Background
Acute myeloid leukemia (AML) is a malignant hematological disease that occurs primarily in the bone marrow (BM). Marrow adipocytes, as an important component of the BM niche, have been suggested to contribute to the proliferation and anti-chemotherapy of AML cells by providing energy or secreting adipokines [
1,
2]. Our previous study found that only small marrow adipocytes, not the total marrow adipocytes, were correlated with a poor prognosis for AML patients [
3], suggesting that understanding the generating mechanism of small marrow adipocytes may be useful for improving the prognosis of AML patients.
In prostate cancer and ovarian cancer, it has been reported that adipocytes surrounding the tumor cells become small and are involved in the metastasis and growth of prostate cancers or ovarian cancers [
4,
5]. In leukemia, Shafat et al. reported that marrow adipocytes transfer fatty acids to AML blasts by activating lipolysis in adipocytes [
2]. These reports indicate that the reduction of adipocyte size is due to transfer of their lipid droplets to tumor cells. Additionally, in breast cancer, tumor cells release inflammatory factors, such as TNFα and Wnt3a, which are involved in the regulation of morphological remodeling of the mature adipocytes, including the reduction of adipocyte size and acquisition of fibroblast-like morphology [
6]. This implies that the morphological remodeling of adipocytes are not only due to the transfer of their lipid droplets to the surrounding tumor cells but also highly dependent on extrinsic signals from tumor cells.
Growth differentiation factor-15 (GDF15), a TGF-β/bone morphogenetic protein (BMP) superfamily member, is a 40-kDa secretory propeptide that is cleaved in the endoplasmic reticulum to release a 25-kDa circulating protein [
7]. Under physiological conditions, GDF15 is abundantly expressed only in placenta and macrophage cells [
8]. However, recent studies have reported that GDF15 is highly expressed in many types of cancer tissues, including colorectal, gastric, esophageal, oral, pancreatic and so on [
9‐
14]. We previously found the expression of GDF15 was high in the residual acute lymphoblastic leukemic cells in mice [
15]. However, its expression in AML cells has not been studied in depth. Studies have shown that similar to other TGF-β family members, GDF15 is involved in the inhibition of cell growth, induction of apoptosis, and enhancement of cancer invasiveness in different cancer cell lines [
16‐
19]. Until now, little attention was paid to the effect of GDF15 on the adipocytes. Increased serum concentrations of GDF15 have been reported in patients with anorexia nervosa and obesity [
20], inspiring us to explore the function of GDF15 on the adipocytes. Here, we demonstrate that leukemic cells highly express GDF15, and in turn, GDF15-induced small adipocytes may promote the growth of leukemic cells.
Methods
Cell culture and regents
The leukemic cell lines THP-1, K562, HEL, HL-60 and Kasumi (Chinese Academy of Sciences Cell Bank, Shanghai, China) were cultured in 1640 supplemented with 10% fetal bovine serum (FBS) (Gibco, Grand Island, NY, USA) and penicillin-streptomycin at 37 °C in 5% CO2. Primary AML blasts and mesenchymal stem cells in bone marrow (BMSCs) were isolated by Ficoll-Hypaque (Axis-Shield Diagnostics, Dundee, Scotland, UK) density-gradient centrifugation. BMSCs were differentiated into adipocytes as previously described [
21]. The differentiated adipocytes were stained with Oil Red O (ORO). Conditioned medium (CM) from the leukemic cell lines was obtained from cells cultured with high glucose Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 1% FBS. Mature adipocytes were cultured with high glucose DMEM supplemented with 10% FBS alone or mixed with the leukemic cell lines CM at the ratio of 4:1. Mature adipocytes were treated with recombinant human GDF15 (rhGDF15 200 ng/ml, Peprotech, Cat#120–28, USA) or a neutralizing anti-GDF15 antibody (8 μg/ml, R&D Systems, Cat#MAB957, USA) for 5 days to observe the effect of GDF15 factor on the marrow adipocytes.
Cell cycle analysis
The measurements were made using a flow cytometry (Beckman, Urbana, IL, USA). In brief, THP-1 and K562 cells were cultured with the CM from mature adipocytes and small adipocytes for 48 h respectively, washed with PBS, then fixed with 70% ethanol for 24 h. Cells were incubated with propyl iodide (Sigma, St Louis, MO, USA) organism dye for 30 min at 37 °C, followed by flow cytometric analysis.
Free fat acid detection
Adipocytes were treated with or without rhGDF15 (200 ng/ml) for 5 days, then the cultured medium was replaced by high glucose DMEM with 1% FBS for 48 h. The supernatant of adipocytes was collected and stored in − 80 °C.The concentration of FFA was detected by using a colorimetric method via a commercial kit (Sigma Aldrich, St. Louis, Missouri). The assay was carried out according to manufacturer’s specifications.
Cell proliferation assay
After treating mature adipocytes with GDF15 for 5 days, we cultured the GDF15-induced small adipocytes with DMEM supplemented with 10% FBS for 48 h. Then, leukemic cells were co-cultured with the CM of mature adipocytes or GDF15-induced small adipocytes. Leukemic cells (3 × 103) were seeded into 96-well plates, and the leukemic cell proliferation was evaluated by a CCK8 kit (Dojindo, Japan). CCK8 reagent was added to each well and incubated for 2 h at 37 °C. The measurement of absorption at 450 nm was performed using a microplate reader (Multiscan FC, Thermo Fisher, USA).
Transfection assays
Transfection assays were set up for 4 groups, scrambled siRNA (negative control/NC), GDF15-homo-161 (siRNA-161); GDF15-homo-290 (siRNA-290) and GDF15-homo-860 (siRNA-860) groups. GDF15-siRNA and scrambled siRNA were obtained from Shanghai GenePharma Co., Ltd (Shanghai, China) and blended into 20 μM with DEPC water and stored in - 20 °C. The THP-1 cells were seeded in 24-well plates at a density of 2 × 105 cells/well for 24 h prior to transfection and then the medium was replaced with 0.5 mL of Opti-MEM medium. Subsequently, 1 μL of Lipofectamine 2000, 2 μL of GDF15-siRNA was added into the corresponding well. After 48 h and 72 h of transfection, the cells were collected for further gene expression assays.
PCR and real-time quantitative PCR (RT-qPCR)
Total RNA was extracted using Trizol (Invitrogen, Paisley, UK), and the RNA was converted into cDNA using the PrimeScript™ RT reagent Kit (Takara Bio Inc, Shiga, Japan) for RT-qPCR and using the PrimeScript™ II 1st Strand cDNA Synthesis Kit (Takara Bio Inc, Shiga, Japan) for PCR. All RT-qPCR reactions were performed using an ABI 7500 system (Biosystems, Foster City, CA, USA) and the SYBR Premix Ex Taq reagent kit (Takara Bio Inc, Shiga, Japan). Premix Taq™ (Takara Bio Inc, Shiga, Japan) for electrophoresis. All the primers used in this study are presented in the Table
1.
Table 1
Sequences of the primers used to detect genes expression by RT-qPCR
GDF15 | GACCCTCAGAGTTGCACTCC | GCCTGGTTAGCAGGTCCTC | NM_004864 |
FABP4 | AACCTTAGATGGGGGTGTCCTG | CTCTCTCATAAACTCTCGTG | NM_001442 |
PPARγ | GGGATCAGCTCCGTGGATCT | TGCACTTTGGTACTCTTGAAGTT | NM_138711 |
C/EBPα | GAACAGCAACGAGTACCGGGTA | GCCATGGCCTTGACCAAGGAG | NM_004364 |
HSL | GACCCCTGCACAACATGATG | TGAGCAGCACCCTTTGGATG | NM_005357 |
ATGL | GGCTTCCTCGGCGTCTACTA | TTTACCAGGTTGAAGGAGGGG | NM_020376 |
GAPDH | AATGGACAACTGGTCGTGGAC | CCCTCCAGGGGATCTGTTTG | NM_014364 |
Western blotting analysis and ELISA
Mononuclear cells from the controls and primary AML patients were washed twice with phosphate buffer saline and resuspended in 200 μl of lysis buffer containing a mix of protease inhibitors (Beyotime, Haimen, Jiangsu, China). Immunoblots were prepared as previously described [
22]. Rabbit anti-GDF15 monoclonal antibody (Abcam, Cambridge, MA, USA), rabbit anti-β-tubulin antibody (Abcam, Cambridge, MA, USA), rabbit anti-Cdk2 antibody (Abcam, Cambridge, MA, USA), rabbit anti-Cyclin D1 antibody (Abcam, Cambridge, MA, USA), rabbit anti-P21 antibody (Abcam, Cambridge, MA, USA) and rabbit anti-β-actin monoclonal antibody (Cell Signaling Technology, Danvers, MA, USA). The THP-1 cell CM was obtained from cells cultured in regular medium with 1% FBS at different cell densities (2 × 10
5/ml, 5 × 10
5/ml, 1 × 10
6/ml, 2 × 10
6/ml). The ELISA analysis for GDF15 was performed according to the manufacturer’s instructions (R&D systems).
Immunofluorescence
Adipocytes differentiated on coverslips grown alone or co-cultivated with leukemic cells were fixed with 4% paraformaldehyde and blocked with goat serum. The process was carried out as previously described [
23]. Cells were stained with neutral lipid specific BODIPY®493/503 (4, 4-difluoro-1,3,5,7,8-pentamethyl-4-bora-3a,4a-diaza-s-indacene) dye, tubulin and DAPI. The immunofluorescence of BM paraffin sections from AML patients was performed as previously described [
24]. The sections were stained with GDF15 (goat anti-GDF15 multiclonal antibody, Abcam, Cambridge, MA, USA), CD34 (rabbit anti-CD34 monoclonal antibody, Abcam, Cambridge, MA, USA), CD117 (rabbit anti-CD117 polyclonal antibody, Proteintech, Wuhan, China) and DAPI (Solarbio, Beijing, China). Fluorescent images were captured using a confocal laser microscopy system (Leica SP2).
Adipocyte measurements
BM trephine biopsies of 20 AML patients were obtained from the posterior iliac crest, and BM tissues were fixed, decalcified and embedded with paraffin or plastic slices according to the conventional methods. This study was approved by the Medical Ethical Committee of our institute. The adipocyte number and adipocyte volume were measured as previously reported. The number and area of per adipocyte cultured in vitro were measured by using Image-Pro Plus 5.1. Ten fields were analyzed at × 400 magnification.
Statistical analysis
Values were calculated as the mean ± SEM. The Spearman’s correlation test was used to analyze the correlation between small adipocyte volume or small adipocyte number and GDF15 level in the BM. For all analyses, P < 0.05 was considered to be significant. All statistical analyses were performed using the SPSS 20.0 software program (Statistical Package for Social Science, SPSS Inc. Chicago, IL., USA).
Discussion
In the present study, we investigated the possible mechanism on the generation of small adipocytes in AML patients by focusing on extracellular regulatory factors. We found that small marrow adipocytes were remodeled from larger marrow adipocytes in response to the release of GDF15 from leukemic cells. Accordingly, GDF15-induced small adipocytes could promote the proliferation of leukemic cells, indicating that GDF15 plays a critical role in the crosstalk between leukemic cells and adipocytes.
In this study, both on BM sections and in AML cell lines, our experiments showed that AML cells highly expressed GDF15. As a secretory protein, GDF15 might be released into the BM cavity by leukemic cells and have an effect on other cells in BM, including adipocytes. Certainly, non-leukemic cells also expressed GDF15 on BM sections (Fig.
5c-
d). Our previous studies have demonstrated that GDF15 was highly expressed in leukemia-activated fibroblasts, suggesting that GDF15 was from many kinds of cells in BM of AML patients. Additionally, it has been reported that mature adipocytes can undergo morphologic changes, from mature adipocytes to small adipocytes (cancer-associated adipocytes) to fibroblast-like cells (adipocytes-derived fibroblasts) when they were activated by soluble factors derived from solid tumor cells [
6]. Therefore, we guessed that GDF15 secreted by leukemic cells might play an important role in the conversion from adipocytes to leukemia-activated fibroblasts. Functionally, GDF15 was involved in the fibrosis of many organs [
28‐
30]. Although both the fibroblasts and adipocytes can be differentiated from BMSCs, it is less known about the function of GDF15 in adipogenesis. However, it is well known that TGF-β1 and GDF15 are belonged to the TGF-β superfamily, which can prevent preadipocyte differentiation through cooperation with the Wnt signaling pathway [
27]. Similarly, CTGF, a downstream mediator of TGF-β1 signaling in many cell types, has anti-adipogenic effects in primary adipocytes [
31,
32]. It leads us to infer the possibility that GDF15 may play an important role in the marrow adipocyte differentiation of AML patients. Indeed, our results, acquired by exogenous addition rhGDF15 or neutralizing anti-GDF15 antibody, indicated that GDF15 can induce the transition of larger adipocytes into small adipocytes. This was further confirmed by the positive correlation between the levels of GDF15 and the number and volume of small adipocytes in AML patients. Meanwhile, our results were consistent with the findings reported by Chrysovergis K et al. In that study, they found that the transgenic mice treated with GDF15 expressing xenografts had smaller adipocytes compared to wild-type (WT) littermates [
33].
Our results indicated that GDF15 could induce the adipocyte remodeling, that is the morphological transition of larger adipocytes into small adipocytes. It has been showed that the small adipocytes in mice highly expressed lipolytic genes [
33]. Our results also showed that the expression of lipolytic genes including HSL and ATGL increased in the GDF15-induced small adipocytes, indicating that the marrow adipocytes remodeling might be dependent on lipolysis. However, much remains to be uncovered on the mechanism of lipolysis regulation by GDF15. It has been reported that GDF15 induced a significant ERK activation in the malignant progression of human cancer cell [
34‐
36]. What’s more, ERK activation could cause HSL phosphorylation which leads to increased activity of the enzyme [
37]. Thus, whether the increased HSL in GDF15 induced-small adipocytes is also dependent on ERK signal pathway requires further study. Adipose tissue is a plastic organ with the ability of a continuous remodeling, including of extension and regression depending on nutrient intake [
38,
39]. The morphological, transcriptional and functional remodeling of adipocytes may be concurrent [
39]. Indeed, we found that when the adipocytes were becoming small induced by GDF15, they had a stronger ability to promote the proliferation of leukemic cells (Fig.
4). Smaller adipocytes are frequently linked to higher metabolic activity since smaller adipocytes suggest greater utilization of fat storage for metabolism [
40,
41]. Until now, the function of FFAs on the tumor cells was still controversial. On one hand, some reported that FFAs could inhibit the growth and progression of breast cancer cells [
42,
43]. On the other hand, FFAs could promote the proliferation of leukemic cells and the metastasis of ovarian cancer cells [
2,
44]. In our study, we found that with the high expression of lipolytic genes, the FFA levels increased during the process of small adipocyte formation. Since it has been reported that FFAs can be transported by FABP4 to AML cells [
2], we considered that the leukemic cell rapid proliferation might rely on FFAs providing energy.
Conclusions
In conclusion, leukemic cells mediated the marrow adipocyte remodeling from larger adipocytes to small adipocytes by secreting GDF15. In turn, small adipocytes enhanced the leukemic cell proliferation by providing FFA. From the point of bone marrow microenvironment, GDF15 might be a new target to treat the leukemia. Since our study was focused only on clinical samples, animal studies in the future would provide a better insight into the mechanism of GDF15 regulation on marrow adipocytes remodeling.