nach oben

European Journal of Clinical Microbiology & Infectious Diseases

Erschienen in:

Open Access 29.04.2020 | Original Article

Emergence of linezolid-resistant Staphylococcus epidermidis in the tertiary children’s hospital in Cracow, Poland

verfasst von: Maja Kosecka-Strojek, Ewa Sadowy, Iwona Gawryszewska, Joanna Klepacka, Tomasz Tomasik, Michal Michalik, Waleria Hryniewicz, Jacek Miedzobrodzki

Erschienen in: European Journal of Clinical Microbiology & Infectious Diseases | Ausgabe 9/2020

Abstract

Coagulase-negative staphylococci, ubiquitous commensals of human skin, and mucous membranes represent important pathogens for immunocompromised patients and neonates. The increasing antibiotic resistance among Staphylococcus epidermidis is an emerging problem worldwide. In particular, the linezolid-resistant S. epidermidis (LRSE) strains are observed in Europe since 2014. The aim of our study was to genetically characterize 11 LRSE isolates, recovered mostly from blood in the University Children’s Hospital in Krakow, Poland, between 2015 and 2017. For identification of the isolates at the species level, we used 16S rRNA sequencing and RFLP of the saoC gene. Isolates were characterized phenotypically by determining their antimicrobial resistance patterns and using molecular methods such as PFGE, MLST, SCCmec typing, detection of the ica operon, and analysis of antimicrobial resistance determinants. All isolates were multidrug-resistant, including resistance to methicillin, and exhibited so-called PhLOPS_A phenotype. In PFGE, all isolates (excluding one from a catheter) represented identical patterns, were identified as ST2, and harbored the ica operon, responsible for biofilm formation. Linezolid resistance was associated with acquisition of A157R mutation in the ribosomal protein L3 and the presence of cfr gene. All isolates revealed new SCCmec cassette element composition. Recently, pediatric patients with serious staphylococcal infections are often treated with linezolid. The increasing linezolid resistance in bacterial strains becomes a real threat for patients, and monitoring such infections combined with surveillance and infection prevention programs is very important to decrease number of linezolid-resistant staphylococcal strains.

Maja Kosecka-Strojek and Ewa Sadowy contributed equally to this work.

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Introduction

Coagulase-negative staphylococci (CoNS) ubiquitously colonize human skin and mucosal membranes, and due to this fact, they were for a long time considered harmless commensals [1]. Nowadays, however, they are increasingly important etiologic agents of hospital-acquired infections (HAIs), including central line-associated bloodstream infections (CLABSIs) and surgical-site infections (SSIs). Among human CoNS, Staphylococcus epidermidis represents the most frequently isolated species [2]. The increasing prevalence of antibiotic-resistant CoNS from nosocomial infections have been reported in Europe for some time [3‐6], including especially worrisome methicillin-resistant S. epidermidis (MRSE) [7]. Since 2000, linezolid, a representative of the oxazolidynones has become an important addition in treatment for uncomplicated and complicated skin and skin structure infections and hospital- and community-acquired pneumonia caused by Gram-positive pathogens [8]. Shortly after the introduction into hospital practice, the first case of linezolid-resistant Staphylococcus aureus was reported in the USA in 2001 [9]. Linezolid-resistant S. epidermidis (LRSE) are increasingly observed in European countries, such as Portugal, Germany, Greece, Italy, Ireland, and France [10‐17]. Linezolid resistance determinants may be acquired by staphylococci due to mutations selected during prolonged linezolid therapy and by horizontal gene transfer [18‐21]. The G2576T mutation in the loop V of 23S rRNA is the principal determinant of the resistance; however, other mutations such as C2190T, T2502A, C2532T, and G2603T are observed as well [11, 22‐24]. Mutations in the genes of ribosomal proteins L3 (rplC gene), L4 (rplD gene), and L22 (rplV gene) are also relatively frequently encountered among LRSE [8]. As reviewed by Mendes et al. [8], the alterations in L3 and L4 as a resistance mechanism appeared later in time and the complexity and number of such alterations in LRSE increased since 2014. The A157R modification in L3 was observed in the USA and Italy up to date [8]. Transferable genes conferring linezolid resistance in staphylococci include the cfr gene encoding ribosomal methyltransferase gene and the optrA and poxtA genes of ribosomal protection proteins [25‐28]. Among these, only cfr was reported among LRSE so far [29]. Next emerging problem is that linezolid and methicillin resistance are often combined, so it is also important to characterize the SCCmec cassette elements in such isolates [16, 30‐31].

Here, we present a report on a possible LRSE spread in the University Children’s Hospital (UCH) in Krakow, Poland, between 2015 and 2017. The aim of this study was to genetically characterize the LRSE strains, determine their clonal relationships, linezolid resistance mechanisms and refer the results to patients’ characteristics.

Materials and methods

Bacterial isolates

The study included 11 LRSE clinical isolates recovered between 2015 and 2017 from the UCH in Krakow from 10 pediatric patients aged from 23 days to 11 months. Nine isolates were recovered from blood (including two isolates from the same patient), one from a throat and one from a central venous catheter. All isolates were recovered after at least 48 h after admission to the unit. Linezolid resistance was detected in the hospital laboratory based on disc-diffusion method (linezolid (30 μg)). The preliminary identification of isolates was performed with BD Phoenix™ system (Becton Dickinson, Franklin Lakes, NJ, USA).

Genomic DNA extraction

For genomic DNA extraction, isolates were grown for 18–20 h at 37 °C on blood agar plates. A full inoculation loop of 10 μl of bacterial colonies was homogenized with a TissueLyser II (Qiagen, Germantown, MD, USA). Total DNA was extracted by enzymatic lysis using the buffers and solutions provided with the DNeasy Blood and Tissue Kit (Qiagen, Germantown, MD, USA) according to manufacturer’s instructions.

Species identification

All isolates were identified at the species level by sequencing of 16S rRNA as previously described [32] and PCR-RFLP of the saoC gene [33]. The 16S rRNA gene was amplified with slight modifications in PCR program: initial denaturation for 2 min at 94 °C, then followed by 25 cycles of denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, and extension at 72 °C for 60 s. The final extension was for 5 min at 72 °C. The PCR products were resolved by electrophoresis and purified using the DNA Clean & Concentrator™-5 purification kit (Zymo Research, Irvine, CA, USA). Two hundred nanograms of PCR product was used for sequencing with the primers used for PCR amplification. The saoC gene was amplified with the set of seven primers described previously [33]. PCR products were digested separately using each enzyme from the set of restriction enzymes (TaiI, Tsp509I, AluI, and MseI (Thermo Fisher Scientific, Waltham, MA, USA)). The obtained restriction patterns were compared to saoC gene fingerprint of the reference S. epidermidis strain.

Susceptibility testing

Methicillin resistance was initially identified using cefoxitin disks (30 μg) (Oxoid Ltd., Cambridge, UK), and the phenotype was further confirmed by the detection of the mecA gene [34]. MIC values for linezolid, ceftarolin, vancomycin, teicoplanin, dalbavancin, daptomycin, and fosfomycin were determined using the Etest method (bioMérieux, Marcy l’Etoile, France); MIC of ciprofloxacin was determined by a broth microdilution method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST; www.eucast.org); for rifampin, tetracycline, minocycline, tigecycline, chloramphenicol, and gentamicin, the disk-diffusion method was used following the EUCAST recommendations. The results were interpreted using the EUCAST criteria. The S. aureus strain ATCC 29213 was used as a control. Inducible clindamycin resistance was tested by placing the erythromycin and clindamycin double-disk test according to the EUCAST recommendations.

Molecular typing, analysis of antimicrobial resistance determinants, and detection of the ica operon

The clonality of isolates was studied using the pulsed-field electrophoresis (PFGE) of SmaI-digested bacterial DNA embedded in agarose plugs, as described by others [35] and the multilocus sequence typing (MLST) [36]. To assign alleles and sequence types (STs) for allelic profiles, the S. epidermidis MLST website (https://pubmlst.org/ sepidermidis/; 24th October 2019, date last accessed) was used [37]. The SCCmec cassettes were typed with two independent methods as described previously by Milheirico et al. [38] and Kondo et al. [34] with USA300 3956/13 strain as a positive control for IV SCCmec cassette.

Detection of the cfr and optrA genes was performed as previously, using strains from the laboratory collection as positive controls [39]. Presence of aac(6′)-Ie-aph(2″) and structure of Tn4001 were studied as described [40] with the control strains characterized previously [41]. For the poxtA, fexA, norA, fosB and the ica operon detection by PCR and for rplC, rplD, rplV and the 23S rRNA gene sequencing primers were designed in the current study (Table 1).

Table 1

Primers used in the study

Gene	Sequence (5′-3′)
poxtA	TGCCCGTATTGGTTATCTCC
poxtA	TTCCTGCTCTGCATTGACTG
fexA	ATGACTCTGATGGGGCTGTC
fexA	CCTGCTCCAAGGTACAAAGC
norA	CAAGGTTTTGCAGGTGGATTG
norA	TGCTTCTTTACGGCGTGACTT
fosB	AGGTGAGACCTCGGCCTAT
fosB	CTTTCAACCAGATATACCAATCTTCA
ica operon	CTGGTAAAGTCCGTCAATGGAA
	TACCGTTGGATATTGCCTCTG
	ATTGACAGTCGCTACGAAAAGAAA
	ATCACTACCGGAAACAGCGAT
rplC	AGGAGGTGGACTTTCGATGAC
rplC	TGCAATTTCCTCCTTTCGCTTC
rplD	TAAGAAGCGAAAGGAGGAAATTG
rplD	ATTACGGGGCGCTTAAGAAC
rplV	TTTCAGCATACCATTTTGCTTCC
rplV	TAAAGGACATGCAGCAGACG
23S rRNA	CGGCGGCCGTAACTATAACGCAGCACTTATCCCGTCCATAC

Nucleotide sequence accession numbers

The 16S rRNA gene sequences were annotated using the NCBI BankIt tool and deposited in GenBank under accession numbers: MN850509–MN850519.

Results

Patient characteristics

We evaluated 10 patients (newborns and infants) age 23 days to 11 months at the time of the LRSE isolation; weight 915 to 6400 g on the day of admission to UCH. Four patients were small for gestational age (SGA), and no data was available for 2 patients. All patients were transferred from five different hospitals in Krakow or Lesser Poland. With an exception of one patient, all patients had at least one birth defect (Table 2). After transfer to the UCH, patients were admitted to two different Intensive Care Units: ICU 1 (n = 8) and ICU 2 (n = 2). All patients had indwelling central venous catheters. During the hospitalization, nine patients were transferred to another ward once or twice. The infection due to LRSE was diagnosed within 7 to 331 day after hospital admission. All LRSE isolates were recovered after at least 48 h after admission to the unit so the criterion of HAI is fulfilled. Patients were diagnosed with sepsis, fever, oliguria, and chronic respiratory failure. All patients underwent from one to six surgery operations. The values of infectious markers such as leukocytosis, the C-reactive protein (CRP), and procalcitonin (PCT) are presented in Table 2. At the time of LRSE isolation, six patients were treated with linezolid, but all patients were treated with linezolid at least once during hospitalization (Table 2). Figure 1 shows the time of patient hospitalization, LRSE detection, and date of patient discharge.

Table 2

Patients characteristics

Patient	Isolate no.	Date of isolate	Ward^a	Age^a (days)	Weight^b (g)	Length of hospitalization^a (days)	Antimicrobial treatment^a	No. of birth defects^b	No. of surgery procedures^b	Diagnosis associated with LRSE^a (sepsis etc)	Leukocytosis^a (leukocytes/mm³)	CRP^a (mg/l)	PCT^a (ng/ml)	Outcome
1	K/15/9696; K/15/9821	28.11.2015; 2.12.2015	ICU 1	23; 27	2900	23; 27	Linezolid (Zyvoxid); meropenem (Meronem); vancomycin	1	3	Fever; circulatory centralization; oliguria; edema	7180; 7250	57; 199.5	6.86; 1.98	Discharge
2	K/16/3213	12.04.2016	ICU 1	95	6400	7	Linezolid (Zyvoxid); meropenem (Meronem)	0	4	Fever	18,460	248	0.26	Discharge
3	K/16/4573	30.05.2016	ICU 2	236	3850	228	Ceftriaxone (Lendacin)	1	3	Fever	5100	8.2	n/d	Discharge
4	K/16/8122	21.09.2016	ICU 1	25	2740	15	Linezolid (Zyvoxid); meropenem (Meronem); vancomycin	3	1	The patient’s condition is stable, suspected asymptomatic endocarditis, no extra symptoms	4290	63	2.79	Discharge
5	K/16/9005	22.10.2016	ICU 1	268	915	15	Linezolid (Zyvoxid); meropenem (Meronem)	1	4	Severe chronic condition; respiratory failure; suppuration of the postoperative wound	17,340	55	0.11	Discharge
6	K/3119	25.04.2017	ICU 1	91	4820	68	Ceftolozane/tazobactam (Zerbaxa)	3	1	Very severe condition, but stable, no extra symptoms	8970	46.5	3.59	Discharge
7	K/17/5479	12.07.2017	ICU 1	337	2400	331	Vancomycin	3	6	Chronic severe condition, no extra symptoms	13,500	155.6	1.34	Death (not due to infection)
8	O/17/6502	03.09.2017	ICU 1	83	1880	76	Ceftazidime (Fortum); biseptol	1	3	Chronic respiratory failure, inflammation around the central catheter	7490	19	n/d	Discharge
9	O/17/6612	07.09.2017	ICU 2	70	3750	58	Linezolid (Zyvoxid); levofloxacin; colistin	2	3	Chronic circulatory failure; respiratory failure, no extra symptoms	10,130	65.8	0.28	Discharge
10	K/17/7152	13.09.2017	ICU 1	55	2300	54	Linezolid (Zyvoxid)	5	3	Sepsis; fever, gastrostomy suppuration	6670	245	0.24	Death (not due to infection)

LRSE linezolid-resistant S. epidermidis, CRP C-reactive protein, PCT procalcitonin

^aAt LRSE isolation

^bBefore LRSE infection

Characteristics of isolates and species identification

A total of 11 isolates from blood (n = 9), throat (n = 1), and central venous catheter (n = 1) collected from pediatric ICUs patients were investigated. Two isolates (K/15/9696 and K/15/9821) were collected from the same patient, 23 and 27 days after hospitalization, respectively. The preliminary identification with BD Phoenix™ system identified seven isolates as S. epidermidis and three isolates as Staphylococcus hominis. The obtained 16S rRNA sequences, identical for all studied isolates, were analyzed using nucleotide BLAST (Basic Local Alignment Search Tool, http://www.ncbi.nlm.nih.gov/BLAST/) and aligned to the reference sequences deposited in the GenBank and leBIBI databases. Using the previously described criteria for Staphylococcus identification at the species level [42‐43], the best and the second-best species alignments were analyzed, and all isolates were identified as S. epidermidis. The identification as S. epidermidis was additionally confirmed with the saoC gene restriction analysis.

Molecular typing and ica detection

PFGE analysis included 10 isolates into the subtype 1A and the remaining isolate from a catheter into the related pulsotype 1B. All isolates represented ST2 and harbored the ica operon.

Antimicrobial susceptibility and resistance determinants

Eleven investigated isolates fully shared their antimicrobial susceptibility profiles. All isolates remained susceptible to vancomycin, teicoplanin, daptomycin, ceftaroline, tetracycline, minocycline, tigecycline, rifampin, and erythromycin. All isolates showed high resistance to linezolid (MIC above 256 mg/L) together with resistance to chloramphenicol and clindamycin, consistent with the presence of cfr, rendering so-called PhLOPS_A phenotype [44]. No inducible clindamycin resistance was detected. The chloramphenicol-resistance gene, fexA, was also observed in the whole group. Additionally, the isolates demonstrated the A157R change in their deduced amino acid sequences of the L3 protein. No changes occurred in the analyzed part of 23S rRNA genes and in the L4 and L22 protein genes. The isolates also demonstrated resistance to methicillin, ciprofloxacin, fosfomycin, and gentamicin, and in agreement with these phenotypes, all isolates were positive for mecA, norA, fosB, and aac(6′)-Ie-aph(2″) located in the complete Tn4001 transposon. Altogether, the isolates were resistant to six various classes of antimicrobials, i.e., they were multidrug resistant [45].

SCCmec cassettes typing

In both SCCmec typing methods, all isolates revealed new composition of the SCCmec cassette. All LRSE strains harbored: mecA, mecI, SCCmecIII J1, and dcs genes which indicates the mixture of SCCmec type II and III cassette elements [38]. Despite the dcs, mecI, and mecA genes, the SCCmec II cassette includes kdp and ccrB genes which were not detected in LRSE isolates. Although, all 11 isolates had SCCmecIII J1 gene which is a component of SCCmec III but they did not harbor RIF gene. The Kondo typing method [34] showed that all 11 LRSE isolates possessed class A of mecA gene and two ccr complexes (ccrAB3 and ccrAB4).

Discussion

Linezolid is an effective treatment for multidrug-resistant Gram-positive bacteria and despite its broad use for almost 20 years, it still exhibits excellent activity against staphylococci. Linezolid resistance among S. epidermidis remains uncommon worldwide but the increasing resistance in European countries such as Greece, Spain, Portugal, Italy, France, and Ireland has been reported [10‐17]. The LRSE outbreaks occur occasionally and are mainly associated with ICUs [15]. Here, we describe the first emergence of LRSE and MRSE in Poland in a pediatric ICU. The emergence of LRSE strains is associated with an increased prior linezolid usage. In our hospital, linezolid was introduced into practice in 2005. The first LRSE strain was isolated from cerebrospinal fluid at 12.01.2014 from the Oncology and Hematology Department. Since 2015, the increased number of LRSE was isolated from invasive infections with a highest number of isolates in 2017.

Pediatric patients are at particular risk of bacterial infections due to their immature immune system, and this risk is especially evident in premature newborns and babies undergoing medical procedures, such as surgery, presence of catheters, and prolonged/extensive antimicrobial treatment. Restriction of linezolid usage was associated with disappearance of the resistant strains from the affected ICU.

In Poland, the nosocomial S. epidermidis population is dominated by strains belonging to MLST clonal complex 2 (CC2) [http://eburst.mlst.net]. These clones are multiresistant, seem to persist in hospital environment, and evolve quickly due to mutations, recombination events, and frequent transmission of mobile genetic elements [46]. In the present study, all isolates belonged to ST2, a presumable ancestral type of CC2. In Germany, in 2015, Bender et al. described 12 (33%) LRSE belonging to ST2 [11], O’Connor et al. described 9 isolates (100%) as ST2 [13], and Barros et al. described one in a Portuguese hospital [10]. In 2018, Dortet et al. described an outbreak caused by ST2, ST5, and ST22 of LRSE in France [15]. In other European countries, five different STs were identified: (i) ST22 in Greece, Germany, and Spain [11‐12, 16, 31]; (ii) ST23 in Italy and Germany [11, 14, 16]; (iii) ST83 in Italy [14]; and (iv and v) ST5 and ST168 in Germany [11, 16].

PFGE analyses are widely used for detection of the spread of a single clone at the local level [47], and we also applied this technique in our study. The restriction patterns of SmaI revealed two closely related PFGE types among isolates. Furthermore, all isolates shared the antimicrobial resistance phenotypes and determinants. Linezolid resistance was associated with acquisition of the A157R mutation in the ribosomal protein L3 and the presence of cfr gene. Such L3 alterations were described previously to impact linezolid susceptibility [48‐49]. As shown in other studies, the cfr gene can co-occur with other linezolid resistance mechanisms [26, 50‐51]. Importantly, the presence of a highly similar cfr plasmids in different genetic backgrounds was confirmed [17], and their acquisition via horizontal gene transfer in LRSE has been shown [11, 14]. The evidence for the presence of endemic LRSE clones that circulate in hospital settings was also reported [10, 12]. These strains differ from commensal S. epidermidis isolates and become more successful in the hospital environment [6]. All isolates carried also the icaADBC locus, which is responsible for the production of polysaccharide intercellular adhesin (PIA), playing an important role in formation of biofilm by the bacterium [52‐53]. Since, the linezolid have been used to treat biofilm-associated S. epidermidis infections, the circulation of LRSE with a biofilm-associated operon constitutes a real threat for patients [54‐55].

All studied isolates shared also the atypical composition of their SCCmec elements. Such situation is indeed observed in MRCoNS also by others [3, 56]. Chen et al. showed the multiple ccr complexes composition in CoNS strains. The authors showed the ccrAB3 and ccrAB4 genes in S. hominis and S. capitis [57]. Our study revealed not only the multiple ccr but also a combination of SCCmec cassette II and III elements in all our LRSE strains. The detection of new SCCmec cassettes composition of all LRSE strains revealed the acquisition of antibiotic resistance determinants within hospital environment and revealed that CoNS strains are a reservoir of antibiotic resistance genes which can be easily spread to S. aureus strains. To fully elucidate the structure of SCCmec element in studied isolates, the whole-genome sequencing is indispensable.

In conclusion, we have reported the first emergence of LRSE in Poland. Recently, linezolid is used more frequently, especially in pediatric patients for treatment of severe infections. As the ST2 LRSE is identified not only in Poland but in many European countries, it is very important to start or continue the surveillance, infection control, and antimicrobial guidelines against linezolid-resistant staphylococcal strains.

Acknowledgments

The publication made use of the PubMLST website (https://pubmlst.org/) developed by Keith Jolley (Jolley et al. Welcome Open Res 2018, 3:124) and sited at the University of Oxford. The development of that website was funded by the Welcome Trust. We thank Mariola Wolska for performing PCR of SCCmec cassettes during the study.

Compliance with ethical standards

Conflict of interest

The authors declare that they have no conflict of interest.

Ethical approval

For this type of study, formal consent is not required.

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Unsere Produktempfehlungen

e.Med Interdisziplinär

Kombi-Abonnement

Für Ihren Erfolg in Klinik und Praxis - Die beste Hilfe in Ihrem Arbeitsalltag

Mit e.Med Interdisziplinär erhalten Sie Zugang zu allen CME-Fortbildungen und Fachzeitschriften auf SpringerMedizin.de.

Jetzt testen ¹

e.Med Innere Medizin

Kombi-Abonnement

Mit e.Med Innere Medizin erhalten Sie Zugang zu CME-Fortbildungen des Fachgebietes Innere Medizin, den Premium-Inhalten der internistischen Fachzeitschriften, inklusive einer gedruckten internistischen Zeitschrift Ihrer Wahl.

Jetzt testen ²

Kosecka-Strojek M, Buda A, Miedzobrodzki J (2018) Staphylococcal ecology and epidemiology. In: Savini V (ed) Pet-to-man travelling staphylococci: a world in progress, 1st edn. Elsevier, Cambridge, pp 11–24. https://doi.org/10.1016/B978-0-12-813547-1.00002-9CrossRef

Sydnor ER, Perl TM (2011) Hospital epidemiology and infection control in acute-care settings. Clin Microbiol Rev 24(1):141–173. https://doi.org/10.1128/CMR.00027-10CrossRefPubMedPubMedCentral

Otto M (2013) Coagulase-negative staphylococci as reservoirs of genes facilitating MRSA infection: staphylococcal commensal species such as Staphylococcus epidermidis are being recognized as important sources of genes promoting MRSA colonization and virulence. Bioessays. 35(1):4–11. https://doi.org/10.1002/bies.201200112CrossRefPubMed

Liakopoulos V, Petinaki E, Efthimiadi G, Klapsa D, Giannopoulou M, Dovas S, Eleftheriadis T, Mertens PR, Stefanidis I (2008) Clonal relatedness of methicillin-resistant coagulase-negative staphylococci in the haemodialysis unit of a single university centre in Greece. Nephrol Dial Transplant 23(8):2599–2603. https://doi.org/10.1093/ndt/gfn101CrossRefPubMed

Cherifi S, Byl B, Deplano A, Nonhoff C, Denis O, Hallin M (2013) Comparative epidemiology of Staphylococcus epidermidis isolates from patients with catheter-related bacteremia and from healthy volunteers. J Clin Microbiol 51(5):1541–1547. https://doi.org/10.1128/JCM.03378-12CrossRefPubMedPubMedCentral

Cherifi S, Byl B, Deplano A, Nagant C, Nonhoff C, Denis O, Hallin M (2014) Genetic characteristics and antimicrobial resistance of Staphylococcus epidermidis isolates from patients with catheter-related bloodstream infections and from colonized healthcare workers in a Belgian hospital. Ann Clin Microbiol Antimicrob 13:20. https://doi.org/10.1186/1476-0711-13-20CrossRefPubMedPubMedCentral

Deplano A, Vandendriessche S, Nonhoff C, Dodémont M, Roisin S, Denis O (2016) National surveillance of Staphylococcus epidermidis recovered from bloodstream infections in Belgian hospitals. J Antimicrob Chemother 71(7):1815–1819. https://doi.org/10.1093/jac/dkw086CrossRefPubMed

Mendes RE, Deshpande LM, Jones RN (2014) Linezolid update: stable in vitro activity following more than a decade of clinical use and summary of associated resistance mechanisms. Drug Resist Updat 17:1–12CrossRef

Tsiodras S, Gold HS, Sakoulas G, Eliopoulos GM, Wennersten C, Venkataraman L, Moellering RC, Ferraro MJ (2001) Linezolid resistance in a clinical isolate of Staphylococcus aureus. Lancet 358:207–208CrossRef

10.

Barros M, Branquinho R, Grosso F, Peixe L, Novais C (2014) Linezolid-resistant staphylococcus epidermidis, Portugal, 2012. Emerg Infect Dis 20(5):903–905. https://doi.org/10.3201/eid2005.130783CrossRefPubMedPubMedCentral

11.

Bender J, Strommenger B, Steglich M, Zimmermann O, Fenner I, Lensing C, Dagwadordsch U, Kekule AS, Werner G, Layer F (2015) Linezolid resistance in clinical isolates of Staphylococcus epidermidis from German hospitals and characterization of two cfr-carrying plasmids. J Antimicrob Chemother 70(6):1630–1638. https://doi.org/10.1093/jac/dkv025CrossRefPubMed

12.

Karavasilis V, Zarkotou O, Panopoulou M, Kachrimanidou M, Themeli-Digalaki K, Stylianakis A, Gennimata V, Ntokou E, Stathopoulos C, Tsakris A, Pournaras S (2015) On behalf of the Greek Study Group on Staphylococcal Linezolid Resistance Wide dissemination of linezolid-resistant Staphylococcus epidermidis in Greece is associated with a linezolid-dependent ST22 clone. J Antimicrob Chemother 70(6):1625–1629. https://doi.org/10.1093/jac/dkv028CrossRefPubMed

13.

O'Connor C, Powell J, Finnegan C, O'Gorman A, Barrett S, Hopkins KL, Pichon B, Hill R, Power L, Woodford N, Coffey JC, Kearns A, O'Connell NH, Dunne CP (2015) Incidence, management and outcomes of the first cfr-mediated linezolid-resistant Staphylococcus epidermidis outbreak in a tertiary referral centre in the Republic of Ireland. J Hosp Infect 90(4):316–321. https://doi.org/10.1016/j.jhin.2014.12.013CrossRefPubMed

14.

Brenciani A, Morroni G, Pollini S, Tiberi E, Mingoia M, Varaldo PE, Rossolini GM, Giovanetti E (2016) Characterization of novel conjugative multiresistance plasmids carrying cfr from linezolid-resistant Staphylococcus epidermidis clinical isolates from Italy. J Antimicrob Chemother 71(2):307–313. https://doi.org/10.1093/jac/dkv341CrossRefPubMed

15.

Dortet L, Glaser P, Kassis-Chikhani N, Girlich D, Ichai P, Boudon M, Samuel D, Creton E, Imanci D, Bonnin R, Fortineau N, Naas T (2018) Long-lasting successful dissemination of resistance to oxazolidinones in MDR Staphylococcus epidermidis clinical isolates in a tertiary care hospital in France. J Antimicrob Chemother 73(1):41–51. https://doi.org/10.1093/jac/dkx370CrossRefPubMed

16.

Layer F, Vourli S, Karavasilis V, Strommenger B, Dafopoulou K, Tsakris A, Werner G, Pournaras S (2018) Dissemination of linezolid-dependent, linezolid-resistant Staphylococcus epidermidis clinical isolates belonging to CC5 in German hospitals. J Antimicrob Chemother 73(5):1181–1184. https://doi.org/10.1093/jac/dkx524CrossRefPubMed

17.

Weßels C, Strommenger B, Klare I, Bender J, Messler S, Mattner F, Krakau M, Werner G, Layer F (2018) Emergence and control of linezolid-resistant Staphylococcus epidermidis in an ICU of a German hospital. J Antimicrob Chemother 73(5):1185–1193. https://doi.org/10.1093/jac/dky010CrossRefPubMed

18.

Sadowy E (2018) Linezolid resistance genes and genetic elements enhancing their dissemination in enterococci and streptococci. Plasmid. 99:89–98. https://doi.org/10.1016/j.plasmid.2018.09.011CrossRefPubMed

19.

Ishiwada N, Takaya A, Kimura A, Watanabe M, Hino M, Ochiai H, Matsui M, Shibayama K, Yamamoto T (2016) Linezolid-resistant Staphylococcus epidermidis associated with long-term, repeated linezolid use in a pediatric patient. J Infect Chemother 22(3):187–190. https://doi.org/10.1016/j.jiac.2015.10.004CrossRefPubMed

20.

Hill RL, Kearns AM, Nash J, North SE, Pike R, Newson T, Woodford N, Calver R, Livermore DM (2010) Linezolid-resistant ST36 methicillin-resistant Staphylococcus aureus associated with prolonged linezolid treatment in two paediatric cystic fibrosis patients. J Antimicrob Chemother 65(3):442–445. https://doi.org/10.1093/jac/dkp494CrossRefPubMed

21.

Meka VG, Gold HS, Cooke A, Venkataraman L, Eliopoulos GM, Moellering RC Jr, Jenkins SG (2004) Reversion to susceptibility in a linezolid-resistant clinical isolate of Staphylococcus aureus. J Antimicrob Chemother 54(4):818–820CrossRef

22.

Liakopoulos A, Neocleous C, Klapsa D, Kanellopoulou M, Spiliopoulou I, Mathiopoulos KD, Papafrangas E, Petinaki E (2009) A T2504A mutation in the 23S rRNA gene responsible for high-level resistance to linezolid of Staphylococcus epidermidis. J Antimicrob Chemother 64(1):206–207. https://doi.org/10.1093/jac/dkp167CrossRefPubMed

23.

Lincopan N, de Almeida LM, Elmor de Araújo MR, Mamizuka EM (2009) Linezolid resistance in Staphylococcus epidermidis associated with a G2603T mutation in the 23S rRNA gene. Int J Antimicrob Agents 34(3):281–282. https://doi.org/10.1016/j.ijantimicag.2009.02.023CrossRefPubMed

24.

Cidral TA, Carvalho MC, Figueiredo AM, de Melo MC (2015) Emergence of methicillin-resistant coagulase-negative staphylococci resistant to linezolid with rRNA gene C2190T and G2603T mutations. APMIS. 123(10):867–871. https://doi.org/10.1111/apm.12426CrossRefPubMed

25.

Gu B, Kelesidis T, Tsiodras S, Hindler J, Humphries RM (2013) The emerging problem of linezolid-resistant Staphylococcus. J Antimicrob Chemother 68(1):4–11. https://doi.org/10.1093/jac/dks354CrossRefPubMed

26.

Mendes RE, Deshpande LM, Farrell DJ, Spanu T, Fadda G, Jones RN (2010) Assessment of linezolid resistance mechanisms among Staphylococcus epidermidis causing bacteraemia in Rome, Italy. J Antimicrob Chemother 65(11):2329–2335. https://doi.org/10.1093/jac/dkq331CrossRefPubMed

27.

Fan R, Li D, Wang Y, He T, Feßler AT, Schwarz S, Wu C (2016) Presence of the optrA gene in methicillin-resistant Staphylococcus sciuri of porcine origin. Antimicrob Agents Chemother 60(12):7200–7205PubMedPubMedCentral

28.

Antonelli A, D'Andrea MM, Brenciani A, Galeotti CL, Morroni G, Pollini S, Varaldo PE, Rossolini GM (2018) Characterization of poxtA, a novel phenicol-oxazolidinone-tetracycline resistance gene from an MRSA of clinical origin. J Antimicrob Chemother 73(7):1763–1769. https://doi.org/10.1093/jac/dky088CrossRefPubMed

29.

Mendes RE, Deshpande LM, Castanheira M, DiPersio J, Saubolle MA, Jones RN (2008) First report of cfr-mediated resistance to linezolid in human staphylococcal clinical isolates recovered in the United States. Antimicrob Agents Chemother 52(6):2244–2246. https://doi.org/10.1128/AAC.00231-08CrossRefPubMedPubMedCentral

30.

Seral C, Sáenz Y, Algarate S, Duran E, Luque P, Torres C, Castillo FJ (2011 Apr) Nosocomial outbreak of methicillin- and linezolid-resistant Staphylococcus epidermidis associated with catheter-related infections in intensive care unit patients. Int J Med Microbiol 301(4):354–358. https://doi.org/10.1016/j.ijmm.2010.11.001CrossRefPubMed

31.

Lozano C, Ruiz-García M, Gómez-Sanz E, López-García P, Royo-García G, Zarazaga M, Torres C (2012) Characterization of a cfr-positive methicillin-resistant Staphylococcus epidermidis strain of the lineage ST22 implicated in a life-threatening human infection. Diagn Microbiol Infect Dis 73(4):380–382. https://doi.org/10.1016/j.diagmicrobio.2012.04.013CrossRefPubMed

32.

Woo PC, Leung AS, Leung KW, Yuen KY (2001) Identification of slide coagulase positive, tube coagulase negative Staphylococcus aureus by 16S ribosomal RNA gene sequencing. Mol Pathol 54(4):244–247CrossRef

33.

Bukowski M, Polakowska K, Ilczyszyn WM, Sitarska A, Nytko K, Kosecka M, Miedzobrodzki J, Dubin A, Wladyka B (2015) Species determination within Staphylococcus genus by extended PCR-restriction fragment length polymorphism of saoC gene. FEMS Microbiol Lett 362(1):1–11. https://doi.org/10.1093/femsle/fnu007CrossRefPubMed

34.

Kondo Y, Ito T, Ma XX, Watanabe S, Kreiswirth BN, Etienne J, Hiramatsu K (2007) Combination of multiplex PCRs for staphylococcal cassette chromosome mec type assignment: rapid identification system for mec, ccr, and major differences in junkyard regions. Antimicrob Agents Chemother 51(1):264–274. https://doi.org/10.1128/AAC.00165-06CrossRefPubMed

35.

Linhardt F, Ziebuhr W, Meyer P, Witte W, Hacker J (1992) Pulsed-field gel electrophoresis of genomic restriction fragments as a tool for the epidemiological analysis of Staphylococcus aureus and coagulase-negative staphylococci. FEMS Microbiol Lett 74(2–3):181–185CrossRef

36.

Thomas JC, Vargas MR, Miragaia M, Peacock SJ, Archer GL, Enright MC (2007) Improved multilocus sequence typing scheme for Staphylococcus epidermidis. J Clin Microbiol 45(2):616–619. https://doi.org/10.1128/JCM.01934-06CrossRefPubMed

37.

Jolley KA, Bray JE, Maiden MCJ. (2018) Open-access bacterial population genomics: BIGSdb software, the PubMLST.org website and their applications. Wellcome Open Res 3:124. https://doi.org/10.12688/wellcomeopenres.14826.1

38.

Milheiriço C, Oliveira DC, de Lencastre H (2007 Sep) Update to the multiplex PCR strategy for assignment of mec element types in Staphylococcus aureus. Antimicrob Agents Chemother 51(9):3374–3377CrossRef

39.

Gawryszewska I, Żabicka D, Hryniewicz W, Sadowy E (2017) Linezolid-resistant enterococci in polish hospitals: species, clonality and determinants of linezolid resistance. Eur J Clin Microbiol Infect Dis 36(7):1279–1286. https://doi.org/10.1007/s10096-017-2934-7CrossRefPubMedPubMedCentral

40.

Leelaporn A, Yodkamol K, Waywa D, Pattanachaiwit S (2008) A novel structure of Tn4001-truncated element, type V, in clinical enterococcal isolates and multiplex PCR for detecting aminoglycoside resistance genes. Int J Antimicrob Agents 31(3):250–254CrossRef

41.

Sadowy E, Sieńko A, Gawryszewska I, Bojarska A, Malinowska K, Hryniewicz W (2013) High abundance and diversity of antimicrobial resistance determinants among early vancomycin-resistant Enterococcus faecium in Poland. Eur J Clin Microbiol Infect Dis 32(9):1193–1203. https://doi.org/10.1007/s10096-013-1868-yCrossRefPubMed

42.

Kosecka-Strojek M, Sabat AJ, Akkerboom V, Becker K, van Zanten E, Wisselink G, Miedzobrodzki J, Kooistra-Smid AMDM, Friedrich AW (2019) Development and validation of a reference data set for assigning Staphylococcus species based on next-generation sequencing of the 16S-23S rRNA region. Front Cell Infect Microbiol 9:278. https://doi.org/10.3389/fcimb.2019.00278CrossRefPubMedPubMedCentral

43.

Sabat AJ, van Zanten E, Akkerboom V, Wisselink G, van Slochteren K, de Boer RF, Hendrix R, Friedrich AW, Rossen JWA, Kooistra-Smid AMDM (2017) Targeted next-generation sequencing of the 16S-23S rRNA region for culture-independent bacterial identification - increased discrimination of closely related species. Sci Rep 7(1):3434. https://doi.org/10.1038/s41598-017-03458-6CrossRefPubMedPubMedCentral

44.

Long KS, Poehlsgaard J, Kehrenberg C, Schwarz S, Vester B (2006) The Cfr rRNA methyltransferase confers resistance to phenicols, lincosamides, oxazolidinones, pleuromutilins, and streptogramin A antibiotics. Antimicrob Agents Chemother 50(7):2500–2505CrossRef

45.

Magiorakos AP, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, Harbarth S, Hindler JF, Kahlmeter G, Olsson-Liljequist B, Paterson DL, Rice LB, Stelling J, Struelens MJ, Vatopoulos A, Weber JT, Monnet DL (2012) Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect 18(3):268–281. https://doi.org/10.1111/j.1469-0691.2011.03570.xCrossRef

46.

Miragaia M, Thomas JC, Couto I, Enright MC, de Lencastre H (2007) Inferring a population structure for Staphylococcus epidermidis from multilocus sequence typing data. J Bacteriol 189(6):2540–2552CrossRef

47.

Frickmann H, Gawlik PP, Crusius S, Podbielski A (2012) The current role of pulsed-field gel electrophoresis in methicillin-resistant Staphylococcus aureus (MRSA) typing and the retrospective identification of outbreaks. Eur J Microbiol Immunol (Bp) 2(2):128–133. https://doi.org/10.1556/EuJMI.2.2012.2.5CrossRef

48.

Long KS, Vester B (2012) Resistance to linezolid caused by modifications at its binding site on the ribosome. Antimicrob Agents Chemother 56(2):603–612. https://doi.org/10.1128/AAC.05702-11CrossRefPubMedPubMedCentral

49.

Rouard C, Aslangul E, Rivière A, Deback C, Butel MJ, Doucet-Populaire F, Bourgeois-Nicolaos N (2017) Mutation in the L3 ribosomal protein could be associated with risk of selection of high-level linezolid-resistant Staphylococcus epidermidis strains. Microb Drug Resist 23(4):462–467. https://doi.org/10.1089/mdr.2016.0137CrossRefPubMed

50.

Cercenado E et al (2010) Emerging linezolid resistance: dissemination of the cfr gene among Staphylococcus aureus, Staphylococcus epidermidis, enterococcus faecium and enterococcus faecalis and inability of the Etest method for detection, abstr C2-1490. Abstr. 50th Intersci. Conf. Antimicrob. Agents Chemother., Boston, MA

51.

Locke JB, Finn J, Hilgers M, Morales G, Rahawi S, G C K, Picazo JJ, Im W, Shaw KJ, Stein JL (2010) Structure-activity relationships of diverse oxazolidinones for linezolid-resistant Staphylococcus aureus strains possessing the cfr methyltransferase gene or ribosomal mutations. Antimicrob Agents Chemother 54(12):5337–5343. https://doi.org/10.1128/AAC.00663-10CrossRefPubMedPubMedCentral

52.

Heilmann C, Schweitzer O, Gerke C, Vanittanakom N, Mack D, Götz F (1996) Molecular basis of intercellular adhesion in the biofilm-forming Staphylococcus epidermidis. Mol Microbiol 20:1083–1091CrossRef

53.

Ziebuhr W, Heilmann C, Götz F, Meyer P, Wilms K, Straube E, Hacker J (1997) Detection of the intercellular adhesion gene cluster (ica) and phase variation in Staphylococcus epidermidis blood culture strains and mucosal isolates. Infect Immun 65:890–896CrossRef

54.

Hashem AA, Abd E, Fadeal NM, Shehata AS (2017) In vitro activities of vancomycin and linezolid against biofilm-producing methicillin-resistant staphylococci species isolated from catheter-related bloodstream infections from an Egyptian tertiary hospital. J Med Microbiol 66(6):744–752. https://doi.org/10.1099/jmm.0.000490CrossRefPubMed

55.

Reiter KC, Villa B, Paim TG, de Oliveira CF, d'Azevedo PA (2013) Inhibition of biofilm maturation by linezolid in meticillin-resistant Staphylococcus epidermidis clinical isolates: comparison with other drugs. J Med Microbiol 62(Pt 3):394–399. https://doi.org/10.1099/jmm.0.048678-0CrossRefPubMed

56.

Hanssen AM, Ericson Sollid JU (2007) Multiple staphylococcal cassette chromosomes and allelic variants of cassette chromosome recombinases in Staphylococcus aureus and coagulase-negative staphylococci from Norway. Antimicrob Agents Chemother 51:1671–1677CrossRef

57.

Chen XP, Li WG, Zheng H, Du HY, Zhang L, Zhang L, Che J, Wu Y, Liu SM, Lu JX (2017 Aug 22) Extreme diversity and multiple SCCmec elements in coagulase-negative Staphylococcus found in the clinic and Community in Beijing, China. Ann Clin Microbiol Antimicrob 16(1):57. https://doi.org/10.1186/s12941-017-0231-zCrossRefPubMedPubMedCentral

Titel: Emergence of linezolid-resistant Staphylococcus epidermidis in the tertiary children’s hospital in Cracow, Poland
verfasst von: Maja Kosecka-Strojek
Ewa Sadowy
Iwona Gawryszewska
Joanna Klepacka
Tomasz Tomasik
Michal Michalik
Waleria Hryniewicz
Jacek Miedzobrodzki
Publikationsdatum: 29.04.2020
Verlag: Springer Berlin Heidelberg
Erschienen in: European Journal of Clinical Microbiology & Infectious Diseases / Ausgabe 9/2020
Print ISSN: 0934-9723
Elektronische ISSN: 1435-4373
DOI: https://doi.org/10.1007/s10096-020-03893-w

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

^{Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag}

Kostenlos registrieren

Neu im Fachgebiet Innere Medizin

Notfall-TEP der Hüfte ist auch bei 90-Jährigen machbar

26.04.2024 Hüft-TEP Nachrichten

Ob bei einer Notfalloperation nach Schenkelhalsfraktur eine Hemiarthroplastik oder eine totale Endoprothese (TEP) eingebaut wird, sollte nicht allein vom Alter der Patientinnen und Patienten abhängen. Auch über 90-Jährige können von der TEP profitieren.

Niedriger diastolischer Blutdruck erhöht Risiko für schwere kardiovaskuläre Komplikationen

25.04.2024 Hypotonie Nachrichten

Wenn unter einer medikamentösen Hochdrucktherapie der diastolische Blutdruck in den Keller geht, steigt das Risiko für schwere kardiovaskuläre Ereignisse: Darauf deutet eine Sekundäranalyse der SPRINT-Studie hin.

Bei schweren Reaktionen auf Insektenstiche empfiehlt sich eine spezifische Immuntherapie

25.04.2024 Allergien und Intoleranzreaktionen Nachrichten

Insektenstiche sind bei Erwachsenen die häufigsten Auslöser einer Anaphylaxie. Einen wirksamen Schutz vor schweren anaphylaktischen Reaktionen bietet die allergenspezifische Immuntherapie. Jedoch kommt sie noch viel zu selten zum Einsatz.

Therapiestart mit Blutdrucksenkern erhöht Frakturrisiko

25.04.2024 Hypertonie Nachrichten

Beginnen ältere Männer im Pflegeheim eine Antihypertensiva-Therapie, dann ist die Frakturrate in den folgenden 30 Tagen mehr als verdoppelt. Besonders häufig stürzen Demenzkranke und Männer, die erstmals Blutdrucksenker nehmen. Dafür spricht eine Analyse unter US-Veteranen.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.

Newsletter bestellen

Springer Medizin

Abstract

Publisher’s note

Introduction

Materials and methods

Bacterial isolates

Genomic DNA extraction

Species identification

Susceptibility testing

Molecular typing, analysis of antimicrobial resistance determinants, and detection of the ica operon

Nucleotide sequence accession numbers

Results

Patient characteristics

Characteristics of isolates and species identification

Molecular typing and ica detection

Antimicrobial susceptibility and resistance determinants

SCCmec cassettes typing

Discussion

Acknowledgments

Compliance with ethical standards

Conflict of interest

Ethical approval

Publisher’s note

Unsere Produktempfehlungen

e.Med Interdisziplinär

e.Med Innere Medizin

Weitere Artikel der Ausgabe 9/2020

Molecular characterization of Shigella species isolated from diarrheal patients in Tehran, Iran: phylogenetic typing and its association with virulence gene profiles and a novel description of Shigella invasion associated locus

Molecular epidemiology of carbapenemase-producing Enterobacterales in Finland, 2012–2018

A decade after the emergence of Candida auris: what do we know?

Performances and usefulness of Xpert MTB/RIF assay in low-incidence settings: not that bad?

Comparison of Legionella K-set® and BinaxNOW® Legionella for diagnosing Legionnaires’ disease on concentrated urine samples

Is brucellosis a great mimic of tuberculosis? A case report

Leitlinien kompakt für die Innere Medizin

Neu im Fachgebiet Innere Medizin

Notfall-TEP der Hüfte ist auch bei 90-Jährigen machbar

Niedriger diastolischer Blutdruck erhöht Risiko für schwere kardiovaskuläre Komplikationen

Bei schweren Reaktionen auf Insektenstiche empfiehlt sich eine spezifische Immuntherapie

Therapiestart mit Blutdrucksenkern erhöht Frakturrisiko

Update Innere Medizin