Introduction
As one of the deadliest cancers, malignant melanoma (MM) is a highly malignant tumor and difficult to treat when diagnosed in the late stage. Approximately 75% of skin cancer patients die of melanoma, although it accounts for approximately 2% of all skin cancers; thus, MM is the main cause of death from skin cancer [
1]. Meanwhile, the incidence rate of melanoma has been increasing sharply with the affected population gradually becoming younger [
2]. The principal treatment for early stage melanoma is surgery; however, 40–60% of high-risk cases experience recurrence and metastasis [
3], and patients with metastatic melanoma have a five-year survival rate of only 10% [
4]. In the past decades, targeted therapy has emerged as the main treatment for various cancers, and new targets have been discovered one after the other. As a result, it's critical to look at potential molecular therapy targets for MM.
Epithelial mesenchymal transition (EMT) is a key process in tumor cell metastasis. EMT has been shown to play a significant role in progression and metastasis of melanomas [
5]. EMT is regulated by a variety of signaling pathways, among which is the Wnt/β-catenin signaling pathway, one of the most classic pathways [
6,
7]. The Wnt/β-catenin pathway is closely related to the occurrence, progression, metastasis, and drug resistance of cancer cells. It plays an important role in the development of many cancers, such as colorectal cancer, melanoma, breast cancer, lung cancer, and leukemia [
8].
Proliferation associated protein 2G4 (PA2G4), also known as the ERBB3 binding protein 1 (Ebp1), is a widely expressed multifunctional protein [
9]. There are two types of p48 and p42. Both subtypes play regulatory roles in cell growth and differentiation. However, these two subtypes play opposite roles in different tissues [
10]. In a number of cancerous tumors, the expression of the long subtype Ebp1 p48 is significantly increased, such as glioblastoma multiforme (GBM) [
11], colon cancer [
12], hepatocellular carcinoma [
13], and acute myeloid leukemia [
14]. The expression level of Ebp1 p48 is also closely linked to cancer patients’ clinical prognosis. Studies have shown that PA2G4 is an independent prognostic factor in breast cancer by means of 2-nitrobenzenesulfenyl chloride/two-dimensional gel electrophoresis/mass spectrometry (NBS/2DE /MS) protein quantification [
15]. In addition, GBM patients with increased Ebp1 p48 expression had a significantly worse prognosis than those with lower expression [
11]. Since the longer subtype of Ebp1 p48 is the main expressed form, its carcinogenic function deserves more attention. Nevertheless, the tumor suppressive effect of the shorter subtype Ebp1 p42 in other cancers cannot be ignored [
16‐
18].
In this study, we explored the mechanism by which Ebp1 promotes the proliferation and metastasis of melanoma cells, as well as the expression of Ebp1 in melanoma tissues. Moreover, we also looked into the effect of Ebp1 on the Wnt/β-catenin pathway.
Materials and methods
Cell culture
Human keratinocytes HaCaT, human melanoma cells A375 and murine melanoma cells B16 were purchased from the National Collection of Authenticated Cell Cultures. The above cells were cultured in DMEM medium (Gibco) with 10% FBS (Bioind) and 1% penicillin–streptomycin solution (Bioind) at 37 ℃ incubator supplemented with 5% CO2. Cell lines were tested monthly for mycoplasma and validated via STR testing.
Cell transfection
A375 and B16 cells were transduced with the shRNA lentivirus targeting Ebp1 (TRCN050413, target sequence: CCGGCCACCAGCATTTCGGTAAATACTCGAGTATTTACCGAAATGCTGGTGGTTTTTG, Sigma-Aldrich) or the non-silencing control (TRCN0286798 target sequence: CCGGCCTGGTCGTGACCAAGTATAACTCGAGTTA TACTTGGTCACGACCAGGTTTTTG, Sigma-Aldrich) and then selected with 1 μg/ml puromycin for 7 days. The transfection efficacy was determined by western blot.
Cell growth assay
For cell proliferation analysis, A375 and B16 cells transduced to express sh-NC and sh-Ebp1 were seeded on 96 well plates at 1 × 103 / well and cultured for 0, 1, 2, 3, 4, 5 and 6 days, cells were cultured for 1 h at 37 ℃ with 10ul of CCK-8 solution. Absorbance value was measured at 450 nm.
Gene transduced A375 and B16 cells were seeded into 6-well plates (2 × 103 cells/ well) and cultured for 14 days. Then the cells were first washed twice with PBS solution and fixed with 4% paraformaldehyde (Solarbio) for 15 min. The cells were stained using Giemsa stain (Solarbio).
Flow cytometry
A375 and B16 cells were fixed in 70% ethanol for 18 h at 4 °C, washed with PBS, and incubated with Propidium Iodide for 30 min. Cells were analyzed by flow cytometer (BD Biosciences).
Wound healing assay
Gene transduced A375 and B16 cells were seeded on 6 well plates, grown to near confluence, and incubated with serum-free media overnight. Then cells were wounded with a 10-μl pipette tip. Images were taken at 0 and 48 h after wounding.
Transwell assay
The A375 and B16 cells were trypsinized and resuspended in DMEM without serum, and 300 μl cell suspension with 2 × 105 cells administered to the top chamber, 600ul complete DMEM was added to the deeper well. 24 h later, the cell was fixed for 15 min and stained with Giemsa, then washed with ddH2O and photographed.
Western blot
Cells were grown to approximately 90% confluence in the 10%FBS/DMEM medium Protein lysates were prepared by RIPA buffer. For Western blotting, proteins (20 μg/sample) were separated by different polyacrylamide gel electrophoresis, transferred onto PVDF membrane, and incubated with the primary antibodies overnight. Then the blots were incubated with HRP-conjugated secondary antibodies (Boster Biological Technology), detected with the X-ray film and imaged. The antibodies used in the experiment were shown in Table
1.
Table 1
Antibodies used in the experiment
Ebp1 (N-terminus) (WB) | 1:1000 | Millipore | Goat anti-rabbit IgG |
Vimentin (C-20) (WB) | 1:1000 | Santa Cruz | Rabbit anti-goat IgG |
N-cadherin (13A9) (WB) | 1:1000 | Santa Cruz | Goat anti-mouse IgG |
Snail (ab53519) (WB) | 1:1000 | Abcam | Goat anti-rabbit IgG |
E-cadherin (S-17) (WB) | 1:1000 | Santa Cruz | Rabbit anti-goat IgG |
Slug (A-7) (WB) | 1:1000 | Santa Cruz | Goat anti-mouse IgG |
β-catenin (E-5) (WB) | 1:1000 | Santa Cruz | Goat anti-mouse IgG |
p-GSK-3β (Ser 9) (WB) | 1:1000 | Santa Cruz | Rabbit anti-goat IgG |
cyclinD1 (A-12) (WB) | 1:1000 | Santa Cruz | Goat anti-mouse IgG |
β-actin (C4) (WB) | 1:1000 | Santa Cruz | Goat anti-mouse IgG |
Vimentin (C-20) (IF) | 1:200 | Santa Cruz | TRITC-rabbit anti-goat IgG |
E-cadherin (S-17) (IF) | 1:200 | Santa Cruz | TRITC-rabbit anti-goat IgG |
Immunofluorescence
Cells were seeded on coverslips and cultured until 70% confluence, then permeabilized in PBS containing 0.4% Triton, fixed in PBS with 4% paraformaldehyde and blocked with 1% BSA for 1 h. The primary antibody was added and incubated overnight, then incubated with secondary antibody for 1 h and stained with DAPI. The cells were visualized and imaged with a laser scanning microscope (Nikon, Japan).
Animal studies
Animal studies were performed in compliance with Yanbian University Ethics Committee. 4–6 weeks old female nude mice were purchased from the Experimental animal center of Yanbian University. Animals (n = 6/group) were injected with 100 µl of solution containing 5 × 106 B16 cells (sh-NC; sh-Ebp1) via the caudal vein. 3 weeks later, the mice were sacrificed, and the lung tissues were collected.
H&E staining
Lung tissues from mice were fixed in 10% formalin, dehydrated in graded ethanol, then embedded in paraffin, cut into 4um thickness slices. Slices were baked in an oven at 56 ℃ overnight and stained with H&E Stain Kit (Solarbio, Beijing, China).
Statistical analysis
The two-tailed multiple Student’s t-tests were used to determine significant differences and Kaplan–Meier was used to estimate the survival function. Computations were performed using SPSS 26.0 (IBM, USA) or GraphPad Prism 8. The data are expressed as the means ± SD and all p values less than 0.05 were considered statistically significant. All the experiments were repeated at least three times.
Discussion
Although MM has a low global cancer incidence rate, the mortality rate of MM patients is significantly high owing to its high metastasis rate [
19]. Early surgical resection can achieve a good curative effect; however, the treatment difficulty increases significantly in cases of metastatic MM, which causes many patients to relapse or have a poor prognosis [
20]. Therefore, the mechanism of metastasis in MM requires further investigation.
The PA2G4 gene encodes Ebp1, a multifunctional protein that regulates proliferation [
21]. The two subtypes of Ebp1 play different roles in different types of cancers [
22]. Since Ebp1 p48 is the main form of maintenance expression in mammalian cells [
23], research on the carcinogenic effect of Ebp1 p48 is critical. Ebp1 p48 promotes the malignant biological behavior of glioma cells through the negative regulation of p53, according to current research [
11]. In addition, in oral tumors, Ebp1 promotes tumorigenesis by activating podoplanin [
24]. Moreover, some scholars have proposed that the carcinogenic effect of Ebp1 p48 depends on the phosphorylation of the N-terminal domain of the longer subtype by CDK2 [
25]. Pisapia et al. found that Ebp1 p48 was highly expressed in M14 melanoma cells, and Ebp1 p48 promoted the growth of glioblastoma cells and melanoma cells as an oncogene [
26]. However, there are no reports on the mechanism by which Ebp1 p48 promotes metastasis in melanoma. Because the high metastasis rate of melanoma is the most common lethal factor, it is crucial to study the mechanism of melanoma metastasis. This study investigated the effect of Ebp1 on the progression of MM. First, by analyzing the clinical data of melanoma patients in TCGA and GTEx databases, it was found that Ebp1 was highly expressed in MM, and was linked to the disease progression and prognosis of patients with MM. This suggests that Ebp1 may be carcinogenic in the occurrence and development of MM. To test our hypothesis, we knocked down Ebp1 in two melanoma cell lines. It was found that the knockdown of Ebp1 drastically reduced the proliferation, migration, and invasion of the A375 and B16 cells. Combined with the results of the in vitro tests, we performed lung metastasis experiments in vivo. Notably, the results of the in vivo experiments show that Ebp1 plays an important role in promoting melanoma metastasis, which is consistent with the carcinogenic role of Ebp1 in glioma cells and oral tumors. In recent years, studies have shown that the ERBB receptor family, including ERBB1, ERBB2, ERBB3 and ERBB4, are important regulators of skin homeostasis. Their imbalance usually leads to cancer [
27]. Moreover, the high expression level of ERBB3 significantly correlated with the poor survival rate of melanoma patients [
28]. Ebp1 is an ERBB3 binding protein. We considered that Ebp1, following its interaction with ERBB3, may cause an imbalance in ERBB3 in melanoma, which leads to poor prognosis for patients with high Ebp1 expression. However, future research is needed to confirm this hypothesis.
EMT is important in carcinogenesis and metastasis [
29]. Growing evidence shows that non-epithelial tumors, including MM, also have mesenchymal-like characteristics, which help the tumor cells to acquire strong metastatic ability [
30]. Therefore, we speculate that Ebp1 may enhance MM cells invasion and metastasis by inducing EMT. Through western blotting and immunofluorescence, we found that Ebp1 knockdown changed the expression of EMT-related proteins. This suggests that Ebp1 may be involved in the EMT process.
The molecular mechanisms regulating EMT are diverse. EMT plays an important role in cell adhesion [
31]. Studies have shown that E-cadherin usually forms a complex with β-catenin and inhibits the movement of tumor cells [
32,
33]. However, E-cadherin can be down-regulated by specific transcription factors, such as the SNAIL, SLUG, and ZEB zinc finger proteins [
34‐
36]. These transcription factors are affected by different signaling pathways, including TGF-β members, Notch, Hedgehog, and Wnt [
37]. Wnt/β-catenin signaling pathway is closely related to cancer occurrence and development [
38,
39]. In addition, the Wnt signaling pathway also plays an important role in melanocyte differentiation and cell cycle progression, and has also been proven to play a role in melanoma progression [
8,
40,
41]. At the same time, a decrease in E-cadherin will cause intracellular β-catenin aggregation. A large amount of undegraded β-catenin transfers to the nucleus and activates downstream Wnt-dependent transcription factors, thus promoting the growth and invasion of different types of cancer cells, including melanoma [
42,
43].
β-catenin is the central molecule of the Wnt signaling pathway. Under normal circumstances, the destruction complex composed of APC, Axin, GSK-3β, and CK1α induces the degradation of β-catenin in the cytoplasm [
44]. Moreover, when Wnt/β-catenin pathway is activated, the destruction complex is inactivated, resulting in β-catenin accumulation in the cytoplasm and entry into the nucleus to promote downstream target genes [
45‐
47]. GSK-3β is the main negative regulator of the Wnt/β-catenin signaling pathway [
48]. GSK-3β mainly regulates the phosphorylation, degradation, and translocation of β-catenin [
49]. GSK-3β decreases the amount of β-catenin in the cytoplasm, resulting in a reduction in the number of β-catenin entering the nucleus. According to the above literature, we considered that Ebp1 may affect β-catenin degradation by regulating GSK-3β. CHIR99021 is an inhibitor of GSK3β and a specific activator of the Wnt/β-catenin pathway [
50]. Moreover, 6 µM CHIR99021 was added to A375 and B16 knockdown Ebp1 cells. CHIR99021 reversed the changes caused by Ebp1 knockdown in related proteins. These results suggest that Ebp1 affects the progression of malignant melanoma in a Wnt/β-catenin dependent manner.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.