Background
The Rocio virus (ROCV), member of the Flaviviridae family with some well-known viruses, such as West Nile, dengue, yellow fever, and more recently Zika, is a single-stranded RNA virus that infects humans and other vertebrates. Infection with ROCV leads to a wide range of symptoms including, but not restrict to, the following: fever, headache, anorexia, nausea, vomiting, myalgia, and malaise. The pathology of this viral infection in humans ranges from asymptomatic to acute encephalitis [
1]. Previous studies from our group demonstrated that ROCV infects and induces in BALB/c mice damage of the central nervous system (CNS), characterized by neuronal degeneration and apoptosis with detectable levels of inflammatory cytokines and massive cellular infiltration [
2]. Moreover, cellular infiltration in CNS is highly dependent of the CCR-5/MIP-1α axis, since CCR5 and macrophage inflammatory protein 1 alpha (MIP-1α) knockout mice presented reduced inflammation with increased survival rates after ROCV infection [
3]. CNS cellular infiltration induced by ROCV infection is characterized by F4/80
+ cells, detected early as 4 days post-infection. At later points after infection, the CNS became infiltrated with NK, B cells, and especially T lymphocytes. Locally, these cells produce high amounts of interferon-gamma (IFN-γ) and tumor necrosis factor alpha (TNF-α), among other cytokines, which contribute to the degeneration and death of neurons with extensive tissue damage [
2].
Interleukin 33 (IL-33), a member of the IL-1 cytokine family, is constitutively expressed by tissue barrier cells such as the epithelial and endothelial cells of different body compartments. In addition, some innate immune cells such as macrophages and dendritic cells also express IL-33 [
4‐
6]. IL-33 is recognized as the functional ST2 receptor ligand, a heterodimer receptor complex consisting of ST2 and the IL-1 receptor accessory protein (IL-1RAcP) [
4]. ST2 cell surface expression is observed on T helper 2 (Th2) cells but not on T helper (Th1) cells; thus, it functions as an important effector molecule of T helper type 2 responses [
7]. ST2 activation signals through the myeloid differentiation primary response gene 88 (MyD88) and nuclear factor kappa b (NF-kB) pathway, inducing the production of several cytokines and chemokines. Moreover, ST2 activation causes cell differentiation, polarization, and activation, depending on the target cell [
5].
On viral and parasitic experimental infections, IL-33 plays a crucial role in the local immune response to several different pathogens [
8‐
11]. In fact, it has been reported that in mice, IL-33 is necessary for effective cluster of differentiation 8 (CD8
+) T cell responses to replicate lymphocytic choriomeningitis virus (LCMV), an RNA virus, and against murine γ-herpesvirus 68 (MHV-68), a DNA virus. Interestingly, recombinant IL-33 administration improved vaccine-induced CD8
+ T cell responses to vaccinia virus-based vectors and virus-like particles (VLPs) [
12]. Following infection with coxsackievirus B (CVB), mice deficient for T1/ST2 (IL-33R signaling) significantly developed more severe pancreatitis with greater weight loss and higher viral load compared with wild type [
8]. However, the role of IL-33 in the ROCV-induced host CNS-damage was not addressed yet. In human, rhinovirus infection induced asthma exacerbation dependent of IL-33 and the production of type 2 cytokines IL-4, IL-5, and IL-13. The authors state that IL-33 induction directly correlates with viral load and IL-5 and IL-13 levels, proposing IL-33 inhibition as a novel therapeutic approach for virus-induced asthma exacerbations [
13]. However, depending on the organ involved and the Th1/Th2 immune balance necessary to control the infection, IL-33 may also present opposing roles.
Herein, we are showing that the ST2 receptor is expressed in the CNS during experimental murine ROCV-induced encephalitis. The ST2 deficiency, by target disruption in BALB/c mice (T1/ST2−/−), led to impaired control of viral burden in the CNS, which was associated with an early cellular CNS infiltration and a Th1-polarized immune response with consequent increased expression of the cytokines TNF-α and IFN-γ, which in turn upregulates tissue inducible nitric oxide synthase (iNOS) expression. In the brain, the generation of reactive nitrogen species through iNOS induction could act by increasing the oxidative stress responsible for tissue injury, worsening the disease. In conclusion, our data suggest that IL-33 might play a crucial role in the pathogenesis of virus-induced encephalitis by controlling the local Th1/Th2 balance.
Discussion
Understanding the pathogenic mechanisms of viral infections in the CNS is critical to encephalitis treatment. Previous reports demonstrate that CNS IL-33 signaling is related to protection following experimental infection with
Toxoplasma gondii, and the authors found that IL-33 deficiency leads to increased parasite burden and pathology in the brains of infected mice [
17]. Here, in this study, we demonstrate that IL-33 has a protective role on experimental viral encephalitis. Our data supports previous studies in the literature demonstrating the contribution of IL-33 on T cell response modulation [
7,
18]. Here, the absence of ST2 (the receptor for IL-33) following the infection with an encephalitogenic virus leads to increased cellular-mediated immunopathology on mouse CNS.
Although the influenza A virus induced the production of IL-33 in alveolar macrophages and the activation of IL-13-producing natural helper cells and that after infection with coxsackievirus B, IL-33 in the pancreas is markedly elevated, data about the role of IL-33 signaling on viral infections are still scarce [
8,
19]. Even though the participation of IL-33 is well documented on several different pathologies and disease conditions, we are the first to demonstrate the protective role of IL-33 signaling on viral experimental encephalitis. We are showing that IL-33 is expressed on the CNS following infection with a neurotropic virus, balancing the local immune response with consequent protection from exacerbated CNS injury. In fact, among other CNS pathologies, Jiang et al. [
20] demonstrated that IL-33 administered after experimental autoimmune encephalomyelitis (EAE) onset could be protective against the disease and also that ST2
−/− mice developed exacerbated disease following EAE induction. Interestingly, recombinant IL-33 treatment attenuates EAE by suppression of IL-17 and interferon-gamma (IFN-γ)-producing cells [
20]. In addition, it was recently demonstrated that IL-33 is widely expressed on the healthy brain, especially by oligodendrocytes and gray matter astrocytes. Following CNS injury, induced by mechanical spinal cord contusion, IL-33 is immediately released acting on astrocytes and microglia to signal the production of chemokines that recruit monocytes and enhance M2 genes at the injury site involved in immunosuppression and tissue repair [
21]. Thus, it seems that IL-33 production in response to CNS injury could represent a protective mechanism. In our model, the protective role of IL-33 is directly related to the local T cell response modulation, since IL-33 deficiency leads to augmented Th1 local immune response, with IFN-γ overproduction and increased death following infection with ROCV. In fact, on viral infections, IFN-γ is important to virus clearance; however, exacerbated IFN-γ response could lead to tissue damage due to the extensive inflammation process, as observed in our results.
Given that IL-33 is characterized as a nuclear alarmin released after the cell is damaged, it is not surprising that a neurotropic virus such as ROCV could upregulate IL-33 production. ROCV infection induces degeneration and neuronal death, and apoptotic cells expressing caspase 3 (mainly neurons, lymphomononuclear and endothelial cells) were significantly increased across different CNS regions in later time points after ROCV infection. Viral antigens are usually detected on CNS after 4 days of infection [
2]. In our results, we detected IL-33 expression also in later time points, coinciding with the detection of virus replication in the CNS. However, virus replication itself may not be the only factor inducing cell damage in the CNS; we suggest that the extensive injury might actually be a consequence of the inflammation, characterized by waives of cellular infiltration and local cytokine production. In this scenario, IL-33 is important to drive the expression of Th2-type cytokines which in turn can protect the animals by downregulating the CNS Th2-type inflammatory response. On the other hand, Th2 cytokines might not have a direct role on viral clearance. In fact, on viral infections of the CNS, the immune responses implicated on viral clearance are usually cell specific, for example, antibody responses are important to neurons and the T cell-mediated immune responses are more important to virus clearance from glial cells [
22]. Upon ROCV infection, a mixed Th1/Th2 immune response is already documented [
2]. Thus, it is crucial to identify specific immune factors that participate in protective virus response. In our analyses, we demonstrate a critical protective role of IL-33 signaling on CNS immune responses. However, the precise mechanisms of IL-33 synthesis, localization, and release during CNS viral inflammation remain to be fully characterized. Although we indentify macrophages expressing higher levels of IL-33 after infection, we cannot exclude that other CNS resident cells such as glial cells and astrocytes could be the main source of IL-33 production. In fact, it is previously demonstrated that astrocytes secrete IL-33 after inflammatory stimulation with TNF-α in vitro and that damaged neurons actively secrete IL-33 following EAE [
23]. Moreover, it was recently demonstrated that dendritic cells can produce IL-33 after engagement of TLR4 and TLR5 receptors, and this leads to NF-kB activation and IL-33 expression following microbial stimulus [
24]. The authors testify that the dendritic cell IL-33 could amplify local inflammatory response through an autocrine mechanism. More recently, Kim et al. [
25] demonstrated that CD11c
hi dendritic cells act on CNS by controlling the activation and function of infiltrated monocytes. By selective deletion of CD11c
hi dendritic cells, the authors found increased viral copies on CNS and death following mice infection with Japanese encephalitis virus; further analysis leads to the conclusion that CD11c
hi-DC cells can regulate the activation of CD11b
+Ly-6C
hi monocytes controlling exacerbated CNS inflammation [
25]. In our study, the participation of dendritic cells was not addressed and further experiments are necessary to investigate the role of these cells on viral encephalitis.
Several different neurotropic viruses such as rabies virus (RABV), Japanese encephalitis virus (JEV), and West Nile virus (WNV) and more recently Zika virus present the potential to disrupt the blood brain barrier (BBB) and establish tissue damage [
26‐
28]. The pathogenic mechanisms that contribute to BBB disruption are diverse, and chemokines or inflammatory cytokines such as IFN-γ, IL-8, TNF-α, and IL-1β can indirectly contribute [
29]. In this context, IFN-γ has an important role. Following infection with JEV on the mouse, neutralization of IFN-γ ameliorated the enhancement of BBB permeability. However, the administration of IFN-γ-neutralizing antibody did not significantly change the viral load on CNS [
27]. Thus, it seems that IFN-γ production on CNS could act by breaking the BBB allowing or facilitating the infiltration and activation of resident cells such as microglia. Interestingly, microglia activation has been suggested to be responsible for the progression of neuronal damage-releasing neurotoxic factors such as TNF-α or nitric oxide (NO) [
30]. In conclusion, given that all these pro-inflammatory factors are cytotoxic to neurons, IL-33 signaling on CNS is crucial to balance the local inflammatory process by avoiding excessive pro-inflammatory cytokine production, protecting the neurons from extensive damage. In our model, we observed higher levels of both mediators: IFN-γ and NO, following infection of IL-33 signaling-deficient mouse (ST2
−/−) with ROCV. Thus, microglia overactivation through NO production could serve to enhance or amplify the neuronal damage induced by virus replication. Additionally, we observed a higher viral load on the CNS of ST2
−/− mice; this could be partly explained by the fact that the IL-33-deficient mouse presented higher frequencies of cellular infiltrates in the brain (providing more cells that can be infected). On the other hand, IL-33 signaling is necessary to generate effective CD8
+ T cell responses in viral and tumor metastatic models [
12,
31]. Thus, ineffective cytotoxic T cell lymphocyte (CTL) response (CTL) by the lack of IL-33 could favor ROCV replication in our model, although a more detailed study on CTL function could provide more solid data.
Numerous pathological conditions such as Alzheimer’s disease, Parkinson’s disease, and multiple sclerosis are well known to induce neurodegeneration [
32]. The mechanisms of neuroinflammation are dependent on glial cell activation, which releases a number of neurotoxic factors, especially nitric oxide species (NOS) and cytokines. In the CNS, the production of pro-inflammatory molecules results in apoptosis in various subsets of resident brain cells. Interestingly, NO has a neuroprotective effect at physiological levels; however, NO becomes harmful if it is produced in excess, leading to neuronal damage [
33]. Usually, iNOS expression in the CNS is very low and can be induced in astrocytes or microglial cells following events such as viral infection. In fact, it has been reported that in vitro infection of mouse macrophages with ROCV leads to NO production [
34]. Here, the induction of NO release by virus infection is highly amplified on the ST2
−/− mouse as a direct consequence of augmented Th1 response on the CNS. This was associated with the increased CNS infiltration of immune cells, particularly Th1 cells. Higher levels of IFN-γ can act by shifting infiltrating macrophages to the M1 phenotype, as evidenced by a higher expression of iNOS transcripts on infected mouse CNS. M1 macrophages are cytotoxic and exhibit pro-inflammatory markers, characterized by the production of pro-inflammatory cytokines and high levels of reactive oxygen and nitrogen species [
35]. Importantly, it was recently reported that the lack of IL-33 signaling in CNS results in lower levels of infiltrating neuroprotective M2 macrophages, which, in turn, leads to impaired recovery after CNS mechanical injury [
21]. Thus, here we provide evidence that following viral infection, IL-33 is produced in the CNS to counteract the deleterious effects of pro-inflammatory cytokines IFN-γ and TNF-α, as well to shift macrophage response to a M2-protective phenotype.
We previously demonstrated that ROCV infection results in increasing diffuse neuronal degeneration starting at 4 days post-infection, with positive caspase 3 glial and neuronal cells at 9 days post-infection [
2]. Nitric oxide production in the CNS is highly toxic to neurons. Thus, we hypothesized that NO release in the CNS could represent the most downstream event on IL-33 local response modulation. Another function of NO is to act as a negative regulator of immune cell trafficking to the CNS [
36]. It is very interesting that the macrophage from the M1 phenotype infiltrates injured CNS tissue via CCL2 signaling through adjacent spinal cord leptomeninges; on the other hand, M2 cells came from monocytes that trafficked through the brain-ventricular choroid plexus (CP), via the VCAM-1-VLA4 and CD73 mechanism [
37]. At the CP, NO inhibits NF-kB/p65 translocation to the nucleus and sequential leukocyte entry to the CNS [
36]. In our results, we observed higher cellular infiltrates in iNOS
−/−-infected mice (Additional file
1: Figure S5); however, iNOS deficiency results in increased survival rates following ROCV infection despite the higher pathological scores. Thus, taken together, our data support the idea that NO production in the CNS is the most neurotoxic product.
Methods
Virus
ROCV (SPH34675 strain) was used for mouse infection and kindly provided by Prof. Dr. Luiz Tadeu M. Figueiredo, Ribeirão Preto School of Medicine, University of São Paulo—Brazil. Virus stocks were obtained from the brains of intracerebrally infected suckling mice. Mouse brains were aspirated and macerated in phosphate-buffered saline (PBS) and centrifuged at 500
g for 10 min at 4 °C, and supernatants were collected and stored at −70 °C until use. Viral stocks were titrated by the plaque-forming unit (PFU) assay, as previously described [
38].
Animal experimentation
Wild-type BALB/c (WT), ST2-deficient (T1/ST2−/−), and Stat6-deficient (Stat6−/−) mice were infected by intraperitoneal route with different concentrations of ROCV stocks, as stated. C57/B6 wild type and iNOS−/− were infected by intraperitoneal route of ROCV. A mock control group (false infected) was inoculated with extracts from uninfected brain in PBS/albumin7.5 % by the same route, and volume as used for the virus infection The clinical score was monitored daily, and the animals were scored accordingly to the following: 0 normal mouse, no overt signs of disease; 1 limp tail or hind limb weakness; 2 limp tail and hind limb weakness; 3 partial hind limb paralysis; 4 complete hind limb paralysis; and 5 moribund state, death by encephalitis (sacrifice for ethical reasons). Survival was monitored daily up to 21 days. For tissue collection, the animals were sacrificed on different days post-infection (p.i.) as indicated and perfused and tissues samples were collected for analysis. A blood sample was collected to quantify the levels of serum cytokines by ELISA. The animals were housed at five per cage with food and water available ad libitum. All experiments were conducted in accordance with the prescribed guidelines on experimental animal welfare of the National Institutes of Health and were approved by the Ethics Committee of the Ribeirão Preto Medical School, University of São Paulo.
Histopathological analysis and CNS histologic scores
Histologic scores were performed in the CNS of infected and control mice at 9 days post-infection. Briefly, animals were euthanized and perfused, and brain tissue was removed and fixed in 10 % formaldehyde. Tissues were dehydrated in graded ethanol and embedded in a 100 % paraffin block. Serial sections with 5-μm thickness were prepared and stained with hematoxylin and eosin. Five to six photos were obtained for each animal. The extent of meningeal inflammation was assessed and graded as follows: 0, no inflammation (total absence of inflammatory cells at the meninges area); 1, one cell layer of inflammation (a single layer of infiltrating cells at the meninges); 2, two cell layers of inflammation (two cell layers at the meninges area); 3, three cell layers of inflammation; 4, four cell layers; and 5, five or more cell layers of inflammation. The area with the maximal extent of tissue damage was used for the assessment of each brain region.
Clinical scores
The clinical score was assessed daily as described by Miller et al. [
39]. Briefly, the following grades were considered: 0 normal mouse, no signs of disease; 1 limp tail or hind limb weakness (but not both); 2 limp tail and hind limb weakness (both symptoms manifestation); 3 partial hind limb paralysis; 4 complete hind limb paralysis; and 5 moribund state (euthanasia performed for ethical issues).
Tissue quantification of cytokine mRNAs and viral load
Total RNA from brain samples (approximately 100 mg from each animal time point) was extracted with the TRIzol Reagent (Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions. After extraction, RNA was quantified by absorbance at 260 nm and approximately 1 μg of each sample was used to obtain the complementary DNA (cDNA) strands using the SuperScript III enzyme (Life Technologies) and Oligo(dT)12-18 for first strand synthesis, according to the manufacturer’s instruction. Real-time polymerase chain reaction (PCR) analysis of cytokine mRNA profiles was performed with the Power SYBR® Green Master Mix kit (Applied Biosystems, CA, USA), and reactions were processed in ABI7500 equipment (Applied Biosystems). The results were analyzed on the basis of the cycle threshold (Ct) of target genes, and the level of expression was calculated by comparing to an endogenous control gene (β-actin) using the ΔΔCt method (relative amount of target gene for each sample is quantified by the equation 2
−ΔΔCt); data were analyzed with the comparative Ct method. The reactions were carried out in a final volume of 25 μl containing 12.5 μl of SYBR Green PCR Master Mix, 0.5 μM of each primer (designed on the basis of the mRNA sequence of the cytokine genes), and 5 μl of cDNA. RT-PCR cycles were 95 °C for 15 s and 60 °C for 1 min, and the dissociation curve was constructed by increasing temperatures from 60 to 90 °C. Viral copies were determined by qPCR, as described above. A standard curve from a previous established virus stock was serially diluted to construct a standard curve, and viral copies were determined from each sample analyzed; results were expressed as viral copies in the brain per 100 mg/tissue. Primers used for cytokine quantification are listed in Table
1.
Table 1
Primers used for gene expression analysis
IFN-γ | F: ATCAGGAGGGACTCCTTTTCCGCTT |
R: GAAGCCTAGAAAGTCTGAATAACT |
IL-17A | F: GGTCAACCTCAAGTCTTTAACTC |
R: TTAAAAATGCAAGTAAGTTTGCTG |
TNF-α | F: ACCAGCTAAGAGGGAGAGAAGCAA |
R: TCAGTGCTCATGGTGTCCTTTCCA |
IL-33 | F: TCCTTGCTTGGCAGTATCCA |
R: TGCTCAATGTGTCAACAGACG |
ST2L | F: CATGGCATGATAAGGCACAC |
R: GTAGAGCTTGCCATCGTTCC |
iNOS | F: CAGTTCCGAGCGTCAAAGACCTGC |
R: CAGCCCAACAATACAATACAAGATG |
arg1 | F: GTTCCCAGATGTACCAGGATTC |
R: CGATGTCTTTGGCAGATATGC |
IL-4 | F: GAATGTACCAGGAGCCATATC |
R: CTCAGTACTACGAGTAATCCA |
β-actin | F: AGCTGCGTTTTACACCCTTT |
R: AAGCCATGCCAATGTTGTCT |
ROCV—SPH34675—NS5 | F: GGTCAATGCCACAAGCCAAG |
R: CTTCAGCCTTTCGATCCGGT |
Viral titration
Viral stocks were titrated by the PFU assay. Briefly, Vero cells were cultivated in 24-well plates, and cell-confluent monolayers were infected with 100 μl of serial dilutions of the viral stocks. Next, the cells were incubated for 1.5 h at 37 °C and washed with PBS, and an overlay consisting of DMEM containing 2 % fetal bovine serum and 3 % carboxymethylcellulose was added to the wells. The cells were then incubated for 7 days at 37 °C/5 %CO2. After this period of incubation, the overlay was discarded and the cells were washed with PBS and stained with 0.5 % Neutral Red solution. The viral titer was based on the number of plaques present in the highest dilution.
Cytokine quantification ELISA
Serum samples were used to quantify the levels of IFN-γ and TNF-α using commercial kits (R&D Systems, Abingdon, UK). ELISA was performed by coating 96-well polystyrene microtiter plates with the specific antibody. After blocking, standards and samples were and the plates were incubated overnight at 4 °C. A specific biotinylated antibody was added to all wells and incubated for 1 h at room temperature. The plates were washed and incubated for 30 min with horseradish peroxidase-conjugated streptavidin. 3-3′,5,5′-tetramethylbenzidine (TMB) substrate reagent solution (Sigma-Aldrich) was added to the wells. Absorbance was read at 450 nm.
Flow cytometry
Mice were perfused with PBS before the brains were harvested. Brain tissues were pretreated with 2 μg/ml collagenase D and 1 μg/ml DNAse I (both Roche Diagnostics), and total cells were isolated by cell straining (100-μm mesh). Brain homogenates were separated into neuronal and leukocyte populations by discontinuous density gradient centrifugation using isotonic Percoll (GE HealthCare, Uppsala, Sweden) as described by Pino and Cardona [
40]. After isolation, cells were stimulated in vitro with PMA and Ionomycin plus BD GolgiStop™ (BD Biosciences, San Jose, CA, USA) for at least 4 h at 37 °C. After stimulation, the cells were fixed with BD Cytofix/Cytoperm™ Plus Fixation/Permeabilization Kit and intracellular staining was carried out following the manufacturer’s instructions (BD Biosciences). Flow cytometry was performed using a FACS Verse (BD Biosciences) with the specific antibodies listed: anti-CD45 clone A20, anti-CD4 clone GK1.5, CD8α clone 5H10-1, IFN-γ clone XMG1.2, TNF-α clone MP6-XT22, CD3 clone 17A2, IL-10 clone JES5-16E3, F4/80 clone BM8 (all from BioLegend Inc., San Diego, CA, USA), IL-33 clone 396118 (R&D Systems, Minneapolis, MN, USA), and anti-iNOS (NOS2) clone N-20 (Santa Cruz Biotechnology, San Diego, CA, USA).
Statistical analysis
The data are reported as the means ± SEM. Student’s t test was used to test for statistical significance of the differences between the different group parameters. p values of less than 0.05 were considered statistically significant. When necessary, statistical analysis was performed by either one-way ANOVA or two-way ANOVA with Bonferroni post-test as stated on figure legends.
Abbreviations
BBB, blood brain barrier; CCL2, chemokine (C-C motif) ligand 2; CCR5 C-C, chemokine receptor type 5; CD11b, cluster of differentiation 11b; CD11c, cluster of differentiation 11c; CD3, cluster of differentiation 3; CD4+, cluster of differentiation 4; CD45+ cluster of differentiation 45; CD73, cluster of differentiation 73; CD8+, cluster of differentiation 8; cDNA, complementary DNA; CNS, central nervous system; CP, choroid plexus; CTL, cytotoxic T lymphocyte; DMEM, Dulbecco’s minimal essential media; EAE, experimental autoimmune encephalomyelitis; ELISA, enzyme-linked immunosorbent assay; FACS, fluorescent-activated cell sorting; IFN-γ, interferon-gamma; IL-10, interleukin 10; IL-13, interleukin 13; IL-17A, interleukin 17A; IL-1β, interleukin 1 beta; IL-33, interleukin 33; IL-4, interleukin 4; IL-5, interleukin 5; IL-8, interleukin 8; iNOS, inducible nitric oxide synthase; JEV, Japanese encephalitis virus; Ly-6C, lymphocyte antigen 6 complex; MIP-1α, macrophage inflammatory protein 1 alpha; mRNA, messenger ribonucleic acid; MyD88, myeloid differentiation primary response gene 88; NF-kB, nuclear factor kappa b; NO, nitric oxide; p.i., post-infection; PBS, phosphate-buffered saline; PCR, polymerase chain reaction; PFU, plaque forming unit; qPCR, quantitative polymerase chain reaction; RABV, rabies virus; RNA, ribonucleic acid; ROCV, Rocio virus; RT-PCR, reverse-transcription polymerase chain reaction; Th1, T helper 1; Th2, T helper 2; TNF-α, tumor necrosis factor alpha; VCAM-1, vascular cell adhesion protein 1; VLA-4, very late antigen 4; WNV, West Nile virus; WT, wild type.