Background
Every year, more than 10,000 people in the United States are victims of spinal cord injury (SCI) caused by traffic, sports, and other trauma-related accidents. While medication during the acute injury period involves the administration of large amounts of steroids and other anti-inflammatory drugs, the recovery of neurological function relies on neural plasticity and compensatory mechanisms specific to each patient. Many of these patients end up being permanently paralyzed [
1,
2].
Observations made on animal models suggest that a potential therapy for disorders of the central nervous system (CNS) is the administration of adult mesenchymal stem/stromal cells (MSCs) from bone marrow [
3-
6]. While human MSCs (hMSCs) initially attracted interest for their ability to differentiate into multiple cellular phenotypes
in vitro and
in vivo, part of the interest in them is due to their anti-inflammatory and immunosuppressive properties [
4,
7-
10]. MSCs also cross-talk with host tissues to enhance protective factors and the microenvironment, inducing the release of a range of cytokines and growth factors from those tissues [
4,
9]. We reported that hMSCs injected into the mouse hippocampus after ischemia improved the neurological symptom, and that hMSCs increased the recipient microglia/macrophage (MΦ) to alternatively activated M2 type (AAM) [
11], which are known to promote repair and regeneration after injury [
12]. We also determined by microarray analysis the implanted hMSC-suppressed interferon-related genes. Recently, we reanalyzed the microarray data and found that the expression of the gene for mouse pituitary adenylate cyclase-activating polypeptide (PACAP; gene:
Adcyap1) increased approximately ten fold in animals receiving hMSCs after ischemia compared with animals receiving the vehicle after ischemia, or hMSCs after sham-operation (see Additional file
1: Figure S1). However, no evidence has thus far been provided to demonstrate the involvement of neuropeptides in the neuroprotective properties exerted by hMSCs.
PACAP, which was first isolated from the ovine hypothalamus, belongs to the secretin/glucagon/vasoactive intestinal peptide (VIP) superfamily. PACAP exerts multiple functions through three specific receptors - PACAP receptor 1 (PAC1R) and two VIP/PACAP receptors [
13,
14]. Exogenous and endogenous PACAP decreases neuronal cell death after ischemia, SCI, and other neuronal disorders [
15-
20]. PACAP also contributes to suppress inflammatory/immune responses.
Adcyap1-deficient mice exhibited increased deterioration in an experimental model for multiple sclerosis [
21]. Severe combined immunodeficiency (SCID)-type immune-deficient mice showed decreased
Adcyap1 expression after facial nerve-crush.
Adcyap1-deficient mice also exhibited increased levels of proinflammatory cytokines such as IL-6, tumor necrosis factor α (TNFα), and interferon-γ (IFNγ) and decreased levels of interleukin-4 (IL-4) [
22]. Although a synergistic protective effect in response to co-treatment with hMSCs and PACAP after SCI has been reported [
17], no evidence has been shown that hMSCs regulate the expression of PACAP.
We hypothesized here that the anti-inflammatory effect of hMSCs in response to CNS damage could involve Adcyap1 regulation. We transplanted hMSCs into the spinal cord after a SCI in wild-type (WT) and Adcyap1
+/− mice and compared the determined neurological symptoms and mouse Adcyap1 and Adcyap1r1 (PAC1R gene) expression after SCI. Moreover, the effects of mouse- and human-specific cytokine gene expression to determine mechanisms underlying the anti-inflammatory action of hMSCs were also examined.
Methods
Animals
Wild-type C57BL/6 mice were purchased from Sankyo Lab Service Corporation (Tokyo, Japan).
Adcyap1
+/− mice on a C57BL/6 background were originally provided by Dr. Hashimoto of Osaka University [
23]. All mice were housed in the specific pathogen-free animal facility at Showa University and had free access to food and water. In all experiments, adult male mice (8 to 12 weeks old, weighing 17 to 25 g) were used. All experimental procedures involving animals were approved by the Institutional Animal Care and Use Committee of Showa University (#00168 and 01150).
SCI model
The SCI mouse model was produced according to our previous report [
24]. Anesthesia was induced in mice by inhalation of 4.0% sevoflurane and maintained with 3.0% sevoflurane. Under aseptic conditions, an incision was made along the midline of skin of the back, and the muscles, soft tissues, and yellow ligaments overlying the spinal column between T9 and T10 were removed. The intervertebral spinal cord between T9 and T10 was then transected with a thin-bladed razor (FEATHER, Osaka, Japan). After bleeding had stopped and coagulated blood was removed, the incision was closed and the animals were given 1.0-mL lactate Ringer’s solution (s.c., Otsuka, Tokyo, Japan) to avoid dehydration. Following recovery, foods were placed on the cage floor and the intake of the water bottle was lowered to allow for easy access. All mice were allowed to recover in a room maintained at 24°C ± 1°C during the experimental period. To support urination, the region of the lower abdomen in all mice was gently stimulated a few times a day.
Preparation of implanted hMSCs
Frozen vials of hMSCs from bone marrow were obtained from Dr. Prockop (The Center for the Preparation and Distribution of Adult Stem Cells (
http://medicine.tamhsc.edu/irm/msc-distribution.html)) under the auspices of a National Institutes of Health (NIH)/National Center for Research Resources grant (P40 RR 17 447-06). The experiments were performed with hMSCs from donor 281L [
11,
25]. To expand hMSCs, a frozen vial of 1.0 × 10
6 passage 3 cells was thawed and plated at 100 cells/cm
2 in multiple 150-mm plates (Nunclon, Thermo Fisher Scientific, Rochester, NY) with a 20-mL complete culture medium (CCM) that consisted of α-minimal essential medium (α-MEM; Invitrogen, Grand Island, NY), 20% heat-inactivated fetal bovine serum (FBS, Hyclone; Thermo Fisher Scientific), 100 units/mL penicillin, 100 μg/mL streptomycin (Invitrogen), and 2 mM L-glutamine (Invitrogen). The cultures were incubated, and the medium replaced every 3 days for approximately 8 days until cells were 70% to 80% confluent. The medium was then discarded, and the cultures plates were washed with PBS. Adherent cells were harvested with 0.25% trypsin and 1 mM EDTA (Invitrogen) for 5 min at 37°C and were resuspended at 5 × 10
5 cells in 0.5 μL of sterile Hank’s balanced salt solution (HBSS; Invitrogen) for injection. Unviable hMSCs were prepared by repeated freezing and thawing (three times) of aliquots of these cells.
PKH26-labeled hMSCs were prepared according to instructions provided with the PKH26 Red Fluorescent Cell Linker Kit (Sigma-Aldrich, St Louis, MO). In brief, harvested hMSCs (approximately 1 × 10
7 cells) were washed with α-MEM and centrifuged at 1,500 rpm for 7 min. The cells were then suspended for 3 min at 25°C in 1.0 mL of Diluent C with 1.0 mL of a PKH26 solution diluted 250-fold in Diluent C. Two mL of FBS was added to the suspension and incubated for 1 min at room temperature. A further 4.0 mL of CCM was added, and the suspension was centrifuged at 1,500 rpm for 6 min. After discarding the supernatant, the cells were washed three times with CCM and resuspended finally with HBSS at 5 × 10
5 cells/mL. In a preliminary study, we confirmed that the cell suspension showed greater red fluorescence (Ex 544, Em580-10) than naive hMSCs or HBSS (Additional file
2: Figure S2). The red fluorescence of the hMSCs was also confirmed with fluorescence immunocytochemistry with CD59 (BD Bioscience) or HuNu (Chemicon) antibodies (Additional file
2: Figure S2).
Injection of hMSCs into spinal cord
The day following surgery to invoke SCI, mice were reanesthetized by inhalation of 4.0% sevoflurane. The animals were placed face-down and a 29G-needle (HAMILTON, Reno, NV) with a 5.0-μL glass syringe (HAMILTON) was inserted directly into the intervertebral spinal cord between T10 and T11. hMSCs (5 × 10
5 cells/μL) or HBSS were infused at a rate of 0.5 μL/min with an Ultra Micro Pump (World Precision Instruments, Sarasota, FL). After infusion, the needle was left in place for 1 min to enable the solution to diffuse into the tissue. We have shown that the fate of hMSCs was not different between immunocompetent and immunodeficient animals after ischemia [
11]. Therefore, the present study did not use any immunosuppressant after cell implantation.
Assessment of locomotor function
Motor function after SCI was assessed by using an open-field behavior test that focused on hindlimb function according to the Basso Mouse Scale (BMS) [
26]. The BMS consists of an open-field locomotor rating scale, ranging from 0 (complete paralysis) to 9 (normal mobility). Briefly, individual mice were placed in the center of the open field (e.g., 50 × 50 cm
2) with a smooth, non-slip floor and monitored for 4 min. The hindlimb movements, trunk/tail stability, and forelimb-hindlimb coordination were assessed and graded. Mice were tested daily until post-operative (p.o.) day 7. Mice with peritoneal infection, hindlimb wounds, and/or tail or foot autophagia were excluded from the study. Scoring was done by randomly numbering the mice to ensure that the investigators were not aware of the treatment groups.
Measurement of injury volume
After anesthesia with sodium pentobarbital (50 mg/kg, i.p.), the animals were perfused transcardially on p.o. day 7 with 0.9% saline followed by 4% paraformaldehyde (PFA) in 50 mM phosphate buffer (pH 7.2) and the spinal cord removed (T7 to L1 vertebrae). Spinal cords were then post-fixed with 20% sucrose in 0.1 M phosphate buffer (pH 7.2) for two nights, and then embedded in an O.C.T. compound (Sakura Finetech, Tokyo, Japan) for subsequent preparation of frozen blocks. Five spinal cord sections (5-μm thickness) were obtained from each mouse: at the midline which included the central canal nearby to the core-injury site, and bilaterally at 30 μm and 60 μm lateral to the midline (total five sections from each mouse). The damaged area can be identified by glial fibrillary acidic protein (GFAP) immunostaining of the surrounding area, which is considered to be indicative of glial scarring [
24]. The frozen sections were washed with phosphate-buffered saline (PBS) and incubated in 0.3% H
2O
2. The sections were blocked with 2.5% normal horse serum (NHS) in PBS for 1 h at room temperature. Subsequently, the sections were incubated overnight with rabbit anti-GFAP antibody (1:10, DAKO, Glostrup, Denmark). The sections were washed with PBS and immersed with goat anti-rabbit IgG (1:200, Santa Cruz, Santa Cruz, CA) for 2 h. They were then incubated in an avidin-biotin complex solution (Vector, Burlingame, CA) followed by diaminobenzidine (DAB; Vector) as a chromogen. Control staining involved carrying out the same steps without the incubation with the primary antibody. The injury area consisting of GFAP-immunopositive cells was measured by DP2-BSW image analysis software (Olympus, Tokyo, Japan), and the estimated injury volume was calculated by integration of the injured areas.
Human Alu (hAlu) real-time PCR assays
Immediately following, and then at 7 and 14 days after injection of hMSCs, mice were anesthetized with sodium pentobarbital (50 mg/kg, i.p.) and the spinal cord was dissected. The tissue was snap frozen in liquid nitrogen and stored at −80°C until use. Genomic DNA was extracted (n = 4; DNeasy, Qiagen, Valencia, CA) and total DNA was assayed by UV absorbance. Real-time PCR was performed with 100 ng of target DNA, hAlu-specific primers, and a fluorescent probe (Model 7700; Applied Biosystems, Foster City, CA). The primers were as follows: Alu forward, 5′-CAT GGT GAA ACC CCG TCT CTA-3′; Alu reverse, 5′-GCC TCA GCC TCC CGA GTA G-3′; Probe, 5′-FAM-ATT AGC CGG GCG TGG TGG CG-TAMRA-3′. Standard curves were prepared by adding 1 × 102 to 1 × 106 hMSCs to samples of spinal cord from uninjured mice.
Multiple-immunostaining
Spinal cords (T7 to L1 segment) from immediately after the injection of hMSCs and on p.o. day 7 were obtained and frozen sections prepared as described above. Microscope slides containing attached hMSCs in culture were washed three times with HBSS, fixed with 4% PFA for 15 min, and immersed in PBS containing 0.1% Tween 20 (PBST).
Tissue sections or microscope slides were washed several times with PBST and incubated in 2.5% NHS/PBST for 1 h. Subsequently, the sections were incubated overnight with primary antibodies. The sections were then rinsed with PBST and immersed with appropriate fluorescently labeled secondary antibodies for 2 h. Control staining involved carrying out the same procedures but without the incubation with primary antibodies. The primary antibodies were used as follows: rabbit anti-β2-microglobulin (B2M, 1:1000; LifeSpan Biosciences, Seattle, WA), rabbit anti-PACAP (1:1000; Peninsula Laboratories, San Carlos, CA), and rabbit anti-type1 PACAP receptor (PAC1R, 1:400). The rabbit anti-PAC1R antibody was raised by using the N-terminal residue as an antigen [
15,
27]. The secondary antibody used was goat anti-rabbit Alexa 488 (1:400; Invitrogen). Some sections were stained with 4,6-Diamidine-2-phenylindole dihydrochloride (DAPI, 1:10,000; Roche, Manheim, Germany) to identify cell nuclei. Fluorescence was detected using an Axio Imager optical sectioning microscope with ApoTome (Carl Zeiss, Inc.; Oberkochen, Germany).
Isolation of RNA
Immediately after injection of hMSCs, or on p.o. days 3 or 7, mice were anesthetized with sodium pentobarbital (50 mg/kg, i.p.) and the spinal cord was dissected (T7 to L1 vertebrae). The excised tissue was snap frozen in liquid nitrogen and stored at −80°C until use. The total RNA was isolated from the cultured hMSCs or the spinal cord samples using the TRIZOL Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. In brief, cultured hMSCs (1 × 106 cells) or spinal cord tissue samples (40 mg) in 1.0 mL of TRIZOL Reagent were homogenized using a Dounce tissue grinder (WHEATON, Millville, NJ). Added to the homogenized samples was 0.2 mL of chloroform per 1 mL of TRIZOL Reagent. Following centrifugation, the aqueous phase (containing RNA) was separated from the mixture. Added to this aqueous phase was 0.5 mL of isopropyl alcohol per 1 mL of TRIZOL Reagent. After centrifugation, RNA precipitate was formed on the bottom of sample tube. The RNA precipitate was washed with 75% ethanol and dried completely at room temperature. The RNA was dissolved in RNase-free water. The purity and concentration of extracted RNA were determined spectrophotometrically (NanoDrop, Wilmington, DE). Extracted RNA was stored at −80°C until use.
Real-time PCR
cDNA was then synthesized with a TaKaRa PrimeScript RT reagent Kit (TaKaRa BIO Inc., Shiga, Japan), using 3 μg of the total RNA. The synthesized cDNA was made up to a volume of 30 μL with sterile distilled water. Real-time PCR was performed as previously reported by our group [
28], with minor modifications. Reverse transcription PCR (RT-PCR) for tumor necrosis factor α-induced protein 6 (TSG-6) was performed on a Taqman system [
29], while for the others, SYBR Green was used. All human- or mouse-specific primers and probes were designed as described in Table
1.
Table 1
Primers and probe to use for real-time PCR
PACAP |
Adcyap1
| mouse | AACCCGCTGCAAGACTTCTATGAC | TTAAGGATTTCGTGGGCGACA | Cyber green (TaKaRa) |
PAC1R |
Adcyap1r1
| mouse | GGCTGTGCTGAGGCTCTACTTTG | AGGATGATGATGATGCCGATGA |
IL-1β |
Il1b
| mouse | TCCAGGATGAGGACATGAGCAC | GAACGTCACACACCAGCAGGTTA |
TNFα |
Tnf
| mouse | GTTCTATGGCCCAGACCCTCAC | GGCACCACTAGTTGGTTGTCTTTG |
IL-10 |
Il10
| mouse | GACCAGCTGGACAACATACTGCTAA | GATAAGGCTTGGCAACCCAAGTAA |
TGFβ1 |
Tgfb1
| mouse | GTGTGGAGCAACATGTGGAACTCTA | TTGGTTCAGCCACTGCCGTA |
IL-4 |
Il4
| mouse | TCTCGAATGTACCAGGAGCCATATC | AGCACCTTGGAAGCCCTACAGA |
RPLP1 |
Rplp1
| mouse | TCCGAGCTCGCTTGCATCTA | CAGATGAGGCTCCCAATGTTGA |
PACAP |
ADCYAP1
| human | GTGAGGTAAGCAAGCTCCAACAGAC | CTCGATCTGATTGCTGGGTGAA | Cyber green (TaKaRa) |
PAC1R |
ADCYAPR1
| human | CTCACCACTGCCATGGTCATC | GCCCTCAGCATGAACGACAC |
NGF |
NGF
| human | AGCGTCCGGACCCAATAACA | CCTGCAGGGACATTGCTCTC |
BDNF |
BDNF
| human | GTCAAGTTGGGAGCCTGAAATAGTG | AGGATGCTGGTCCAAGTGGTG |
NT-3 |
NTF3
| human | GAAACGGTACGCGGAGCATAA | GTCGGTCACCCACAGACTCTCA |
IL-4 |
IL4
| human | AGCAGCTGATCCGATTCCTGA | TCCAACGTACTCTGGTTGGCTTC |
IL-10 |
IL10
| human | GAGATGCCTTCAGCAGAGTGAAGA | AGTTCACATGCGCCTTGATGTC |
TGFβ1 |
TGFB1
| human | GCGACTCGCCAGAGTGGTTA | GTTGATGTCCACTTGCAGTGTGTTA |
β2-microgloblin |
B2M
| human | CGGGCATTCCTGAAGCTGA | GGATGGATGAAACCCAGACACATAG |
TSG-6 |
TNFAIP6
| human | AAGCAGGGTCTGGCAAATACAAGC | ATCCATCCAGCAGCACAGACATGA | Taqman (Japan Bio Service) |
probe:FAM-TTTGAAGGCGGCCATCTCGCAACTT-TAMRA | |
Assay for arginase activity
Arginase is a marker for AAM, and its activity was measured according to our previous report [
24]. Briefly, spinal cord sections containing the T5 and L1 vertebrae from p.o. day 7 animals were removed. The tissues were homogenized with a lysis buffer (10 mM Tris-HCl (pH 7.4), 0.15 M NaCl and 1% Triton X-100, 1 mM ethylene glycol tetraacetic acid (EGTA), 50 mM NaF, 2 mM sodium orthovanadate, 10 mM sodium pyruvate, and protease inhibitor cocktail (Sigma-Aldrich)) and centrifuged at 800 ×
g for 10 min at 4°C, and the supernatant was collected. Protein concentration in the samples was determined using the BCA protein assay kit (Thermo Fisher Scientific).
The homogenate was mixed with an equal volume of pre-warmed 50 mM Tris-HCl, pH 7.5 containing 10 mM MnCl2 and incubated for 15 min at 55°C for activation. The mixture was then incubated in 0.25 M L-arginine for 60 min at 37°C to hydrolyze urea from L-arginine, and the reactions were stopped by adding Stop solution (H2SO4/H3PO4/H2O, 1:3:7). A 1% (final concentration) solution 1-phenyl-1,2-propanedione-2-oxime (ISPF, Wako, Tokyo, Japan) in ethanol was then added to the solution, which was heated at 100°C for 45 min. The reaction between urea and ISPF produced a pink color, and absorption was measured at 540 nm. Data are presented as specific activity (nmol/min/mg of protein).
Stimulation of hMSCs with IFNγ
hMSCs were plated at 2 × 105 cells/well in 6-well plates. The next day, the cells were washed twice with PBS (−) and incubated in an experimental medium (α-MEM supplemented with 1% FBS, 100 units/mL penicillin, 100 μg/mL streptomycin, and 2 mM L-glutamine). Then the cells (n = 3 plates for each phenotype) were exposed to a recombinant mouse IFNγ (10 ng/mL, PeproTech, Rocky Hill, NJ) or vehicle. Forty-eight hours later, the cells were collected and stored at −30°C until analysis.
Stimulation of MΦ-differentiated U937 with LPS and RNA isolation
Human monocyte-like cell line U937 was obtained from the RIKEN Cell Bank (Tsukuba, Japan). For routine maintenance, cells were cultured in RPMI 1640 medium (Invitrogen) supplemented with 10% FBS and 1.0% penicillin/streptomycin in 5% CO2 at 37°C in a humidified chamber. Cell concentrations were maintained between 2 × 105 and 2 × 106 cells/mL. For differentiation into MΦ, 5 × 105 cells were placed into the wells of a 12-well plate and treated with 20 nM phorbol myristate acetate (PMA, Sigma-Aldrich) for 24 h to induce the MΦ-like adherent phenotype. Subsequently, the medium was replaced with fresh RPMI 1640 medium and cells cultured for a further 48 h. PMA-induced U937 cells were stimulated with 0.1 μg/mL of lipopolysaccharide (LPS, Sigma-Aldrich) for 24 hours as a positive control.
RT-PCR for human PACAP and PAC1R
RT-PCR was performed as reported previously [
30]. Briefly, the total RNA was extracted from cell pellets (hMSCs, hMSCs stimulated with IFNγ, MΦ-like differentiated U937, MΦ-like differentiated U937 stimulated with LPS) by TRIZOL reagent (Invitrogen) according to the manufacturer’s instructions. The purity and concentration of extracted RNA were determined spectrophotometrically (NanoDrop, Wilmington, DE). The cDNA was then synthesized with an AffinifyScript QPCR cDNA Synthesis Kit (Stratagene, Agilent Technologies, La Jolla, CA), using 1 μg of the total RNA. The synthesized cDNA was made up to a volume of 50 μL with sterile water supplied with the kit. The reaction mixture contained 0.6 μL of the first-strand cDNA, 7 pmols of each primer set and 6.0 μL of the Emerald Amp PCR Master Mix (2X premix) (TaKaRa) in a total volume of 12 μL. The primers were as follows: hPACAP forward, 5′-GAAACAAATGGCTGTCAAGAAA-3′; hPACAP reverse, 5′- TCTGTGCATTCTCTAGTGCTTTG-3′; hPACAPR1forward, 5′-GTTACTTCGCTGTGGACTTCAA-3′; hPACAPR1 reverse, 5′-GGACCAGTACCAAAACAAGGAG-3′; hGAPDH forward, 5′-GGTGGTCTCCTCTGACTTCAAC-3′; hGAPDH reverse, 5′-GTCTACATGGCAACTGTGAGGA-3′. Thermal-cycling parameters were set as follows: 97°C for 5 min for an initial denaturation, then a cycling regime of 40 cycles at 95°C for 45 s, 60°C for 45 s, and 72°C for 1 min. At the end of the final cycle, an additional extension step was carried out for 10 min at 72°C. Three microliters of each reaction mixture were loaded for 1.6% agarose gel electrophoresis and bands were visualized with ethidium bromide.
Statistical analysis
Each mouse was assigned a random number, and all data were collected and analyzed without investigator knowledge of group identities. Data are expressed as mean ± SEM for in vivo experiments and as mean ± SD for in vitro experiments. Statistical comparisons were made by Student’s t-test for two groups and by one-way ANOVA following non-parametric multiple comparison as indicated in each figure legend. A value of P < 0.05 was considered to indicate statistical significance.
Discussions
We demonstrated here that when hMSCs were injected on p.o. day 1 into the spinal cord of WT mice, subsequent improvements were seen in various parameters which suggested to reduce SCI, but inviable hMSCs did not exert these effects. We observed also that these findings could not be reproduced in
Adcyap1
+/− mice. Because the retention of hMSCs was no different between the hMSC/WT and hMSC/
Adcyap1
+/− mice, we considered that the beneficial effect of hMSCs was due to cross-talk between the hMSCs and recipient tissues involving the action of PACAP. PACAP is a well-documented neuropeptide that suppresses cell death in ischemia, SCI, and other CNS disorders [
15-
17,
19-
21]. We previously demonstrated the exacerbation of cell death in
Adcyap1
+/− mice to compare with a WT mouse after ischemia and SCI [
15,
19]. In the present study, we however could not see significant difference in the neural damage in the HBSS-injected animals both for the WT and
Adcyap1
+/− mice. Therefore, it was considered that it may be only competing between an increase of the cell death in
Adcyap1
+/−
and suppression of the cell death by hMSCs. Then, we examined the expression of recipient mouse
Adcyap1 and
Adcyap1r1 in the spinal cord after implanted hMSCs and demonstrated clearly that hMSC transplantation exhibited an increase of mouse
Adcyap1. These findings strongly suggest that hMSCs may contribute to neuroprotection with PACAP induction.
To determine how hMSCs induced
Adcyap1 expression, we studied recipient mouse and donor hMSC gene expressions. So far, it is reported that PACAP has been induced by cyclic AMP, amyloid β-protein, CREB, progesterone, growth factors such as BDNF and NGF, and PACAP itself
in vitro and
in vivo experiments [
31,
32,
34]. The expression of
Adcyap1 might be also influenced by immune/inflammatory stimuli, in particular IL-4-related stimuli, given the decreased expression seen in SCID mice after nerve injury [
22]. In the present study, we observed that the hMSCs after transplantation increased growth factors such as NGF, BDNF, and NTF3. These have been suggested to increase Adcyap1 expression [
31,
32,
34] and are released from hMSCs after implantation [
35]. hMSCs increased an expression of anti-inflammatory cytokines such as
IL4 and
IL10, and
TGFB1 as well. Indeed, mouse
Il4 and an AAM marker, arginase activity, were greater in the hMSC/WT of the spinal cord. It also suggests that microenvironment PACAP expressions are produced in the spinal cord after hMSCs implantation.
We next investigated how hMSCs suppressed SCI and how PACAP associated the effect. Several studies including ours suggested that hMSCs modulated the inflammatory response in recipient tissues, in particular that of microglia/MΦ activation. Microglia/MΦ show different types of activation - CAM, AAM, and DAM - depending on the cytokine stimuli involved [
12,
24]. After hMSCs implantation, a mouse proinflammatory cytokine gene such as
Il1b and
Tnf is significantly suppressed, suggesting that hMSCs modulated CAM in the spinal cord. We have reported that a hMSC-mixed culture with mouse microglial cells under IFNγ stimuli decreased the level of nitric oxide in a hMSC-number-dependent fashion [
25]. We reported also that hMSCs increased the expression of
TNFAIP6 in the present study and the traumatic brain injury model [
33].
TNFAIP6 (also known as TSG-6) is a candidate factor to be involved in hMSCs’ anti-inflammation.
TNFAIP6 increased from hMSCs after the implantation in the cardiac infarction, global ischemia, and peritoneal inflammation [
11,
29,
36] and suppressed TNFα [
29,
36,
37]. Conversely, hMSC implantation increased both human and mouse IL-4 gene expression and arginase activity in the recipient tissue, suggesting that hMSCs increased AAM [
12,
38,
39] which consisted with global ischemia [
11]. It has been reported that hMSCs increased CAM mediated by IL-10 and transforming growth factor β (TGFβ) [
12] in a hippocampal organotypic culture [
40] and sepsis mouse [
10].
However, our observation showed a decrease in the
Il10 and
Tgfb1 expression, probably due to a decrease of proinflammatory cytokine. Like these, we suggest that hMSCs decreased CAM and inflammation and induced a resolution by AAM. Our results interestingly suggested that hMSCs modulated mouse cytokine profile at least via two different pathways: PACAP-dependent and PACAP-independent pathways.
Il1b,
Il4, and
Tgfb1, and part of
Tnf, were abolished in
Adcyap1
+/− mice, suggesting PACAP worked as a mediator between recipient tissue and donor hMSCs. On the other hand,
Il10 and most of
Tnf were independent with endogenous PACAP. We reported previously that
Il4 and AAM decreased in
Il1a- and
Il1b-deficient mice after SCI although the injury area was suppressed in the deficient mice. Like these, the cytokines form a complicated network during the disease [
24].
We hypothesized first that PACAP acts downstream of hMSCs and that it does not influence the human gene profile. However, our results indicated that the endogenous mouse PACAP might modulate the hMSCs’ function because hMSC/Adcyap1
+/− mice influenced human gene expression. For example, IL4 and TGFB1 were influenced by PACAP, whereas TNFAIP6 and IL10 were not the same as mice gene profiles. These indicated that recipient tissue communicated between hMSCs and PACAP or a factor mediated by PACAP. To the present time, no studies have reported that hMSCs express PAC1R. We firstly examined human ADCYAP1 or ADCYAP1R1 in the implanted spinal cord. However, we failed to detect the gene expression. Then, we examined the in vitro study and observed slight increases of them after IFNγ stimulation in vitro. This result suggests that hMSCs could express PAC1R in response to inflammatory conditions, thus enabling hMSCs to communicate with recipient tissues via autocrine and paracrine processes partially mediated by PAC1R. The contribution of human ADCYAP1 in vivo is still unclear because we could not detect human ADCYAP1 in the spinal cord. Using RNA interference or other techniques, we need to clarify how much human PACAP contributed to the communication. This synergistic cross-talk may enhance anti-inflammatory processes and give rise to an AAM environment. Further studies are needed to clarify the central player(s) in this communication and the complicated cytokine network.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
TT, HO, TA, and SS conceived and designed the experiments. TT, HO, DS, AS, TN, ZX, and KD performed the experiments. TT, HO, DS, JW, ZX, and KD analyzed and interpreted the data. HO, AS, YH, and SS supported finance. HH provided study materials. TT, HO, DS, and SS wrote the paper. All authors have read and approved the final version of the manuscript.