INTRODUCTION
Osteoarthritis (OA) is an underlying cause of disability and the most frequently occurring degenerative joint disease [
1]. Synovial inflammation, including cytokine secretion and inflammatory cell infiltration (primarily macrophages), is one of the characteristic pathological hallmarks of OA [
2‐
5]. There has been increasing evidence from ongoing research that fibroblast-like synoviocytes (FLSs) are vital to the pathogenesis of OA. The synovial membrane, which is important for maintaining the intra-articular environment, can generate synovial fluid to maintain joint activity. The synovial membrane is also one of the major sources of intra-articular inflammation and can sustain and even worsen the prognosis of OA by synthesizing proinflammatory cytokines, such as interleukins (ILs) and tumor necrosis factors (TNFs) [
6‐
8]. IL-1β, IL-6, and TNF-α have been reported as the major proinflammatory cytokines participating in the pathophysiology of OA. The synergistic effects of these three cytokines can facilitate OA [
2,
3,
9,
10]. Along with FLSs, macrophages also act as crucial components in synovial tissues that participate in OA pathogenesis. Indeed, the degree of macrophage infiltration is a characteristic of OA and is positively correlated with disease severity [
4,
5]. Thus, synovial inflammation has attracted substantial attention because of its potential as a therapeutic target and its involvement in OA pathogenesis. It is known that the occurrence and development of OA are closely associated with numerous cell signaling pathways. The classical nuclear factor-kappa B (NF-ĸB) signaling pathway has been reported to be crucial for inducing the expression of various proinflammatory cytokines (
e.g., IL-1β, IL-6, and TNF-α) and is considered a potential target in OA progression. Interestingly, these downstream cytokines (
e.g., IL-1β, IL-6, and TNF-α) are also important inducers of NF-ĸB signaling. As a result, this process could form a positive feedback loop to accelerate OA progression [
2,
11,
12]. Moreover, proinflammatory cytokines induced by the NF-ĸB signaling pathway (
e.g., IL-1, IL-6, and TNF-α) could lead to matrix metalloproteinase (MMP) production, causing articular cartilage breakdown and bone resorption in OA progression. Among the MMP family members, MMP-13 and MMP-9 have been reported to be vital for OA progression [
13,
14]. Thus, the potential role of the NF-ĸB signaling pathway and the targets of inflammatory responses in FLSs were explored in this study.
Recent studies have suggested that metabolic syndrome is closely associated with OA. Indeed, clinical studies have verified that type 2 diabetes mellitus (T2DM), an independent risk factor for OA, is closely associated with the pathological mechanism of OA [
15,
16]. Abnormal insulin secretion is a critical characteristic of the early stages of T2DM, and T2DM manifests primarily as hyperinsulinemia (HINS) and insulin resistance. Increased insulin levels can lead to a wide range of effects on metabolism, including increased OA-related proinflammatory cytokine (such as ILs, TNF-α, MMP-13) levels [
16‐
19]. Furthermore, by preventing chondrocyte maturation and inducing cartilage degeneration, insulin can aggravate the pathological variations of OA [
19,
20].
Autophagy, a critical process for maintaining homeostasis, can significantly inhibit inflammation and inflammatory disease progression (
e.g., OA) [
21‐
23]. There has been increasing evidence that autophagy deregulation, especially autophagy inhibition, is closely associated with the pathogenesis of OA [
23‐
25]. In the process of autophagy, microtubule-associated protein 1 light chain 3 I (LC3I) is converted to microtubule-associated protein 1 light chain 3 II (LC3II) in autophagosomes. Thus, the expression level of LC3II, an autophagosome-specific marker protein, reflects the number of autophagosomes and thus the autophagy activity [
26,
27]. Although the signaling regulators involved in autophagy are sophisticated, the PI3K/Akt/mTOR pathway has been well accepted as a basic intracellular signaling pathway, and it can inhibit autophagy when activated in OA progression [
28,
29]. Moreover, the PI3K/Akt/mTOR pathway has long been considered as the key signaling pathways in cell growth and survival, and the activating factors of this pathway include insulin [
30,
31]. In addition, a previous study successfully showed that insulin can exacerbate cartilage degeneration and facilitate OA progression by inhibiting autophagy through the mTOR pathway [
20]. Based on the above-mentioned analysis, this study aimed to analyze the inhibitory effect of the PI3K/AKT/mTOR signaling pathway on autophagy and inflammatory responses in FLSs.
The independent effects of high insulin on the biological behavior of FLSs (e.g., proliferation, autophagy, chemotactic effect on macrophages, and inflammatory activity) have never been studied in the literature. This study aimed to explore whether a potential link may exist between T2DM and OA to gain insight into the pathogenesis of OA and introduce new ideas for the clinical management of this disease.
MATERIALS AND METHODS
Synovial Tissue Collection
Synovial tissues were collected from patients with OA during knee joint replacement surgery (n = 39; 14 males and 25 females, aged 52 to 79 years old, mean age 63 years old). All patients satisfied the American College of Rheumatology (ACR) diagnostic criteria for OA. Informed consent was obtained from all individual participants included in the study. All experimental procedures for the use of human samples in this study were approved by the Ethics Committee of Shandong Provincial Hospital Affiliated to Shandong University (NO. 2017-53).
Cell Culture
OA synovial tissues were macerated, chopped, and then incubated with type II collagenase (1 mg/ml, Sigma) in Dulbecco’s modified Eagle’s medium (DMEM, HyClone, Thermo Scientific) for 6 h at 37 °C and 5% CO2 (Thermo Scientific). The tissues were treated with 0.25% trypsin (Solabio) diluted in a phosphate-buffered saline (PBS) solution at a volume equivalent to that of DMEM. The cells were filtered; incubated overnight in DMEM supplemented with 10% fetal bovine serum (FBS, HyClone, Thermo Scientific), penicillin (100 IU/ml), and streptomycin (100 μg/ml, Gibco); and passaged three times. FLSs at passages 4–6 were used for our study.
Stimulation Assays
FLSs were plated on 6-well plates ( 3-5× 105 cells/well) or 24-well plates (8× 104 cells/well) in high glucose DMEM containing 10% or 2% FBS. Insulin (0, 100, 200, or 500 nM; Sigma-Aldrich, St. Louis, MO, USA; I0516) or inflammatory stimulators, including IL-1β, IL-6, and TNF-α (0, 0.01, 0.1, 1, 10, or 50 ng/ml), were added and then incubated for the indicated times. PBS was used as a control. PDTC (an NF-ĸB inhibitor; MCE, USA), LY294002 (a PI3K/Akt inhibitor; MCE, USA), and rapamycin (an mTOR inhibitor; MCE, USA) were used to block the signaling pathways, and an equal amount of inhibitor solvent (0.1% DMSO, 99.9% corn oil) was used as a control.
Cell Counting Kit-8
Cell suspensions were seeded on a 96-well plate at 1000 cells/well. Next, the cells were shaken, incubated for 4 to 6 h in a 37 °C incubator until they adhered, and incubated with insulin (0, 100, 200, or 500 nM) and with or without each of the inhibitors (LY294002 or rapamycin [10 μM]). The control group received the same amount of solvent. After 24 h or 48 h, 100 μl of CCK-8 reagent was added to each well, shaken, and subsequently incubated for 2 h. Afterward, the absorbance at 450 nm was measured with a microplate reader.
Transwell
According to the source of the supernatant in the lower chamber, the experiments were divided into four groups: the control (N) group, the insulin (ISN)-mediated group (INS group), the fibroblast-like synoviocyte (FLS)-mediated group (FLS group), and the INS- and FLS-mediated group (INS+FLS group). When the FLSs in the 24-well plate reached 80% confluence, the DMEM was replaced with fresh DMEM or with DMEM containing a high INS concentration (500 nM). After 24 h, 1000 μl of the supernatant from each FLS-plated well under different stimulation conditions (DMEM with or without 500 nM INS) was aspirated and mixed well, and then 600 μl of it was added to a lower Transwell chamber (FLS and INS+FLS groups). The supernatant for the control group was 600 μl of DMEM, and the supernatant for the INS group was 600 μl of DMEM with 500 nM INS; these supernatants were placed in other lower Transwell chambers (N and INS groups) to start the experiments. When FLSs in a 24-well plate reached 80% confluence, insulin (500 nM) was added for 24 h. Then, 600 μl of the supernatant was aspirated and added to the lower Transwell chamber. After macrophage digestion, a cell suspension was prepared with DMEM/F12 medium, and 200 μl was added to the upper Transwell chamber. Next, the cells were incubated overnight, and the cells that did not migrate were wiped away with a cotton swab. Then, the cells in the lower chamber were stained with hematoxylin for 10 min at ambient temperature. The number of migrated cells was examined using a cell counter with microscopic imaging system.
Reverse Transcription-Quantitative Polymerase Chain Reaction
FLSs were plated in 24-well plates and cultured in the presence of insulin (0, 100, 200, or 500 nM), the inflammatory stimulators IL-1β, IL-6, and TNF-α (0, 0.01, 0.1, 1, 10, or 50 ng/ml), or different signaling inhibitors (PDTC, LY294002, or rapamycin); then, the cells were analyzed 6, 12, or 24 h after treatment. Total RNA was extracted from FLSs using TRIzol reagent (Invitrogen) and reverse-transcribed using a ReverTra Ace qPCR RT kit (Toyobo, Japan) following the manufacturer’s protocol. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was performed using a LightCycler 480 (Roche, Basel, Switzerland) according to the following protocol: denaturation at 95 °C for 10 min, 40 cycles of denaturation at 95 °C for 10 s, annealing at 60 °C for 1 min, and extension at 72 °C for 1 s. The primers for RT-qPCR were designed according to the consensus sequences by Oligo. GAPDH was used as an internal loading control. The forward and reverse primers are listed in Table
1, and all primers were created by BGI (Beijing, China). To measure the relative messenger RNA (mRNA) levels, the 2-ΔΔ cycle threshold (2-ΔΔCT) method was used.
Table 1
Primers used for real-time polymerase chain reaction
GAPDH | Forward:CACCATCTTCCAGGAGC Reverse:AGTGGACTCCACGACGTA |
IL-1β | Forward:CTAAAGTATGGGCTGGACTG Reverse:AGCTTCAATGAAAGACCTCA |
IL-6 | Forward:ACTCACCTCTTCAGAACGAATTG Reverse:CCATCTTTGGAAGGTTCAGGTTG |
TNFα | Forward:TGTCTACTGAACTTCGGGGT Reverse:TCACAGAGCAATGACTCCAA |
MMP-9 | Forward:TTGACAGCGACAAGAAGTGG Reverse:GCCATTCACGTCGTCCTTAT |
MMP-13 | Forward:CGCGTCATGCCAGCAAATTCCATT Reverse:TCCATGTGTCCCATTTGTGGTGTG |
IL1R1 | Forward:TTCCTGCTAAGGTGGAGGATTC Reverse:GCTCATTCTCCACAAATTTTGC |
IL1R3 | Forward:CTCAGAACGCTGCGATGACT Reverse:CGGTCCTGCCTAGTCCAATAC |
IL6R | Forward:TCTGGAAACTATTCATGCTACCG Reverse:ACTCACAAACAACATTGCTGAGG |
GP130 | Forward:TCTGGAAACTATTCATGCTACCG Reverse:ACTCACAAACAACATTGCTGAGG |
TNFR1 | Forward:AGGAGAAACAGAACACCGTGTG Reverse:CCCTTAACATTCTCAATCTGGG |
TNFR2 | Forward:GACTTCATCCACGGATATTTGC Reverse:ACACTGGCTGGGGTAAGTGTAC |
Enzyme-Linked Immunosorbent Assay
Cells were cultured and then stimulated as described above, and the supernatants were collected at 6 h, 12 h, or 24 h. The release of proinflammatory cytokines (IL-1β, IL-6, and TNF-α), matrix metalloproteinases (MMP-9 and MMP-13), and chemokines (CXCL12, CCL2/MCP-1, and CCL5/RANTES) was analyzed using enzyme-linked immunosorbent assay (ELISA) kits (Multi Sciences, Hang Zhou, China) following the manufacturer’s instructions.
Western Blotting
Whole cell lysates were separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred onto a polyvinylidene difluoride membrane (Merck Millipore, Darmstadt, Germany). Western blotting was performed using anti-LC3I (1:1000, Abcam, USA), anti-LC3II (1:1000, Abcam, USA), anti-PI3K (1:1000, CST), anti-phospho-PI3K (1:500, CST), anti-Akt (1:3000, CST), anti-phospho-Akt (1:1000, CST), anti-mTOR (1:3000, CST), anti-phospho-mTOR (1:1000, CST), anti-phospho-p50 NF-ĸB (1:1000, CST), p50 NF-ĸB (1:2000, CST), anti-phospho-p65 NF-ĸB (1:1000, CST), and anti-p65 NF-ĸB (1:2000, CST) antibodies. GAPDH (1:10000, Abcam, USA) was used as a loading control for proteins. The band intensities were analyzed using an ECL Plus detection system (Thermo Scientific, Pittsburgh, PA, USA).
Immunofluorescence
FLSs were grown in 6-well plates with high insulin stimulation (500 nM) for 24 h. Preconditioned cells were washed slowly three times with PBS for 5 min each, fixed with 4% paraformaldehyde for 30 min, washed three times with PBS (5 min each), and then treated with 5% bovine serum albumin (BSA) for 1 h. The cells were then incubated with anti-p50 (1:100 dilution) and anti-p65 (1:150 dilution) antibodies at 4 °C overnight. After the cells were washed slowly three times with PBS for 5 min each, FITC- and TRITC-conjugated secondary antibodies were used to visualize the proteins under a fluorescence microscope (Olympus, Tokyo, Japan). Nuclei were counterstained with 4′,6′-diamidino-2-phenylindole (DAPI).
Statistical Analysis
Statistical analysis was conducted using the GraphPad Prism 5 software package (La Jolla, CA, USA). A t test was used to assess significant differences between two groups. The results of three different experiments are expressed as the mean ± SEM. Differences in the results with P < 0.05 were considered statistically significant.
DISCUSSION
In this study, we first discovered that insulin can promote synovial inflammation in the progression of osteoarthritis, either alone or in conjunction with inflammatory factors. First, insulin can significantly promote the inflammatory phenotype of FLSs, increase cell viability and inflammatory cytokine production, promote chemokine production, and enhance macrophage chemotaxis. Second, insulin can activate the PI3K/mTOR/Akt/NF-ĸB signaling pathway and simultaneously inhibit autophagy in FLSs. Third, our data suggest that the insulin-induced inflammatory responses are significantly reduced by preblocking three signaling pathways with specific pathway inhibitors in FLSs. Finally, the data show that insulin can upregulate inflammatory cytokine receptor levels in FLSs, and PI3K/mTOR/Akt/NF-ĸB signaling inhibitors can reverse this process. More importantly, insulin has a sensitizing effect on inflammatory factor–mediated synovial inflammation (including MMP production and intracellular signaling pathway activation). Taken together, these data suggest that insulin may exacerbate synovial inflammatory lesions and thus contribute to the progression of OA.
Recent studies have demonstrated a close relationship between the pathogenesis of OA and metabolic syndrome based on insulin resistance and hyperinsulinemia [
15,
16]. Nicola et al. found a positive correlation between T2DM, characterized by hyperinsulinemia, and the development of OA [
16]. Previous study suggested that insulin could promote the production of various proinflammatory factors (such as ILs, TNF-α, MMP-13) associated with OA [
16‐
19]. In addition, insulin can inhibit chondrocyte maturation and promote cartilage degradation
in vitro, thus aggravating the pathological changes of OA [
19,
20]. Synovial tissues, especially FLSs, have been shown to play a vital role in the development of OA [
4‐
7]. However, until now, the effect of insulin on fibroblast synovial inflammation in OA was unclear. In this study, we found that insulin could exacerbate the inflammatory phenotype of OA FLSs. Thus, we hypothesized that insulin could promote OA progression through regulating the biological activity of various cell types.
Previous study showed that the PI3K/AKT and mTOR signaling pathways are implicated in the pathophysiological effects of insulin in OA [
19,
40,
41]. NF-ĸB determines the expression of inflammatory factors and MMPs in the joints and is considered to play a very important role in the pathogenesis of OA [
2,
11‐
14]. This study found that insulin can aggravate the inflammatory phenotype of fibroblast synovial cells by activating the PI3K/mTOR/Akt/NF-ĸB signaling pathways. Our results confirm previous research that the PI3K/mTOR/Akt/NF-ĸB pathway was involved in the proinflammatory effects of insulin towards FLSs. The production of inflammatory factors and activation of signaling pathways in OA FLSs were enhanced with the stimulation of insulin in combination with other proinflammatory factors, such as IL-1β, IL-6, and TNF-α, further supporting these findings. These results indicate that insulin can do more than promote synovial inflammatory lesions alone; it can also work synergistically with inflammatory factors, participate in and activate the positive feedback loop between inflammatory factors and signal pathways, and further amplify the synovial inflammation cascade.
Autophagy is an important cellular process that maintains homeostasis and is involved in the pathogenesis of many inflammatory diseases. Notably, autophagy inhibition is closely related to the pathogenesis of OA [
25]. Studies by Ribeiro et al. [
19] have shown that insulin can lead to proteoglycan component loss and inflammatory cytokine and MMP increases in chondrocytes, and these effects may be achieved by inhibiting chondrocyte autophagy. In addition, the clinical data of this study showed that autophagy decreased in the knee cartilage of diabetic patients compared with non-diabetic patients; namely, the expression of the autophagy-related protein LC3II decreased significantly. Notably, this study revealed that rapamycin, as an autophagy activator (also an mTOR signaling pathway inhibitor), can prevent insulin-mediated reductions in autophagy and cartilage degradation [
19]. Our results showed that high insulin could also aggravate the inflammatory responses of FLSs by coordinating the autophagy process. These facts indicate that insulin was also related to autophagy in the pathogenesis of OA and provide a mechanistic basis for the role of insulin in OA.
Previous studies have suggested that the biological effects of insulin differs in a dose- and cell-specific manner [
19,
20,
40‐
46]. In addition to the effects on FLSs shown in this study, chondrocytes were also found to be affected by insulin [
19,
20,
40‐
43]. However, insulin has been reported to play either an inductive or inhibitory role in chondrocyte differentiation [
20,
43] and consequently ameliorate or impair cartilage degeneration [
19,
42] at different concentrations. Furthermore, at the molecular level, the influence in which insulin exerts differed greatly as its concentration is extremely high or low [
40,
45,
46]. Rosa et al. [
40] found that low and supraphysiological insulin levels exert different effects on aggrecan and proteoglycan synthesis in chondrocytes, which may be due to different receptors for insulin. Moreover, Mirdamadi [
45] et al. found that high insulin (1 μM) reduced the FoxO transcriptional activity, while low insulin (0.1 μM) reduced the FoxO transcriptional activity of SZ95 sebocytes
in vitro. Studies by Kubota et al. [
46] showed that insulin selectively regulates specific downstream responses of the Akt pathway in a dose-dependent manner. Thus, we concluded that different mechanisms of insulin action were associated with different insulin concentrations, which may modulate the cellular response. Previous studies have shown that specific cellular responses could be achieved only after treatment with high concentrations of insulin [
47‐
54]. Consistently, our data showed that insulin’s effects on FLSs, which were exerted in a concentration-dependent manner, were more obvious as the concentration of insulin is super physiological. Taken together with these studies, it is obvious that different effector cells involved in the complex pathophysiologic process of various diseases have different sensitivities to insulin [
19,
40,
43,
47‐
52]. Our research object is FLSs involved in OA, and the different cell type selected is also the reason why the insulin concentration used in this study is different from that of other studies. As the insulin levels were significantly higher in the early stages of T2DM compared with those in non-diabetic individuals, our data may explain why patients with T2DM are more susceptible to OA than non-diabetic individuals. Therefore, although the insulin concentration chosen in our study is supraphysiological, our data still has reference value and clinical guiding significance.
In conclusion, our study demonstrated that insulin exacerbates the inflammatory phenotype involving PI3K/Akt/mTOR/NF-ĸB signaling of OA FLSs. Furthermore, autophagy was identified as another way for insulin to participate in the pathological progression of OA. Therefore, although the detailed regulatory mechanism needs to be further investigated, this study provides molecular evidence that insulin is closely related to OA by regulating the biological activity of FLSs, and blocking insulin-mediated pathway holds potential as a novel treatment strategy.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.