged as the most frequent pathogen responsible for bacterial meningitis in adults in southern Vietnam, the second-most prevalent in Thailand, as well as the third-most-common cause of community-acquired bacterial meningitis in Hong Kong [
3,
4,
6‐
8]. However, little is known about how SS2 strains penetrate the blood-brain barrier (BBB) and cause meningitis.
Innate immunity is an essential host defense against infection by pathogenic microorganisms, in which cytokines function as an indispensable component of the defense. Previous literature has demonstrated that SS2 infection in mice could induce the strong generation of diverse proinflammatory cytokines and chemokines in blood, including tumor necrosis factor alpha (TNF-α), interleukin (IL)-6, IL-12, interferon (IFN)-γ, monocyte chemoattractant protein (MCP)-1, chemokine (C-X-C motif) ligand 1 (GRO-α/CXCL1), C-C motif chemokine ligand 5 (CCL5/RANTES) [
9].The excessive production of proinflammatory cytokines was considered to be the most important cause of SS2 meningitis and septicemia, as well as STSLS [
9,
10]. In recent years, additional SS2 components have been reported to mediate the release of proinflammatory cytokines and contribute to the development of meningitis, including capsular polysaccharide (CPS), suilysin, muramidase-released protein (MRP), and SspA [
4,
5,
11,
12]. However, the specific host molecules participating in SS2 meningitis, as well as regulating the generation of proinflammatory cytokines, were poorly understood.
Epidermal growth factor receptor (EGFR) is recognized as an important initiator manipulated by diverse pathogens for their survival in the host and inducing inflammatory responses [
13,
14]. EGFR belongs to the ErbB family of receptor tyrosine kinases, which consists of four closely related members (ErbB1/EGFR, ErbB2, ErbB3, ErbB4) [
15‐
17]. It is initially expressed in the plasma membrane in an inactive form and transactivated through certain kinases and/or after binding to its specific ligands, which are produced as transmembrane precursors and released after proteolytic cleavage [
15‐
18]. EGFR transactivation leads to either homodimerization or heterodimerization that stimulates the intrinsic tyrosine kinase activity and triggers autophosphorylation of specific tyrosine residues within the cytoplasmic domains, therefore promoting the activation of its downstream signaling cascades [
15,
19]. Although EGFR has been largely reported in the field of cancer because of its involvement in cell proliferation, migration, and invasion [
20,
21], an increasing number of studies have supported its diverse roles in pathogenic bacterial infections, including
Haemophilus influenza,
Klebsiella pneumonia,
Neisseria gonorrhoeae,
Pseudomonas aeruginosa, and
Helicobacter pylori infections [
14,
22‐
24]. However, the specific role of EGFR in SS2 infection, especially its association with SS2-induced meningitis, is completely unclear.
As the most distinct and indispensable structural and functional component of the BBB, brain microvascular endothelial cells (BMEC) prevent circulating pathogens from entering the brain, thus maintaining central nervous system (CNS) homeostasis [
25]. To further determine the mechanism of SS2-induced meningitis, we sought to identify and characterize the potential host targets that participate in SS2 infection of BMEC, as well as induction of proinflammatory cytokines and chemokines. We provide evidence that EGFR acts as an essential host target in SS2 interaction with the BBB and an important molecular switch that additionally controls the production of proinflammatory cytokines. These findings provide evidences supporting the role of EGFR in SS2-mediated neuroinflammation, which will expand our knowledge on SS2-induced CNS dysfunction.
Methods
Bacterial strains and cell culture
SS2 strain SC19, originally isolated from a pig brain during the
S. suis outbreak in Sichuan Province in China in 2005 [
26], was cultured in TSB broth or on TSA plates (Difco Laboratories, Detroit, MI, USA) with 10 % newborn bovine serum at 37 °C with appropriate antibiotics unless otherwise specified.
The human BMEC cell line (hBMEC) was kindly provided by Prof. Kwang Sik Kim in Johns Hopkins University School of Medicine [
27,
28] and cultured in RPMI 1640 medium with 10 % heat-inactivated fetal bovine serum (FBS), 10 % Nu-serum, 2 mM L-glutamine, 1 mM sodium pyruvate, nonessential amino acids, vitamins, and penicillin and streptomycin (100 U/mL) in a 37 °C incubator under 5 % CO
2 [
27]. Confluent cells were washed three times with Hanks’ Balanced Salt Solution (Corning Cellgro, Manassas, VA, USA) and starved in serum-free medium for 16–18 h before further treatment. In some experiments, cells were pretreated with specific inhibitors for the indicated times before challenge.
Reagents, antibodies, and shRNA plasmids
The EGFR tyrosine kinase inhibitor AG1478, nuclear factor kappa B (NF-κB) inhibitors CAY10657 and BAY-11072, and ERK1/2 inhibitor U0126 were purchased from Cayman Chemical Company (Ann Arbor, MI, USA). Protein A + G agarose beads and MTT Cell Proliferation Assay Kit were obtained from Beyotime (Shanghai, China). Horseradish peroxidase (HRP)-conjugated anti-phosphotyrosine (4G10) antibody was purchased from EMD Millipore Corporation (Temecula, CA, USA). Anti-phosphotyrosine antibody was purchased from Abcam (Cambridge, MA, USA). Anti-NF-κB p65, anti-phospho-p65, anti-IκBα, anti-ErbB2, anti-ErbB3, HRP-conjugated anti-rabbit IgG, and HRP-conjugated anti-mouse IgG antibodies were all purchased from Cell Signaling Technology (Danvers, MA, USA). Anti-ErbB4 antibody was purchased from Proteintech (Chicago, IL, USA). Anti-β-actin antibody was purchased from HuaAn Biotechnology Co., Ltd. (Hangzhou, China). The Lipofectamine 3000 transfection reagent was obtained from Invitrogen (Carlsbad, CA, USA). Puromycin was purchased from Corning Cellgro. The ErbB3 shRNA plasmid and control shRNA plasmid-A were purchased from Santa Cruz Biotechnology (Dallas, TX, USA).
Bacterial adhesion assays in hBMEC
The determination of adhesion of SS2 strain SC19 to hBMEC was performed as previously described [
29,
30]. Briefly, SC19 strain was grown overnight, centrifuged, and resuspended in experimental medium (M199-Ham F12 [1:1] medium containing 5 % heat-inactivated FBS) at 10
7 CFU/ml. A confluent monolayer of hBMEC grown in a 24-well plate was infected with bacteria at a MOI of 10 for the indicated time followed by extensive washing to remove the unbound bacteria. Cells were lysed with 0.025 % Triton X-100 for 10 min. Counts of adherent bacteria were determined by plating at appropriate dilutions. The assay was performed independently in triplicate.
Immunoprecipitation and western blotting
The hBMEC were seeded at 1 × 10
6 cells/100 mm
2 dish and cultured until confluent. Serum-starved cells were stimulated with SC19 at a MOI of 10 for the indicated times, and cell lysates were then collected for immunoprecipitation and western blotting analysis as previously described [
19,
31]. The densimetric analysis was performed using ImageJ software.
Transfection
The hBMEC were seeded in 6-well plates and grown to 70 % confluence and transfected with either the shRNA targeting ErbB3 or the control shRNA plasmid-A using the Lipofectamine 3000 transfection reagent according to manufacturers’ instructions. Briefly, liquid A (containing 5 μg plasmid, 10 μL P3000, and 250 μL opti-MEM) and liquid B (containing 7.5 μL Lipo3000 and 250 μL opti-MEM) were gently mixed and incubated at room temperature for 5 min. This suspension was then added dropwise to the cells and incubated at 37 °C with 5 % CO2 for 4–6 h. Fresh medium containing puromycin (100 μg/ml) was then applied to screen and maintain the positively transfected cells for 2–3 weeks.
MTT assay
The hBMEC was seeded in 96-well plates at 5 × 103 cells per well in 100 μL medium and incubated for 24 h; 5 μM AG1478 was added to the wells and incubated for various times as indicated. The supernatant of each well was removed, and MTT dissolved in serum-free medium was added and incubated for a further 4 h. To each well, 100 μL of MTT solvent was then added, and the plate was wrapped in foil and shaken for 15 min. Finally, the absorbance at 570 nm of each well was determined.
Immunofluorescence microscopy
The hBMEC was seeded at 1 × 105 cells onto coverslips in 24-well plates and cultured for 24 h. Cells were challenged with SS2 at a MOI of 10 for 3 h, washed and fixed with 4 % paraformaldehyde. The fixed cells were subsequently incubated with primary anti-p65 antibody and then with FITC-labeled goat anti-mouse IgG antibody. The plate was mounted and visualized using fluorescence microscopy.
Animal infection
Five-week-old female CD1 mice obtained from the Center for Disease Control (Hubei Province, China) were used for our animal infection assays. Mice were challenged with the SC19 strain at 2 × 10
8 CFUs in sterile PBS through the tail vein. At the indicated time points, mice were anesthetized and peripheral blood harvested for serum collection. Subsequently, mice were perfused with heparin solution (10 U/ml) in PBS as previously described [
32] and processed for further assays.
Histopathological examination
Brain samples were collected at the indicated time points post infection and fixed in 4 % paraformaldehyde solution for over 24 h. The fixed-tissues were paraffin embedded for H&E staining following standard procedures [
33].
Reverse transcription and real-time PCR
TRIzol reagent (Invitrogen) was used to isolate total RNA from the infected hBMEC; 1 μg of total RNA was used for cDNA synthesis using the PrimeScript™ RT reagent kit with gDNA Eraser (Takara, Shiga, Japan). Contaminating DNA was removed by the gDNA Eraser treatment during the reverse transcription. Quantitative PCR was conducted with ViiA™ 7 Real-Time PCR System (Applied BioSystems, Foster City, CA, USA) using Power SYBR Green PCR master mix (Applied BioSystems) according to the manufacturers’ instructions. Primers for the real-time PCR are listed in Table
1.
Table 1
Primers used in this study
IL-6 | GGACTGATGCTGGTGACAAC | GGAGTGGTATCCTCTGTGAAGT | Murine |
IL-1α | CTGAAGAAGAGACGGCTGAGTT | CTGGTAGGTGTAAGGTGCTGAT | Murine |
MCP-1 | ACTCACCTGCTGCTACTCAT | TGTCTGGACCCATTCCTTCTT | Murine |
MIP-2 | TGACTTCAAGAACATCCAGAG | CCTTGCCTTTGTTCAGTATCT | Murine |
GRO- α | TGGCTGGGATTCACCTCAA | GTGGCTATGACTTCGGTTTGG | Murine |
β-actin | GTCCCTCCTCTGATACCTTCCTC | CTGGCAGTGTCATTCACATCTTTCT | Murine |
EGFR | TACAGACCCAAGAGCAGCA | AGCCGTACATAGATCCAGAA | Human |
ErbB2 | GTCCCTCCTCTGATACCTTCCTC | CTGGCAGTGTCATTCACATCTTTCT | Human |
ErbB3 | TACAGACCCAAGAGCAGCA | AGCCGTACATAGATCCAGAA | Human |
ErbB4 | GTCCCTCCTCTGATACCTTCCTC | CTGGCAGTGTCATTCACATCTTTCT | Human |
MIP-2 | AGTGTGAAGGTGAAGTCC | CTTTCTGCCCATTCTTGAG | Human |
GRO-α | TGCTGCTCCTGCTCCTGGTA | TGTGGCTATGACTTCGGTTTGG | Human |
IL-6 | CCTTCGGTCCAGTTGCCTTCT | GAGGTGAGTGGCTGTCTGTGT | Human |
MCP-1 | ATAGCAGCCACCTTCATT | GCTTCTTTGGGACACTTG | Human |
TNF-α | AATGGCGTGGAGCTGAGA | TGGCAGAGAGGAGGTTGAC | Human |
IL-8 | GACATACTCCAAACCTTTCC | ATTCTCAGCCCTCTTCAAA | Human |
GAPDH | TGCCTCCTGCACCACCAACT | CGCCTGCTTCACCACCTTC | Human |
Multiplex cytokine and chemokine assays
Mice were challenged with the SC19 strain as described above. In some groups, mice were pretreated with 10 mg/kg AG1478 intraperitoneally 2 h prior to infection. At the indicated time points, mice were euthanized and serum were prepared. Brain tissue samples were lysed in RIPA buffer with protease inhibitor cocktail and centrifuged at 12,000g for 10 min to remove tissue debris. The serum and brain extracts were stored at −80 °C and later used for the measurement of 12 preselected cytokines and chemokines using Q-Plex™ Chemiluminescent ELISA (Quansys Bioscience, Logan, Utah, USA) according to the instructions. The preselected cytokines and chemokines were IL-1α, IL-1β, interleukin-6 (IL-6), IL-10, IL-17, TNF-α, IFN-γ, monocyte chemoattractant protein-1 (MCP-1)/CCL2, RANTES/CCL5, MIP-2/CCL8, GROα/CXCL1, and EOTAXIN/CCL11. Multiplex cytokine and chemokine levels were quantitatively analyzed using Bio-Rad Chemi-Doc XRS camera (Bio-Rad, Hercules, CA, USA) and Q-View™ Software (Quansys Bioscience).
Statistical analysis
Data were expressed as the mean ± SD. The difference between the two groups was analyzed using Student’s t test and GraphPad Prism version 6.0 (GraphPad Software Inc., La Jolla, CA, USA). *p < 0.05 was considered statistically significant; **p < 0.01 and ***p < 0.001 indicated extremely significant differences.
Discussion
As an important zoonotic bacterial pathogen that causes great economic losses in animal husbandry, as well as public health problems, SS2 has received increasing attention and has been recognized as the third-largest contributor causing meningitis in adults [
2,
3,
8,
43]. However, the mechanisms involved in SS2 strains penetration of the BBB and induction of CNS inflammation are not well understood. Studies have previously reported the important roles of several SS2 virulence factors in bacterial penetration of the BBB, for example, the capsular polysaccharides (CPS) regulate the invasion rate in meningeal cells and astrocytes, and encapsulated strains can induce exaggerated inflammatory responses [
44]. The subtilisin-like protease SspA can induce IL-1β, IL-6, TNF-α, CXCL8, and CCL5 secretion dose-dependently in macrophages [
12]. Enolase can significantly increase the production of IL-8 in the serum and brain and increase the permeability of the BBB [
45]. In addition, suilysin was reported to contribute to cytoskeleton remodeling, and muramidase-released protein (MRP) could bind to human fibrinogen, therefore contributing to the breakdown of the BBB [
4,
11]. Noticeably, these studies mainly focused on the virulence factors of SS2 strains and elucidated their possible functions in bacterial infection of the BBB. However, characterization of the host targets that are exploited by SS2 strains in the development of meningitis is less reported.
During SS2 induction of meningitis, bacterial binding of host extracellular matrix proteins of BMEC is the first step necessary for its successful infection [
46]. SS2 association with BMEC can stimulate the activation of the vascular endothelia, which leads to a series of alterations and finally causes the CNS inflammatory response [
47,
48]. Pathogen-induced CNS inflammation has been proven to be vital for the development of meningitis. For example,
pneumococcus proliferation and immune recognition of bacterial components induced a strong inflammatory response, finally leading to BBB impairment [
49,
50]. As a pathogen characterized by sepsis and meningitis, SS2 infection can induce the upregulation of diverse cytokines and chemokines, thus mediating the CNS inflammation storm which results in the alteration of the BBB permeability. The SS2 penetration of the disrupted BBB therefore accelerates the occurrence of meningitis [
47,
51]. Here, a similar situation was observed with our SS2 strain SC19. The cytokine and chemokine concentration increased significantly in the blood after 2 h of infection, indicating an acute infection-induced inflammatory response against SC19. While the cytokines and chemokines maintained a high level in the blood for some time, they only began to be markedly increased several hours later in the brain, which contributes to the neuroinflammatory response. These findings imply that a certain level of systemic cytokines and chemokines in the blood is necessary for the induction of the meningitis and will determine the strength of the inflammation in the brain. Moreover, a previous study showed that intraperitoneal infection of SS2 could induce a rapid increase of systemic inflammatory factors in mice, including TNF-α, IL-6, IL-12, IFN-γ, IL-1β, CXCL1/KC/GRO-α, CCL2/MCP-1, and CCL5/RANTES, most of which reached a peak after 6 h of infection and subsequently decreased along with the infection [
9]. Here, in vivo, we similarly demonstrated the rapid increase of proinflammatory cytokines and chemokines in the brain and serum, including IL-6, IL-1α, MCP-1, MIP-2, and GRO-α, suggesting the ability of SS2 to induce peripheral as well as CNS inflammation. Moreover, we picked IL-6 and MCP-1 as the representative cytokine and chemokine, respectively, and found that their induction in the brain could be significantly decreased by pretreatment with the EGFR inhibitor AG1478, although this treatment did not affect their induction in the serum by infection. Since IL-6 and MCP-1 were reported to be able to alter tight junction expression [
52,
53], this finding implies that AG1478 might specifically protect the brain from cytokine/chemokine-mediated BBB disruption in early infection. Likewise, in vitro, we observed the high production of IL-6, IL-8, TNF-α, MCP-1, MIP-2, and GRO-α in hBMEC upon SS2 infection in a time-dependent manner, which similarly could be inhibited by AG1478. Notably, we observed a high level of MCP-1 in the serum as early as 2 h after SS2 infection, which was maintained until 12 h post infection. In contrast, the MCP-1 level in the brain upon SS2 infection was low for as long as 12 h post infection and then exhibited a sudden increase. MCP-1 is vital for monocyte recruitment and amplification of inflammation, and previous studies demonstrated decreased BBB leakage, as well as astrogliosis and macrophage/microglia accumulation in MCP-1 KO mice [
54,
55]. Whether MCP-1 could be a promising biomarker indicating SS2 meningitis should be further investigated. Thus, altogether, our observations supported that EGFR plays an important role in SS2 strain SC19-induced meningitis, in which it can influence the SS2 induction of the cytokines and chemokines in the brain.
In our work, we demonstrated that SS2 activated EGFR by increasing the shedding of the EGFR-associated ligands AREG, EREG, and HB-EGF, rather than interacting directly with EGFR. Previous studies show that AREG can upregulate mucin gene expression in obstructive airway diseases, EREG modulates Toll-like receptor (TLR)-mediated immune responses, and HB-EGF overexpression promotes vascular endothelial growth factor (VEGF) signaling resulting in hydrocephalus [
56‐
58]. These ligands could induce the rapid phosphorylation of EGFR and subsequent intracellular signal transduction. Additionally, different ligands induce different dimerization of ErbBs, thus mediating different signal transduction and outcomes [
59]. Human cytomegalovirus induces the heterodimerization of EGFR-ErbB3, which was proven to be required for virus invasion [
17].
Neisseria meningitidis activation of ErbB2 stimulates downstream signaling which affects cortical actin polymerization [
19]. Here, we demonstrated the important role of EGFR and the formation of EGFR-ErbB3 heterodimers in hBMEC in response to SS2 challenge. Nevertheless, we could not exclude the possibility of EGFR homodimerization in response to SS2 infection based on our current data. Although ErbB2 is the preferred heterodimerization partner [
37], we did not observe its activation, or association with EGFR, upon SS2 challenge. Therefore, we put forward the hypothesis that SS2 infection of hBMEC induces a ligand-dependent transactivation of EGFR and its dimerization with ErbB3, which leads to the activation of their intrinsic tyrosine kinase activity and regulates the production of proinflammatory cytokines and chemokines in the brain.
Bacterial pathogens exploit host cell signaling molecules to promote their infections, but the underlying mechanisms vary depending on specific pathogens and different host cells. As an important clinical therapeutic target and the signaling receptor on the cell surface, EGFR has been investigated in multiple bacterial infections. Transactivation of EGFR in
N. gonorrhoeae infection can weaken the apical junction and polarity of epithelial cells, and thus enhance pathogen invasion [
22,
60]. However, our results could not support a close relationship between EGFR activation and bacterial colonization in vivo and EGFR blockage could not attenuate the adherence of SS2 strain SC19 to hBMEC. In the field of inflammatory responses involving EGFR,
K. pneumoniae could subvert host inflammation via the regulation of NF-κB signaling through an EGFR-dependent PI3K–AKT–PAK4–ERK–GSK3β pathway [
23]. The nontypeable
H. influenza induces activation of EGFR, which acts as a negative regulator of TLR2 expression via a Src-dependent p38 signaling pathway [
24]. Here, we further highlight the involvement of EGFR in SS2-induced meningitis, by the demonstration that SS2-induced transactivation of EGFR promotes the MAPK-ERK1/2 as well as NF-κB signaling pathways in hBMEC, which subsequently initiates and mediates the inflammatory response in the brain and finally the CNS dysfunction.
Acknowledgements
Not applicable.